Search

Key to Eurythenes specimens larger than 25 mm. This key is expanded from d’ Udekem d’ Acoz and Havermans (2015), and the caution of use remains. Character differences can be tough to objectively discern, and certain characteristics can be phenotypically variable between cohorts. Visual identification paired with DNA barcoding is strongly recommended. 1. Dactylus of pereopods 3–7 short (less than 0.3 of propodus)....................................................................................................2 Dactylus of pereopods 3–7 long (more than 0.6 of propodus).......................................... Eurythenes obesus (Chevreux, 1905) 2. The palm of gnathopod 2 minutely chelate or very protruding.................................................................................................3 The palm of gnathopod 2 subchelate or weakly protruding......................................................................................................4 3. The anterodorsal margin of the head forming an upturned ridge; posterodistal lobe of the basis of pereopod 7 very long...................................................................................................................... Eurythenes thurstoni Stoddart & Lowry, 2004 The anterodorsal margin of the head not forming an upturned ridge; palm of gnathopod 1 very short; posterodistal lobe of the basis of pereopod 7 short or fairly short................................................................................. Eurythenes atacamensis sp. nov. 4. Pereopods 6–7 and epimerons 1–3 not dorsally keeled to slightly keeled; pereopods 6–7 and epimerons 1–2 dorsally not sigmoid (without anterior concavity), epimeron 3 with distinct anterior concavity..................................................................5 Pereopods 6–7 and epimerons 1–3 dorsally strongly keeled and sigmoid (anteriorly slightly to distinctly concave)................................................................................... Eurythenes sigmiferus d’ Udekem d’ Acoz & Havermans, 2015 5. Eyes of variable width; the outer plate of maxilla 1 with 8/3 crown arrangement...................................................................6 Eyes of constant width; the outer plate of maxilla 1 with 9/3 crown arrangement.............................................................. Eurythenes aequilatus Narahara-Nakano, Nakano & Tomikawa, 2018 6. Article 2 of mandibular palp moderately to strongly expanded posteriorly..............................................................................7 Article 2 of mandibular palp not to weakly expanded posteriorly............................................................................................8 7. Maxilliped with 3 non-protruding nodular spines; pereopod 7 with basis posteriorly strongly expanded, with merus narrow..................................................................................... Eurythenes andhakarae d’ Udekem d’ Acoz & Havermans, 2015 Maxilliped with 8–9 non-protruding nodular spines; pereopod 7 with basis posterior border weakly expanded, with merus stout........................................................................................... Eurythenes maldoror d’ Udekem d’ Acoz & Havermans, 2015 8. Gnathopod 2 palm convex; uropod 1 and 2 rami subequal.......................................................................................................9 Gnathopod 2 palm straight; the outer ramus of uropod 1 and 2 are shorter than paired inner ramus......................................................................................................... Eurythenes magellanicus (H. Milne Edwards, 1848) 9. Ventral corner of eye rounded and obliquely pointing backward; maxilliped with 3–4 protruding nodular spines; gnathopod 1 palm convex....................................................................................................................… Eurythenes plasticus Weston, 2020a Ventral corner of eye sharp and pointing downward; maxilliped with 3–4 non-protruding nodular spines; gnathopod 1 palm straight…........................................................................................................ Eurythenes gryllus (Lichtenstein in Mandt, 1822), Published as part of Weston, Johanna N. J., Espinosa-Leal, Liliana, Wainwright, Jennifer A., Stewart, Eva C. D., González, Carolina E., Linley, Thomas D., Reid, William D. K., Hidalgo, Pamela, Oliva, Marcelo E., Ulloa, Osvaldo, Wenzhöfer, Frank, Glud, Ronnie N., Escribano, Rubén & Jamieson, Alan J., 2021, Eurythenes atacamensis sp. nov. (Crustacea: Amphipoda) exhibits ontogenetic vertical stratification across abyssal and hadal depths in the Atacama Trench, eastern South Pacific Ocean, pp. 1-20 in Marine Biodiversity 51 (51) on page 12, DOI: 10.1007/s12526-021-01182-z, http://zenodo.org/record/5841926, {"references":["d' Udekem d' Acoz C, Havermans C (2015) Contribution to the systematics of the genus Eurythenes S. I Smith in Scudder 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae). Zootaxa 3971: 1 - 80. https: // doi. org / 10.11646 / zootaxa. 4196.3.9","Chevreux E (1905) Description d' un amphipode (Katius obesus, nov. gen. et sp.), suivie d' une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grand eouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bull Inst Oceanogr Monaco 35: 1 - 7","Stoddart HE, Lowry JK (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema 26: 425 - 468","Narahara-Nakano Y, Nakano T, Tomikawa K (2018) Deep-sea amphipod genus Eurythenes from Japan, with a description of a new Eurythenes species from off Hokkaido (Crustacea: Amphipoda: Lysianassoidea). Mar Biodivers 48: 603 - 620. https: // doi. org / 10. 1007 / s 12526 - 017 - 0758 - 4","Milne Edwards H (1848) Sur un crustace amphipode, remarquable par sa grand etaille. Ann Sci Nat Zool 3: 98. https: // doi. org / 10.5962 / bhl. title. 15975","Weston JNJ, Carrillo-Barragan P, Linley TD, Reid WDK, Jamieson AJ (2020 a) New species of Eurythenes from hadal depths of the Mariana Trench, Pacific Ocean (Crustacea: Amphipoda). Zootaxa 4748: 163 - 181. https: // doi. org / 10.11646 / zootaxa. 4748.1.9"]}

Eurythenes atacamensis sp. nov. Weston & Espinosa-Leal (Figures 2–6) http://zoobank.org/51F715E8-AD60-403C-B39A-06F3A3223935 Eurythenes gryllus — Ingram and Hessler 1987: 1889.— Thurston et al. 2002: 205–210, figs. 1–7, table 1.— Jamieson et al. 2019: 1–9, fig. 1, table 1. Eurythenes gryllus Peru-Chile (H)— Ritchie et al. 2015: 121–129, figs.2, 4, tables 1, 2. Eurythenes sp. (Hadal Form)— Eustace et al. 2016: 91–97, fig. 1, fig. 2 (d)(e)(f), fig. 5, tables 2, 3. Material Examined. Holotype: Female, total body length 76.2 mm, Atacama Trench, eastern South Pacific Ocean (23° 22.774′ S, 71° 20.683′ W), expedition SO216, station 4, depth 8052 m, MNHNCL AMP-15816, genseq-1 16S (MW042884), COI (MW048996). Paratypes: Female, total body length 70 mm, Atacama Trench, Pacific Ocean (23° 24.48′ S, 71° 19.91′ W), Atacamex Expedition, station 2, depth 8081 m, MZUC/UCCC 46674. Female, total body length 72 mm, Atacama Trench, Pacific Ocean (23° 24.48′ S, 71° 19.91′ W), Atacamex Expedition, station 2, depth 8081 m, MZUC/UCCC 46675, genseq-2 16S (MW290039), COI (MW288146). Male, total body length 50.8 mm, Atacama Trench, Pacific Ocean (23° 22.384′ S, 71° 23.577′ W), expedition SO216, station 4, depth 7204 m, MNHNCL AMP-15817. Female, type locality, MNHNCL AMP-15822. Intersex, total body length 58.8 mm, Atacama Trench, Pacific Ocean (24° 16.233′ S, 71° 25.386′ W), expedition SO216, station 6, depth 7834 m, MNHNCL AMP-15820, genseq-2 16S (MW042883). Juvenile, total body length 16.1 mm, Atacama Trench, Pacific Ocean (21° 44.497′ S, 71° 15.465′ W), expedition SO216, station 2, depth 6738 m, MNHNCL AMP-15819. Juvenile, total body length 38.4 mm, Atacama Trench, Pacific Ocean (21° 44.497′ S, 71° 15.465′ W), expedition SO216, station 2, depth 6714 m, MNHNCL AMP-15818. Juvenile, Atacama Trench, Pacific Ocean (22° 56.282′ S, 71° 40.686′ W), expedition SO216, station 7, depth 4974 m, MNHNCL AMP-15821. Paragenetype: Juvenile, Atacama Trench, Pacific Ocean (22° 56.282′ S, 71° 40.686′ W), expedition SO216, station 7, depth 4974 m, genseq-2 16S (MW042880). Juvenile, Atacama Trench, Pacific Ocean (20° 20.608′ S, 71° 07.821′ W), expedition SO216, station 10, depth 5920 m, genseq-2 16S (MW042881), COI (MW048993). Female, Atacama Trench, Pacific Ocean (23° 02.998′ S, 71° 15.044′ W), expedition SO216, station 3, depth 7139 m, genseq-2 16S (MW042882), COI (MW048994). Type Locality. Atacama Trench, eastern South Pacific Ocean (23° 22.774′ S, 71° 20.683′ W), expedition SO216, station 4, depth 8052 m. Etymology. The species name, atacamensis, references the type locality, Atacama Trench, of this conspicuously abundant scavenging amphipod. Diagnosis. Lateral cephalic lobe rounded and weakly pronounced. Ventral corner of the eye points linearly downwards. Article 2 of mandibular palp expanded posteriorly but not distally tapering. Maxilliped inner plate with three apical, non-protruding nodular setae. Gnathopod 1 subchelate; palm weakly formed, short. Gnathopod 2 minutely chelate; coxa sub-rectangular and posterior margin slightly rounded; palm obtusely angled. Pereopods 3 to 7 dactylus short. Epimeron 3 ventral margin rounded with a small tooth on the posteroventral corner. Uropod 2 inner ramus longer than outer ramus. Lack of dorsal carination or ridging, specifically at pereonite 3. Description, based on holotype, female, MNHNCL AMP-15816. Body (Fig. 2): surface smooth, without setae; urosomite 3 with an anterodorsal depression. Oostegites present on gnathopod 2 to pereopod 5, setae absent. Coxa gills present on gnathopod 2 to pereopod 7. Colour pattern before ethanol preservation unknown as the holotype was selected post-expedition. Head (Fig. 3): rostrum absent; antennal sinus quadrate (Fig. 3d). Antenna 1 short, 0.13× as long as body length; accessory flagellum 14-articulate; primary flagellum 34- articulate; calceoli absent (Fig. 3a). Antenna 2 2.4× the length of antenna 1, 0.25× as long as body; article 4–5 with brush setae; flagellum 68-articulate with some brush setae; calceoli absent (Fig. 3b). Mouthpart bundle (Fig. 3): Mandible left lacinia mobilis a long slender robust seta with smooth distal margin; incisor smooth and convex; setal row with 11 short, slender, robust setae; molar large, setose, small triturating surface; palp article-length ratio 1: 1.8: 1.6, article 3 sickle-shaped (Fig. 3c). Maxilla 1 inner plate with nine apical plumose setae; outer plate with an 8/3- crown arrangement; palp longer than the outer plate, 2- articulate, four apical and one apicolateral robust setae, with one subapical long setae (Fig. 3e–h). Maxilla 2 both plates broad, inner plate 0.6 × shorter than the outer plate (Fig. 3i). Maxilliped inner plate subrectangular, three apical, non-protruding nodular setae; outer plate subovate; palp 4-articulate, left and right are asymmetric with right palp exceeding past the outer plate, dactylus well-developed, unguis present (Figure 3j–l). Pereon (Figs. 4 and 5): Gnathopod 1 coxa sub-quadrate, weakly concave on anterior and ventral margins; basis, long, length 2.2× breadth; palm weakly formed and short (0.1× as long as the posterior margin of propodus), crenulate with one robust seta at base of the palm and another at the end of palm (Fig. 4a–b). Gnathopod 2 coxa with setae along the posteroventral corner; basis elongate, length 6.9 times width, setae along posterior and ventral margins; posterior margin of merus expanded; propodus sub-rectangular, length 4.5 times width; palm with 2 robust setae on the posterodistal corner; dactylus not reaching palmar corner (Fig. 4c–d). Pereopod 3 coxa sub-quadrate, 1.5× as long as wide, setae on the surface of coxa and along ventral margin; basis expanded posteriorly, 2.3× as long as wide; merus expanded anteriorly, tuft of setae on the anteroventral corner; carpus stout, 0.6× as long as propodus; propodus 3.9× as long as wide; dactylus slender, short 0.3× as long as propodus, unguis present (Fig. 4e). Pereopod 4 coxa broad, 0.9× as long as wide, 1.1× length of coxa 3, the junction between anterior and ventral border bluntly angular (sub-rectangular), ventral border straight, posteroventral border weakly oblique; leg almost identical to pereopod 3 (Fig. 4f). Pereopod 5 coxa sub-rectangular, rounded on both the anterior and posterior margins; basis expanded posteriorly, posterior margin weakly crenulated; merus broadly expanded posteriorly, 1.5× as long as wide, posteroventral margin producing a point; carpus stout, 0.4× as long as propodus; propodus long and slender, 5.5× as long as wide, 11 groups robust setae along anterior margin; dactylus short, 0.4× as long as propodus, unguis present (Fig. 5a). Pereopod 6 coxa sub-rectangular, setae along the ventral margin, posterior margin straight; basis expanded posteriorly with posterior margin crenulated; merus expanded posteriorly, 1.5× as long as wide, convex posterior margin; propodus and dactylus nearly identical to pereopod 5 (Fig. 5b). Pereopod 7 coxa sub-rectangular; basis expanded posteriorly, posterior margin distinctly crenulated, distal lobe weakly protruding; merus broad and strongly expanded posteriorly, subequal length to width; propodus and dactylus nearly identical to pereopod 5 (Fig. 5c). Pleon and urosome (Fig. 5): Epimeron 1 with setae along the anteroventral corner (Fig. 5d). Epimeron 2 with setae along the ventral margin, posteroventral corner produced into a strong tooth (Fig. 5d). Epimeron 3 ventral margin rounded with a small tooth on the posteroventral corner (Fig. 5d). Uropod 1 peduncle with 1 apicomedial seta, rami subequal, outer ramus 0.8× as long as peduncle (Fig. 5e). Uropod 2 peduncle with 2 apicomedial setae, outer ramus subequal in length to peduncle, inner ramus longer than outer ramus (1.2×; Fig. 5f). Uropod 3 setae of the distolateral angle of peduncle of normal length and stoutness; inner ramus subequal in length to article 1 of the outer ramus; outer rami article 2 0.8× the length of article 1, medial margins of both rami with plumose setae (Fig. 5g). Telson 77% cleft, distal margin of each lobe with one robust and one slender setae (Fig. 5h–i). Variations. Prior to ethanol preservation, body colour of specimens ranged from white, pink, crimson, to dark red and the eye shape and colour were more defined (Fig. 6). This wide variation in body pigmentation is likely attributed to the moult/intermoult cycle (Baldwin and Smith 1987). Minor differences were observed between females and the male. The mature male paratype (MNHNCL AMP-15817) had calceoli present on both antennas 1 and 2. The primary flagellum of antenna 1 was 31-articulate with calceoli present between articles 8 and 20, and the accessory flagellum was 12-articulate. Antenna 2 was 65-articulate. The intersex paratype (MNHNCL AMP-15820) had protruding penile papillae that flexed towards each other but lacked calceoli on antenna 1 or 2. As with the holotype, the oostegites were present on pereopod 2–5; however, the flattened oostegites were not of full length relative to the total body length and lacked setae. Moderate differences were present between sexed and juvenile specimens, with fewer setae on pereopods and uropods and a reduction in articulation on antennae. Specifically, in the juvenile paratype (MNHNCL AMP-15818), the antenna 1 accessory flagellum was 10- articulate, antenna 1 was 26-articulate, and antenna 2 was 57-articulate. Further, the juvenile had more pronounced crenulation of the posterior margin of the basis on pereopods 5–7. Feeding and distribution. This species is a benthopelagic scavenger, which is well documented by its rapid aggregation and feeding at baited the camera landers (Fig. 6a; Hessler et al. 1978). As with Eurythenes plasticus, individuals of E. atacamensis sp. nov. have been previously documented to ingest microplastics (Jamieson et al. 2019; Weston et al. 2020a). Eurythenes atacamensis sp. nov. has a wide bathymetric range (>3000 m) across abyssal to hadal depths (4974–8081 m), including the deepest point of the Atacama Trench. This species is considered to have a distribution localized to both sectors of the Peru-Chile Trench. Eurythenes atacamensis sp. nov. is a prominent member of a wider scavenging amphipod community (Fujii et al. 2013). This community is comprised of three species also endemic to the Peru-Chile Trench, Hirondellea thurstoni Kilgallen, 2015, Hirondellea sonne Kilgallen, 2015, and Hirondellea wagneri Kilgallen, 2015. Differential diagnosis. In a genus with cryptic speciation (Havermans et al. 2013), Eurythenes atacamensis sp. nov. has distinct diagnostic features. These features include a smooth dorsal body, the palm of gnathopod 1 being very short, and the palm of gnathopod 2 being minutely chelate with an obtusely angled palm. Eurythenes atacamensis sp. nov. is the most similar morphologically to Eurythenes thurstoni Stoddart & Lowry, 2004, as they both have a minutely chelate gnathopod 2. Yet, E. atacamensis sp. nov. can be readily differentiated by the lack of an upturned ridge on the anterodorsal margin of head (present in E. thurstoni), uropod 2 inner ramus longer than outer ramus (opposed to subequal), and small tooth on the posteroventral corner of epimeron 3 (versus subquadrate). Eurythenes thurstoni is also smaller in total body size, most commonly not longer than 35 mm (Stoddart and Lowry 2004). Additionally, the two species have a disjunct vertical distribution, where E. thurstoni lives at bathyal depths (Stoddart and Lowry 2004; d’ Udekem d’ Acoz and Havermans 2015).

Eurythenes plasticus sp. nov. Weston (Figs. 4���8) Material Examined. HOLOTYPE: Mature female, USNM 1615729, body length 48.1 mm. PARATYPES: Mature male, USNM 1615732, GenBank (16S MT 021437), (COI MT 038070), body length 47.6 mm, Mariana Trench, Pacific Ocean (11.5911N, 144.84730E), cruise FK 141109, station LH14, depth 6010 m. Immature female, USNM 1615733 GenBank (16S MT 021438), (COI MT 038071), body length 38.6 mm, Mariana Trench, Pacific Ocean (11.6071N, 144.8331E), cruise FK 141109, station LH15, depth 6142 m. Juvenile, USNM XXXX3, body length 15.6 mm, same collection location as type locality . PARAGENETYPE: Juvenile, GenBank (16S MT 021439), (COI MT 038072), body length 15.1 mm, same collection location as type locality. NON-TYPE SPECIMENS: Three juveniles, body lengths 12.5, 13.5 & 15.7 mm, same collection location as type locality, USNM 1615731. Type Locality. Mariana Trench, Pacific Ocean (12.64065N, 144.73796E), cruise FK141109, station WT02, depth 6865 m. Etymology. The species names, plasticus, stems from Latin for plastic. This name speaks to the ubiquity of plastic pollution present in our oceans. Diagnosis. Lateral cephalic lobe strongly produced, slightly triangular. Article 2 of mandibular palp narrow. Maxilliped inner plate with three to four apical protruding nodular setae. Gnathopod 1 subchelate, basis narrow (2.9x as long as wide), palm not protruding and weakly convex. Gnathopod 2 subchelate, coxa broad ventrally and weakly curved, palm convex. Pereopods 3 to 7 dactyli short. Pereopod 5 coxa bilobate and posterior lobe larger than anterior lobe. Epimeron 3 posteroventral corner subquadrate without small posteroventral tooth. Uropod 1 and 2 rami margins with spine-like setae. Dorsal carination with increasing degree on epimeron 1-3 and urosomite 1. Description, based on holotype, female, USNM 1615729. BODY (Figs. 4, 5, 6): surface smooth, without setae; urosomite 3 with an anterodorsal depression. Oostegites present on gnathopod 2 to pereopod 5, elongate but lacking setae. Coxa gills present on gnathopod 2 to pereopod 7. Colour pattern at time of recovery unknown. HEAD (Fig. 5): rostrum absent; ventral corner of eye rounded and obliquely pointing backwards (Fig. 5C). Antenna 1 short, 0.1x as long as body length; accessory flagellum 12-articulate; primary flagellum 28-articulate; callynophore well-developed; calceoli absent (Fig. 5A). Antenna 2 medium length, 0.3x as long as body, 1.8x as long as antenna 1; flagellum 59-articulate; calceoli absent (Fig. 5B). MOUTHPART BUNDLE (Fig. 5): Mandible left lacinia mobilis a long slender distally cuspidate robust seta; setal row left with 13 short, slender, robust setae; molar large, setose, vestigial distal triturating patch; palp article length ratio 1: 3.2: 2.6, article 2 posteriorly not expanded and distally not tapering, 3.4x as long as wide; article 3 blade-like (Fig. 5I). Maxilla 1 inner plate with nine apical and sub-apical plumose setae; outer plate with an 8/3 setal crown arrangement; palp longer than outer plate, 2-articulate, seven sub-apical and apical setae with one being a flag seta (Fig. 5H). Maxilla 2 inner and outer plates broad, inner plate 0.6x shorter than outer plate (Fig. 5G). Maxilliped inner plate large, sub-rectangular, four apical protruding nodular setae; outer plate subovate, with 12 apical setose setae; palp large and well-developed; dactylus well-developed, unguis present, six small apical setae (Fig. 5D, F). PEREON (Figs. 6, 7): Gnathopod 1 coxa very weakly anteriorly concave, anteroventral margin with setae; palm crenulate, 0.4x as long as width of propodus, defined by one robust seta at base of palm and another robust seta at end of palm that is 2.6x longer; dactylus curved posteriorly, one long anterodistal seta, unguis present (Fig. 6A, B). Gnathopod 2 subchelate, coxa obovate, broad ventrally and weakly curved; propodus elongate, not expanded distally, 6.1x as long as wide; propodus 2.7x as long as wide, moderately expanded distally; palm crenulate, distal end defined by three robust setae; dactylus not reaching palmar corner, curved posteriorly, unguis present, one long anterodistal seta (Fig. 6A, B). Pereopod 3 coxa sub-rectangular, 2.0x as long as wide, setae on surface of coxa and along ventral and posterior margins; basis weakly expanded posteriorly, 2.7x as long as wide; merus expanded anteriorly, tuft of setae on anteroventral corner; propodus 4.8x as long as wide; dactylus short, 0.4x as long as propodus, unguis present (Fig. 6C). Pereopod 4 coxa broad, 1.2x as long as wide, 1.1x length of coxa 3, junction between anterior and ventral border bluntly angular (sub-rectangular), ventral border straight, posteroventral border straight and weakly oblique; leg almost identical with pereopod 3 (Fig. 6D). Pereopod 5 coxa bilobate, posterior lobe 1.3x longer and 1.6x wider than anterior lobe, ventral border of posterior lobe sub-triangular; basis expanded posteriorly, posterior margin smooth; merus broadly expanded posteriorly, 1.5x as long as wide, curved posterior margin; propodus slender, 6.2x as long as wide, seven groups of robust setae on the anterior margin; dactylus short, 0.4x as long as propodus, unguis present (Fig. 7A). Pereopod 6 coxa subquadrate, posterior margin weakly bilobate or weakly concave; basis expanded posteriorly, posterior margin distinctly crenate; merus broadly expanded posteriorly, 1.7x as long as wide, convex posterior margin; propodus slender, 5.9x as long as wide, eight groups of robust setae on the anterior margin; dactylus slender, short, 0.3x as long as propodus, unguis present (Fig. 7B). Pereopod 7 coxa sub-rectangular; basis with posterior border crenulate and strongly expanded, distal lobe moderately protruding; merus broadly expanded posteriorly, 1.6x as long as wide, convex posterior margin; propodus with normal stoutness, 5.6x as long as wide, eight groups of robust setae on the anterior margin; dactylus slender, short, 0.3x as long as propodus, unguis present (Fig. 7C). PLEON AND UROSOME (Figs. 7, 8): Epimeron 1 anteroventral corner rounded with long slender setae; posteroventral corner produced into a small tooth. Epimeron 2 anteroventral margin lined with short fine setae; posteroventral corner produced into a strong tooth. Epimeron 3 ventral margin lined with long fine setae, weakly curved (Fig. 7D). Urosomite 1 with anterodorsal notch (Fig. 7D). Uropod 1 peduncle with one apicomedial setae; inner ramus subequal in length to outer ramus; outer ramus 0.85x as long as peduncle; outer ramus with 18 lateral and eight medial spine-like setae; inner ramus with 20 lateral and 11 medial spine-like setae (Fig. 8A). Uropod 2 peduncle with one apicomedial setae; inner ramus subequal in length (0.9x) to outer ramus; outer ramus subequal in length to peduncle outer ramus with 20 lateral and three medial spine-like setae; inner ramus with seven lateral and 16 medial spine-like setae (Fig. 8B). Uropod 3 inner ramus subequal in length to article 1 of outer ramus; article 2 of outer rami short, 0.05x length of article 1; setae of distolateral angle of peduncle of normal length and stoutness; medial margins of both rami with plumose setae (Fig. 8C). Telson 70% cleft, pair of apical setae on each lobe parallel with beginning of cleft, distal margin with a single apical seta on right lobe, distal end of left lob missing (Fig. 8D). Variations. As with other species of Eurythenes, there appears to be very little sexual dimorphism. In part, this could be limited to having a single male specimen. The mature male paratype (USNM 1615732) has calceoli present on both antenna 1 and antenna 2. Both antennae are shorter than the holotype with antenna 1 accessory flagellum being 10-articulate, antenna 1 25-articulate, and antenna 2 54-articulate. Additionally, the maxilliped inner plate of the male paratype has three apical protruding nodular setae, specifically lacking the third setae present on the holotype (Fig. 5F). There were differences present in the juvenile paratype (USNM 1615730) that included typical cohort differences among Eurythenes, such as fewer setae on pereopods and uropods and reduced articulation on antennae (antenna 1 accessory flagellum 7-articulate, antenna 1 15-articulate, and antenna 2 38-articulate). In addition, the juvenile paratype had more pronounced and raised dorsal carination than on the adults (Fig. 7E). This difference was present among all the juvenile specimens observed. Differential Diagnosis. As highlighted in d���Udekem d���Acoz & Havermans (2015), the morphological characteristics that separate and define the species within the gryllus -complex are hard to observe and should be used with caution. Eurythenes plasticus sp. nov. is a member of the gryllus -complex morphologically and genetically. Nevertheless, there is a combination of characters that are unique to E. plasticus sp. nov. and allow it to be distinguished from the morphologically similar species E. andhakarae, E. magellanicus, and E. aequilatus. The most distinctive characteristics are the robust, spine-like setae on rami of uropod 1 and 2 (Fig. 8A, B) and the lobes of pereopod 5 coxa (Fig. 7A), here being unequal, which is novel within Eurythenes. Eurythenes plasticus sp. nov. can be differentiated from E. andhakarae with article 2 of the mandible palp being narrow (instead of expanded), four protruding nodular spines on the inner plate of the maxilliped (versus three non-protruding), and straight ventral border of coxa 4 (opposed to curved). Eurythenes plasticus sp. nov. can be separated from E. magellanicus with a long gnathopod 1 palm (instead of short), a straight ventral border of coxa 4 (opposed to curved), a subquadrate posteroventral corner in epimeron 3 (instead of bearing a small tooth), and the rami of uropod 1 and 2 being subequal (opposed to uropod 2 outer ramus being shorter than inner ramus and uropod 1 outer ramus being longer than inner ramus). Eurythenes plasticus sp. nov. can also be distinguished from E. aequilatus by its eyes with a variable width (opposed to constant width), the outer plate of maxilla 1 with 8/3 crown arrangement (instead of 9/3 arrangement), and a long gnathopod 1 palm (instead of short). Habitat, Distribution and Biology. Eurythenes plasticus sp. nov. was collected from the upper hadal depths of the Mariana Trench, between 6010 and 6949 m. Similar to sister species within the genus, E. plasticus sp. nov. is a benthic scavenger, as individuals of multiple cohorts entered the baited traps. Eurythenes plasticus sp. nov. is a member of a wider scavenging amphipod community comprised of A. gigantea, Bathycallisoma schellenbergi (Birstein & Vinogradov, 1958), Hirondellea dubia Dahl, 1959, H. gigas, Paralicella caperesca Shulenberger & Barnard, 1976, Paralicella tenuipe s Chevreux, 1908, and Valettietta anacantha (Birstein & Vinogradov, 1963), which were concurrently recovered in the traps (data unpublished). Discussion The salient finding of this study is the paired molecular and morphological identification approaches provided congruent evidence that E. plasticus sp. nov. represents an undescribed species within Eurythenes. Further, as a scavenger at upper hadal depths (6010 ��� 6949 m) in the Mariana Trench, E. plasticus sp. nov. is not exempt from ingesting microplastics that are bioavailable within the hadal zone. In comparison to described Eurythenes species, E. plasticus sp. nov. was placed as part of the gryllus -complex and most closely related to the abyssal E. magellanicus (Fig. 2). The bPTP analysis of COI and both K2P analyses delineated E. plasticus sp. nov. to be a distinctive lineage, and these methods aligned with previous studies that detected cryptic speciation within the gryllus -complex (Havermans et al. 2013; Eustace et al. 2016; Narahara-Nakano et al. 2017). The 16S phylogeny specifically showed E. plasticus sp. nov. to be nearly identical to Eg7 (Fig. 2A; France & Kocher 1996; Havermans et al. 2013). This Eurythenes sp. was a singleton recovered from abyssal depths at the Horizon Guyot seamount, Pacific Ocean, and it was collected along with another Eurythenes sp. from the divergent Eg9 clade (Havermans et al. 2013). Confidence in the identification of Eg7 would be further strengthened with additional genetic or morphological data. The morphological variation seen in E. plasticus sp. nov., such as an uneven coxa 5 lobe and lack of a tooth on the posteroventral corner of epimeron 3, supported the phylogenetic evidence as an undescribed lineage. Consistent with previous studies, these morphological characteristics should be used with caution, as some are difficult to discern objectively. Additional specimens, like from the Eg7 clade, may reveal phenotypic plasticity in the characteristics observed in this morphological study (d���Udekem d���Acoz & Havermans 2015). Continued application of a combined molecular and morphological approaches in future studies is likely to reveal further species diversity within the gryllus -complex. The discovery of E. plasticus sp. nov. continues to align with the pattern Eurythenes that the geographic and bathymetric species distributions are complex (Havermans 2016). With the Eg7 singleton, the geographic range of E. plasticus sp. nov. thus far appears to be restricted to the Central Pacific Ocean. Across that ocean basin, E. plasticus sp. nov. has broad bathymetric range, ~ 3000 m. While it is common among Eurythenes to be found only in a single ocean basin and have a wide vertical distribution (Eustace et al. 2016; Havermans 2016), it is less common to span across the abyssal and hadal zones. Although, this is not unique, as it has been documented in other amphipods, such as A. gigantea (Jamieson et al. 2013). A species needs to be able to cope at the cellular, reproductive, and physiological levels in both the stable abyssal (Smith et al. 2008) and the dynamic hadal environments (Jamieson 2015; Downing et al. 2018). Yet, it was curious that during the present study, E. plasticus sp. nov. was only collected from upper hadal depths, despite amphipods being captured at shallower and deeper depths (43 additional deployments 4506 to 10545 m; data unpublished). This highlights that the distribution of E. plasticus sp. nov. is a patchwork. Further work and sampling will be required to understand the conditions that support the presence of this species. The finding of a microplastic fibre in the hindgut of a juvenile was not unexpected. Deep-sea scavenging amphipods, as an adaption to their food limited environment, indiscriminately consume carrion (Blankenship & Levin 2007) and are known to inadvertently ingest microfibres present in the carrion and sediment (Jamieson et al. 2019). The detection of a microplastic adds to the number of hadal scavenging amphipods, including adult specimens of H. gigas from the Mariana Trench and Eurythenes sp. ���hadal��� the Peru-Chile Trench (Jamieson et al. 2019), which have been found to have consumed plastic microfibers. Microplastic consumption by a juvenile indicates that scavenging amphipods are potentially ingesting microplastics throughout their life, which could pose acute and chronic health effects. While the ecotoxicological impacts of microplastic exposure has yet to be investigated on deep-sea amphipods, early work on other Malacostraca indicates that the ingestion of polypropylene fibres by the sand crab, Emerita analoga, increases adult mortality and decreases in retention of egg clutches (Horn et al. 2019). This study adds to the growing body of literature on marine organisms ingesting plastic and microfibers (Besseling et al. 2015; Lusher et al. 2015; Bellas et al. 2016; Alomar & Deudero 2017). The microplastic found in the hindgut of E. plasticus sp. nov. was most similar to PET, which is one of the top five most prevalent synthetic plastic polymers produced and discarded globally (Geyer et al. 2017). Without substantial global changes to the life cycle of plastic, from reducing the rate of plastic production to improving waste management (Forrest et al. 2019), plastics and microfibres will continue to be transported to the deep sea and be ubiquitous in the hadal food chain for the foreseeable future., Published as part of Weston, Johanna N. J., Carrillo-Barragan, Priscilla, Linley, Thomas D., Reid, William D. K. & Jamieson, Alan J., 2020, New species of Eurythenes from hadal depths of the Mariana Trench, Pacific Ocean (Crustacea: Amphipoda), pp. 163-181 in Zootaxa 4748 (1) on pages 169-177, DOI: 10.11646/zootaxa.4748.1.9, http://zenodo.org/record/3697667, {"references":["d'Udekem d'Acoz, C. & Havermans, C. (2015) Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae). Zootaxa, 3971 (1), 1 - 80. https: // doi. org / 10.11646 / zootaxa. 3971.1.1","Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin, P., Brix, S., Riehl, T., Agrawal, S. & Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and bipolar species. Public Library of Science One, 8 (9), e 74218. https: // doi. org / 10.1371 / journal. pone. 0074218","Eustace, R. M., Kilgallen, N. M., Ritchie, H., Piertney, S. B. & Jamieson, A. J. (2016) Morphological and ontogenetic stratification of abyssal and hadal Eurythenes gryllus sensu lato (Amphipoda: Lysianassidae) from the Peru-Chile Trench. Deep Sea Research I: Oceanographic Research Papers, 109, 91 - 98. https: // doi. org / 10.1016 / j. dsr. 2015.11.005","France, S. C. & Kocher, T. D. (1996) Geographic and bathymetric patterns of mitochondrial 16 S rRNA sequence divergence amount deep-sea amphipods, Eurythenes gryllus. Marine Biology, 126 (4), 633 - 643.","Havermans, C. (2016) Have we so far only seen the tip of the iceberg? Exploring species diversity and distribution of the giant amphipod Eurythenes. Biodiversity, 17 (1 - 2), 12 - 25. https: // doi. org / 10.1080 / 14888386.2016.1172257","Jamieson, A. J., Lacey, N. C., Lorz, A. N., Rowden, A. A. & Piertney S. B. (2013) The supergiant amphipod Alicella gigantea (Crustacea: Alicellidae) from hadal depths in the Kermadec Trench, SW Pacific Ocean. Deep Sea Research II: Topical Studies in Oceanography, 92, 107 - 113. https: // doi. org / 10.1016 / j. dsr 2.2012.12.002","Smith, C. R., De Leo, F. C., Bernardino, A. F., Sweetman, A. K. & Arbizu, P. M. (2008) Abyssal food limitation, ecosystem structure and climate change. Trends in Ecology & Evolution, 23 (9), 518 - 528. https: // doi. org / 10.1016 / j. tree. 2008.05.002","Jamieson, A. J. (2015) The hadal zone: Life in the deepest oceans, 1 st ed. Cambridge University Press, Cambridge, UK.","Downing, A. B., Wallace, G. T. & Yancey, P. H. (2018) Organic osmolytes of amphipods from littoral to hadal zones: Increases with depth in trimethylamine N-oxide, scyllo - inositol and other potential pressure counteractants. DeepSea Research Part I: Oceanographic Research Papers, 138, 1 - 10. https: // doi. org / 10.1016 / j. dsr. 2018.05.008","Blankenship, L. E. & Levin, L. A. (2007) Extreme food webs: Foraging strategies and diets of scavenging amphipods from the ocean's deepest 5 kilometers. Limnology and Oceanography, 52 (4), 1685 - 1697.","Jamieson, A. J., Brooks, L. S. R., Reid, W. D. K., Piertney, S. B., Narayanaswamy, B. E., & Linley, T. D. (2019) Microplastics and synthetic particles ingested by deep-sea amphipods in six of the deepest marine ecosystems on Earth. Royal Society Open Science, 6 (2), 180667. http: // dx. doi. org / 10.1098 / rsos. 180667","Horn, D., Granek, E. F. & Steele, C. L. (2019) Effects of environmentally relevant concentrations of microplastic fibers on Pacific mole crab (Emerita analoga) mortality and reproduction. Limnology and Oceanography Letters. https: // doi. org / 10.1002 / lol 2.10137","Besseling, E., Foekema, E. M., Van Franeker, J. A., Leopold, M. F., Kuhn, S., Bravo Rebolledo, E. L., Hesse, E., Mielke, L. J. I. J., Ijzer, J., Kamminga, P. & Koelmans, A. A. (2015) Microplastic in a macro filter feeder: Humpback whale Megaptera no- vaeangliae. Marine Pollution Bulletin, 95 (1), 248 - 252. https: // doi. org / 10.1016 / j. marpolbul. 2015.04.007","Bellas, J., Martinez-Armental, J., Martinez-Camara, A., Besada, V. & Martinez-Gomez, C. (2016) Ingestion of microplastics by demersal fish from the Spanish Atlantic and Mediterranean coasts. Marine Pollution Bulletin, 109 (1), 55 - 60. https: // doi. org / 10.1016 / j. marpolbul. 2016.06.026","Alomar, C. & Deudero, S. (2017) Evidence of microplastic ingestion in the shark Galeus melastomus Rafinesque, 1810 in the continental shelf off the western Mediterranean Sea. Environmental Pollution, 223, 223 - 229. https: // doi. org / 10.1016 / j. envpol. 2017.01.015","Geyer, R., Jambeck, J. R. & Lavender Law, K. (2017) Production, use, and fate of all plastic ever made. Science Advances, 3 (7), e 1700782. https: // doi. org / 10.1126 / sciadv. 1700782","Forrest, A., Giacovazzi, L., Dunlop, S., Reisser, J., Tickler, D., Jamieson, A. J. & Meeuwig, J. J. (2019) Eliminating plastic pollution: How a voluntary contribution from industry will drive the circular plastics economy. Frontiers in Marine Science, 6: 627. https: // doi. org / 10.3389 / fmars. 2019.00627"]}

The complete mitochondrial genome of the deep sea amphipod Eurythenes magellanicus was determined in this paper. This molecular was 14,988 bp in length, and contained the typical 13 protein coding ...

The genus Eurythenes S. I. Smith in Scudder, 1882, has been the focus of integrated molecular and morphological taxonomy studies in recent years, resulting in the number of species in the genus increasing from three to eight. Samples of Eurythenes spp. collected using free-fall baited traps from the Porcupine Abyssal Plain (PAP), North East Atlantic Ocean, at 4850 m were examined in this study to investigate the identity of the species found using molecular barcoding methods. Mitochondrial COI analysis confirms the presence of E. maldoror at PAP and data from the nuclear 28S rDNA gene provides independent confirmation of this observation. A new, undescribed species that is clearly divergent from all other known species and molecular lineages was identified, which can be distinguished morphologically from known species. A specimen within the E. magellanicus lineage was also found at the site. We discuss the presence of these three Eurythenes species at the Porcupine Abyssal Plain.

Eurythenes magellanicus (H. Milne Edwards, 1848) (Figs 27���32) Lysianassa magellanica H. Milne Edwards 1848: 398.��� Lucas, 1857: 13, pl. 1 fig. 3.��� Spence Bate, 1862: 66, pl. 10 fig. 5. Eurythenes magellanicus.��� Stebbing, 1906: 73 (in part).��� K.H. Barnard, 1932: 59. Eurythenes gryllus.��� Stoddart & Lowry, 2004: 429, in part, figs. 4���7.���? Senna, 2009: 83, in part, figs. 1���2. Eurythenes gryllus clades Eg 4 and Eg 5.��� Havermans et al., 2013: 12 ���13. Not Eurytenes magellanicus.��� Lilljeborg 1865 a: 11, pls. 1���3.��� 1865 b: 6 (= E. gryllus Lichtenstein in Mandt, 1822). Material examined. Clade Eg 4 of Havermans et al. (2013). RV Meteor, expedition DIVA 3, ME 79 - 1, Brazil Basin, sta. 542, 26�� 33 ' 13 "S 35 �� 11 ' 17 "W, 4480 m, baited trap, 21.vii. 2009: 1 specimen, fixed first 96 % denatured ethanol, coll. Ed Hendrycks, DZMB-HH 7989, ZMH K 44264; BraB- 4, Euryt 77412506 (= EG- 2807114), JX 887145 (COI), JX 887097 (28 S), JX 887073 (16 S).���Same station: 1 specimen, DZMB-HH 7983, ZMH K 44265; BraB- 5, Euryt 77412578 (= EG- 2807117), JX 887145 (COI), JX 887099 (28 S), JX 887074 (16 S).���Same station: 1 specimen, DZMB-HH 7976, ZMH K 44266; BraB- 6, Euryt 77412562 (= EG- 2807116), JX 887145 (COI), JX 887098 (28 S), JX 887073 (16 S).���Same station: 1 specimen, DZMB-HH 7992, ZMH K 44267; BraB- 7, Euryt 77412564 (= EG- 2807112), JX 887146 (COI), JX 887073 (16 S). Clade Eg 5 of Havermans et al. (2013). Same station as for clade Eg 4: 1 female, DZMB-HH 7985, ZMH K 44268; BraB- 2, Euryt 77412554 (= EG- 2807113), JX 887144 (COI), JX 887102 (28 S), JX 887072 (16 S).���Same station: 1 female, DZMB-HH 7980, ZMH K 44269; BraB- 3, Euryt 77412514 (= EG- 2807115), JX 887143 (COI), JX 887100 (28 S), JX 887071 (16 S).���Same station: 1 female fully dissected and illustrated, DZMB-HH 7994, ZMH K 44270; BraB- 1, Euryt 77412540 (= EG- 2807111), JX 887144 (COI), JX 887101 (28 S), JX 88707 (16 S). Specimens not sequenced, or without success. Same station as for clades Eg 4 and Eg 5: 8 specimens, DZMB- HH 8047, CMNC 2014 -0098.���Same station: 7 specimens, DZMB-HH 8047, RBINS, INV. 132167.���Same station: 7 specimens, DZMB-HH 8047, ZMH K 44279.���Same station: 8 specimens, each in a different vial, DZMB-HH 7975, ZMH K 44271; DZMB-HH 7977, ZMH K 44272; DZMB-HH 7978, ZMH K 44273; DZMB- HH 7979, ZMH K 44274; DZMB-HH 7982, ZMH K 44275; DZMB-HH 7986, ZMH K 44276; DZMB-HH 7987, ZMH K 44277; DZMB-HH 7990, ZMH K 44278. Voucher DNA sequences. Clade Eg 4, Brazil Basin, Euryt 77412506. COI (GenBANK JX 887145): AACCTTATATTTCGTCTTAGGCGCCTGAGCTAGGGTTGTTGGTACATCTCTTAGTGTAATTATTCGATCT GAACTCAGTAGACCGGGAAACCTAATTGGAGATGATCAAATCTATAATGTAATAGTAACTGCCCACGC CTTTGTCATAATCTTCTTTATAGTTATACCTATCATAATCGGTGGTTTTGGAAATTGACTTGTACCTCTTA TGCTCGGAAGCCCCGACATAGCTTTCCCGCGCATAAATAATATAAGATTCTGACTCCTGCCCCCCTCAC TAACTTTATTATTAATAAGAGGTCTAGTAGAAAGGGGCGTAGGAACTGGTTGAACAGTCTATCCACCCT TGGCCGCAGCCGCGGCCCACAGCGGAGGGTCTGTTGACCTGGCTATCTTCTCTCTGCACCTAGCAGGT GCTTCCTCCATCTTAGGTGCTATTAATTTTATCTCCACTGTAATCAACATACGAACCCCCGGTATATATAT AGACCGAGTCCCTTTATTTGTCTGGTCTGTCTTCATCACAGCCATTCTACTCCTCTTATCTCTACCCGTA CTGGCAGGTGCAATCACCATACTCCTGACAGACCGAAATCTGAATACTTCCTTCTTTGACCCTAGCGG TGGAGGTGACCCTATCCTCTACCAACATCTATTC 28 S (GenBANK JX 887097): GGCCTGCGGCGGAATGTTGCGTTAAGGGAAAGGTCGTAGTCAAACCCTACAACCACACGAACTCTAA GTCTGCCACGAATAGGCTATCCCAACTAACGGCGGGAGTGACTCCACGGAGGGTGTAAGACCCGTGT GGGCGTGTGTCAATGTTGTATGGGCTCGGCCTCTTCCCTGAGAGTCGCGTTGCTTGAGCATGCAGCGC TAAGCAGGTCGTAAACTCGATCTAAGGCTAAATATTTCCACAGGACCGATAGCAAACAAGTACCGTGA GGGAAAGTTGAAAAGCACTCTGAAGAGAGAGTCAAAAGACCGTGAAACCGCTCAGAGTATAAGCCC ATGGAGCTTGGAAGGCTTCCGCAGCGGCGTGCATCCCTTGTGGGTGTACGTGAGGACATTGTGAAAG GTTCGCTAGGCAGGGGGCATTGAGTTTGCTCCCCACCGCCGTGCTGGTGAATTGCCTGGGAGGAGTC GTGCCTCGGTGCGGCTCTCTTTTGGGTCGTTCTCATGTGTATGAACGTTCAAGGACAATGACCTAATGC GGTACGCCCACCACAGTTTGTTGTGAGGTCACCCACAGGCTCAAACTGTCGATCGTGTGTTCAGTGC GTGGCCTGAATTGTGTGCCGTTCGTAATATAGTGCCACCGTTATCTGTGTGGCGCTCCGGCATGCAGTC GCGCGCTGGACCAGGCGACGAAACGAGTATATCCTGGTATGATCCTCGTGCGACAATCTGATTCTGAC CGAGTGTACATCGCTACCGTTTGGCTCTGCCCATGTGTCGGGCGGAGTCAGGAGGTGCAACCTGATTG TCTGGTCCTCTGAACGATGTAACAGTCGATAAGATCTCAGTCGAGGTAGCGAACGACTCGCGTGGTGT TAAGTCCAGCACCATCGGTCACGTCTCGAAACACGGGCCAAGGAGTATAGCATGTGTGCAAGTCTAA GGGTCTCACAAAACCCGCAGGCGAAGTGAAAGCAAATGGTGTGGCGGGAGCGCTACGGCAATCTCG TCAGCCTTGTGGTGGTCAAAAACTACTCGGCTTAAACCGAGCTGATCCTGTTCTGTTGGCAATGTCTC AAGGCAGGCGCAAGCTCCGGGCTCACATACCAACACTGGCATCCTCACGGGTGCTGTGTTGTGAGCA CCGTGGAGCATGCATGCTATAACCCGAAAGATAGTGAACTATGCC 16 S (GenBANK JX 887073): TGCTATAGGGGTAGCGTATGGTAAGGCCTGCCCAGTGATTTATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAGTCATTTGTCTTTTAATTGGAGGCTGGAATGAAGGGTTTAACAAAAGATAGTGTCT TTATTTTAAATTTGTAATTTATAGTAAGAGTAAAAATACTCTGGTGTGATTAAGGGACGACAAGACCCT AAAAGCTTTATTTTTAGTATTAGTTTGAGTTTAAAATAAAATAGAGAGTTTAACTGGGGTAGTTTTTTTG TAAAATCTGAGGTTGTAGAAGGCATGTAAAGTGGGGTTAGGTCCTTTAGATAAGGATAATTTGAGTGA GTTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGGCTGATTGCGACCTCGAT GTTGAATTAAAAGCTCAGTGTAGAGCAGAAGCTACAGGGTGAGGGTTTGTTCAACCTTTAAATTTTTA, Published as part of D'Acoz, C��dric D'Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), pp. 1-80 in Zootaxa 3971 (1) on pages 41-42, DOI: 10.11646/zootaxa.3971.1.1, http://zenodo.org/record/288816, {"references":["Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398.","Lucas, H. (1857) Animaux nouveaux ou rares recueillis pendant l'expedition dans les parties centrales de l'Amerique du Sud, de Rio de Janeiro a Lima, et de Lima au Para: executee par ordre du gouvernement francais pendant les annees 1843 a 1847, sous la direction du comte Francis de Castelnau. In: Expedition de F. de Castelneau (Amerique du Sud). Part 7: Zoologie. Vol. 3. P. Bertrand, Paris, 204 pp., 20 pls.","Spence Bate, C. (1862) Catalogue of the Specimens of Amphipodous Crustacea in the Collection of the British Museum. Trustees British Museum, London, iv pp., 399 pp., 58 pls.","Stebbing, T. R. R. (1906) Amphipoda. I. Gammaridea. Das Tierreich, 21, 1 - 806.","Barnard, K. H. (1932) Amphipoda. Discovery Reports, 5, 1 - 326.","Stoddart, H. E. & Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468.","Senna, A. R. (2009) The giant deep-sea amphipods (Lysianassoidea: Eurytheneidae) from Brazilian waters. Nauplius, 17 (2), 86 - 96.","Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. & Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218","Lilljeborg, W. (1865 a) On the Lysianassa magellanica H. Milne Edwards and on the Crustacea of the suborder Amphipoda and subfamily Lysianassina found an [sic] the coast of Sweden and Norway. The royal academy press, Uppsala, 37 pp., 5 pls."]}

Key to Eurythenes specimens larger than 25 mm This key should be used with caution, for three reasons: (1) some characters are hard to observe, (2) material examined was limited and (3) the analysis of DNA sequences of specimens not examined morphologically strongly suggests the existence of further, undescribed species. 1. Dactylus of pereopods 3–7 short (less than 0.3 of propodus).................................................... 2 - Dactylus of pereopods 3–7 long (more than 0.6 of propodus)............................................ E. obesus 2. Anterodorsal margin of head not forming an upturned ridge; palm of gnathopod 2 not or weakly protruding; junction between ventral and posteroventral border of coxa 4 distinct; posterodistal lobe of basis of pereopod 7 short or fairly short; pleonite 3 notched dorsally...................................................................................... 3 - Anterodorsal margin of head forming an upturned ridge; palm of gnathopod 2 very protruding; junction between ventral and posteroventral border of coxa 4 indistinct; posterodistal lobe of basis of pereopod 7 very long; pleonite 3 not notched dorsally, showing only a scarcely distinct concavity........................................................ E. thurstoni 3. Coxa 2 ventrally broad and weakly curved................................................................. 4 - Coxa 2 ventrally narrow and strongly curved....................................................... E. maldoror 4. Pereonites 6–7 and pleonites 1–3 not keeled to slightly keeled; pereonites 6–7 and pleonite 1–2 dorsally not sigmoid (without anterior concavity), pleonite 3 with distinct anterior concavity.................................................. 5 - Pereonites 6–7 and pleonites 1–3 strongly keeled and sigmoid (anteriorly slightly to distinctly concave)....... E. sigmiferus 5. Anterior lobe of head protruding; lower lobe of eye rounded and pointing obliquely backwards; inner plate of maxilliped with 3 to 6 nodular spines.................................................................................. 6 - Anterior lobe of head not protruding; lower lobe of eye acute and pointing downwards; inner plate of maxilliped with 3 (sometimes 4 on one side) nodular spines................................................................ E. gryllus 6. Maxilliped with 3 non-protruding nodular spines; pereopod 7 with basis posteriorly strongly expanded, with merus narrow........................................................................................... E. andhakarae - Maxilliped with 4–6 protruding nodular spines; pereopod 7 with basis posteriorly not strongly expanded, with merus rather stout.................................................................................... E. magellanicus

Eurythenes thurstoni Stoddart & Lowry, 2004 Eurythenes gryllus.��� Barnard, 1961: 35, in part, figs. 6���7. Eurythenes thurstoni Stoddart & Lowry, 2004: 451, figs. 16���20.��� Senna, 2009: 86 (table).��� Quadra et al., 2014: 376, figs. 2���3. Material examined. None. Holotype and type locality. Australia, Tasman Sea, SE of Twofold Bay, New South Wales, FRV Kapala, stn K 77 - 19 -03, 37 �� 24 ���S 150 �� 30 ���E to 37 �� 28 ���S 150 �� 33 ���E, 550 m over bottom depth 3658 m, midwater trawl, 0 1.11. 1977, K. Graham, female 33 mm, with 18 juveniles in brood pouch (AM P 62435). Diagnosis. Body not keeled. Pleonite 3 anteriorly not notched as in the gryllus -complex. Anterodorsal margin of head forming an upturned ridge (not observed in other species). Anterior lobe of head acute. Gnathopod 1 with basis very narrow, 3.8 x as long as wide, with palm of propodus protruding. Gnathopod 2 with coxa narrow and rounded ventrally, with propodus narrow, about 3.6 x as long as wide, not expanded, with palm very strongly projecting. Pereopod 3 with coxa very elongate, 2.5 x as long as wide. Coxa 4 with junction between ventral and posteroventral borders indistinct. Pereopod 7 with very long basis, 1.85 x as long as wide, with maximal width on proximal 0.25, with very elongate distal lobe (narrowing distally), 0.23 x as long as total length of basis, with propodus short (not longer than merus). Description. See Stoddart & Lowry (2004). Size. Up to 46 mm but most commonly not longer than 35 mm (Stoddart & Lowry 2004). Distribution and depth range. South Atlantic (Quadra et al. 2014), Australia, Indonesia, Loyalty Islands Basin, Wallis and Futuna Islands, Tonga, Tasman Sea, South Tasmania, New Zealand, Gulf of Mexico, Guadeloupe, 550���1960 m, exceptionally as shallow as 128 m (Stoddart & Lowry 2004). Barnard (1961) records E. thurstoni under the name E. gryllus at much deeper (abyssal) stations (Stoddart & Lowry 2004), but it is possible that they were mesopelagic or upper bathypelagic specimens caught when the trawl was hauled up. Biology. The species is a scavenger, which often enters baited traps. It is frequently captured in midwater trawls (Stoddart & Lowry 2004) suggesting a more pelagic life style than the Eurythenes of the gryllus -complex., Published as part of D'Acoz, C��dric D'Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), pp. 1-80 in Zootaxa 3971 (1) on pages 74-75, DOI: 10.11646/zootaxa.3971.1.1, http://zenodo.org/record/288816, {"references":["Stoddart, H. E. & Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468.","Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128.","Senna, A. R. (2009) The giant deep-sea amphipods (Lysianassoidea: Eurytheneidae) from Brazilian waters. Nauplius, 17 (2), 86 - 96.","Quadra, A., Sorrentino, R., Senna, A. R. & Serejo, C. S. (2014) First record of Eurythenes thurstoni Stoddart & Lowry (2004). (Crustacea: Amphipoda: Lysianassoidea) from the South Mid-Atlantic Ridge. Latin American Journal of Aquatic Research, 42 (2), 376 - 380. http: // dx. doi. org / 10.3856 / vol 42 - issue 2 - fulltext- 8"]}

Eurythenes maldoror sp. nov. (Figs 33���45) Eurythenes gryllus clade Eg 3.��� Havermans et al., 2013: 12���13, fig. 5 (1 B)(2 B)(3 C)(4 B)(6 B)(8 B)(9 B)(10 B)(11 B) (12 B)(14 B)(15 B), table 4. Material examined. HOLOTYPE. RV Meteor, expedition ME 79 - 1, DIVA 3, Argentine Basin, sta. 531, 35�� 56.50 ���S 48 �� 53.90 ���W, amphipod trap, 4605.2 m, 15.vii. 2009: 1 adult male, 100 mm, HOLOTYPE, partly dissected (dissected parts in alcohol), fixed first 96 % denatured ethanol, coll. Ed Hendrycks, DZMB-HH 8048, ZMH K 44280; ArgB- 7, EG- 1810111, JX 887151 (COI), JX 887069 (16 S). PARATYPES. Same station as holotype: 1 immature specimen (illustrated in detail), sex unknown, 41 mm, sample 1, ZMH K 44281; EG- 21012010 - 12 (sequencing failed).���Same station: 1 immature specimen, previously dissected, sample 2, ZMH K 44282.���Same station: 1 immature specimen, sample 3, ZMH K 44283.���Same station: 1 immature specimen, sample 4, ZMH K 44284, ArgB- 1, EG- 1102101, JX 887121 (COI), JX 887105 (28 S), JX 887067 (16 S).���Same station: 30 immature specimens, sample 5, ZMH K 44285.���Same station: 5 immature specimens, sample 6, CMNC 2014 -0099.���RV Polarstern, expedition PS 61, ANT-XIX/ 4, ANDEEP II, sta. 131 - 1, East of Antarctic Peninsula, 65 �� 17 'S 51 �� 35 'W, 3070 m, 08.iii. 2002, baited traps M 16, M 17, MP 10, MP 35: 2 immature specimens, sample 7, RBINS, INV. 122791; Ant-a 3, EG-0112102, JX 887123 (COI), JX 887103 (28 S), JX 887067 (16 S); Ant-a 4, EG-P 3049, GU 109270 (COI), JX 887104 (28 S), JX 887067 (16 S).���RV Polarstern, expedition PS 67, ANT-XXII/ 3, ANDEEP III, Eastern Weddell Sea, sta. 59 - 1 / 59 -15, 67�� 30 '00"S 00��00'06"E to 67 �� 30 '03"S 00��00'02"E, 4625 m, baited trap, 14���16.ii. 2005: 2 immature specimens, sample 8, RBINS, INV. 122792; not sequenced, previously mixed with 7 E. andhakarae.���ANT-XXII/ 3, sta. 110 - 1 / 110 -9, 64�� 56 ' 21 "S 43 ��08'01"W to 64 �� 56 ' 26 "S 43 ��08'07"W, 4693���4696 m, baited trap 09��� 10.iii. 2005: 1 immature specimen, sample 9, RBINS, INV. 122793; not sequenced. Voucher DNA sequences. Holotype, ArgB- 7, EG- 1810111. COI (GenBANK JX 887151): GACCTTATACTTCGTCTTAGGTGCCTGAGCTAGGGTCGTCGGCACATCTCTTAGTGTAATTATTCGATCT GAACTCAGTAGACCGGGAAACCTAATTGGAGATGATCAGGTCTATAACGTGATAGTAACTGCCCACGC CTTTGTTATAATCTTCTTTATAGTTATACCTATTATAATTGGCGGTTTTGGAAATTGACTAGTCCCCCTTAT ACTTGGGAGCCCCGACATAGCTTTCCCGCGCATAAACAACATAAGATTCTGACTACTACCCCCCTCAC TAACCTTATTACTAATAAGAGGCCTAGTAGAAAGGGGGGTAGGAACTGGTTGAACCGTTTACCCTCCC TTAGCCGCAGCCGCAGCCCACAGTGGGGGATCTGTTGACCTGGCGATCTTCTCTCTCCACCTAGCAGG TGCTTCTTCCATTTTAGGTGCCATCAATTTTATCTCCACTGTAATTAACATACGAACCCCTGGTATATATA TAGACCGAGTGCCCTTATTTGTCTGGTCCGTCTTCATCACAGCCATTCTGCTCCTCTTATCTCTACCTGT ACTAGCTGGTGCAATTACCATACTCCTAACAGACCGAAATCTAAATACTTCCTTCTTCGATCCTAGGGG TGGAGGTGACCCTATCCTTTACCAACACCTATTC 28 S (GenBANK JX 887069): TGCTATAAGGGTAGTGTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACC GTGCTAAGGTAGCATAGTCATTTGTCTTTTAATTGGAGGCTGGAATGAAGGGTTTAACAAAGGATAGT GTCTTTGTTTTAAATTTGTAATTTATAACAAGAGTAAAAATACTCTGGTGTGATTAAGGGACGACAAGA CCCTAAAAGCTTTATTTTTAAGATAAGTTTGAGTTTAATATAGAATAGAGAGTTTAACTGGGGTAGTTTT TTTGTAAAATCTGAGGTTGTAAAAGGCATGTAAAGTGGGGTTAGGTCCTTTAGATAAGGATAATTTGA GTGAGTTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGATTGATTGCGACCT CGATGTTGAATTAAAAGATCAGTGTAGAGCAGGAGCTACAGGGTGAGGGTTTGTTCAACCTTTAAATT TTTA Type locality. NW of Argentinian Basin, off Argentina, not far from the maritime border between Argentina and Uruguay, 35 �� 56.50 ���S 048�� 53.90 ���W, 4605 m. Etymology. Maldoror, ghastly character of the tale ���Les Chants de Maldoror��� by Lautr��amont, nom de plume of Isidore Lucien Ducasse (French poet born in Uruguay, 04.04.1846 ��� 24.11.1870). Maldoror is a phonetic transposition of ���mal d���aurore���, which can be translated as ���pain of the dawn��� or even 'pain caused by the glow of dawn'. This name has been coined bearing in mind that this species thrives at great depths where sunlight is absent. The name is a noun in apposition. Description. If not specified, the description applies both to the 100 mm male holotype and to the 41 mm immature paratype examined and dissected. Body: pleosomite 3 with anterior concavity; other pleosomites and pereonites without anterior concavity. Head: anterior lobe of head strongly produced; ventral corner of eye blunt and pointing obliquely backwards. Mandible: article 2 of palp strongly expanded posteriorly and strongly tapering distally. Maxilliped: inner plate with 8���9 (adult holotype) or 3 (immature) nodular spines, which are not protruding. Gnathopod 1: coxa very weakly concave anteriorly; basis narrow, 3.3 x as long as wide; palm well developed, slightly but distinctly produced. Gnathopod 2: coxa narrow and strongly curved ventrally; propodus elongate and not expanded distally in holotype, much broader and flaring in immature, 2.8 (immature) to 5.2 (adult) x as long as wide, palm slightly curved and transverse, defined by 2 spines only, both in immature and in adult holotype. Pereopod 3: coxa narrow, 2.0 (immature) to 2.2 (adult holotype) x as deep as wide; basis slender, 3.2 (immature) to 3.8 (adult holotype) x as long as wide; propodus slender, 4.9 (immature) to 6.5 (adult) x as long as wide; dactylus slender. Pereopod 4: coxa narrow, 1.3 x as deep as wide; junction between anterior and ventral border rounded, indistinct (adult holotype) or nearly indistinct (immature); ventral border distinctly curved; posteroventral border very weakly concave (adult holotype) or straight (immature), scarcely oblique; leg almost identical with pereopod 3. Pereopod 5: basis with posterior border weakly crenulated (immature) or completely smooth (adult holotype); merus broad, 1.9 x as long as wide, with posterior border forming a regular curve; propodus slender, 6.1 (immature) to 8.3 (adult holotype) x as long as wide, with 9 (immature) to 13 (adult holotype) groups of spines anteriorly; dactylus slender. Pereopod 6: basis with posterior border scarcely crenulated (crenulation especially faint, scarcely distinct in adult); merus broad, 1.7 (immature) to 1.9 (adult) x as long as wide, with posterior border extremely convex, becoming less convex near its distal end; propodus slender, 6.6 (immature) to 8.5 (adult holotype) x as long as wide; with 10 (immature) to 11 (adult holotype) groups of spines anteriorly; dactylus slender. Pereopod 7: basis elongate, with posterior border weakly expanded, with posterior border scarcely crenulated (crenulation especially faint, scarcely distinct in adult), with ornamentation of anterior border reduced (especially in adult holotype: just a few setae and no spines), 1.6 x as long as wide; with posterodistal corner of lobe scarcely produced and rounded (with very weak trace of angular discontinuity) in adult holotype), regularly rounded in immatures, ratio length of lobe of basis / total length of basis = 0.21 (immature) to 0.25 (adult holotype); merus stout, 1.7 (adult holotype) to 1.8 x as long as wide, with posterior border forming a regular curve (very convex in adult holotype); propodus slender, 5.7 (immature) to 6.8 (adult) x as long as wide, with 9 (immature) to 11 (adult holotype) groups of spines anteriorly; dactylus slender. Epimeron 3: straight ventrally (adult holotype) or scarcely curved (immatures), without small posteroventral tooth in specimens between 25 and 35 mm. Uropod 3: spines of distolateral angle of peduncle rather long and very slender. Colour pattern. The holotype was entirely pink, with the pigmentation more intense on the posterior margin of body segments, on the margins of coxae, on antennae, mouthparts, the tips of pereopods and uropods. Eye pale yellow. Size. Up to 100 mm (holotype). Distribution and depth range. Specimens examined were collected in the Weddell Sea and in the north of the Argentinian basin, between 3076���4693 m. DNA sequences of GenBank suggests that the species is also widely distributed in the North Atlantic and the North Pacific (Havermans et al. 2013) and can descend down to 5117 m depth. A photograph accessible at: http://lysianassidae.myspecies.info/sites/lysianassidae.myspecies.info/files/ Amphipod% 20 -% 20 MDSC 0728.jpg [accessed on 28.01.2013] possibly shows a specimen of E. maldoror sp. nov. The sampling locality of this specimen is the Peru ��� Chile Trench, 04�� 27.016 ���S 81 �� 54.719 ���W, at 5329 m (Kilgallen, pers. comm.). Biology. E. maldoror sp. nov. is a scavenger, which enters baited traps, albeit not in large numbers. With the exception of one adult male, all specimens examined by us were immature, which suggests some kind of biological segregation of size classes. Remarks. Unlike several other Eurythenes species, E. maldoror sp. nov. exhibits a very clear-cut diagnostic character separating it a first glance from similar species described so far. Indeed whilst other Eurythenes of the gryllus -complex have coxa 2 ventrally broadened and weakly convex, in E. maldoror sp. nov. the same structure is ventrally narrow and strongly convex., Published as part of D'Acoz, C��dric D'Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), pp. 1-80 in Zootaxa 3971 (1) on pages 50-63, DOI: 10.11646/zootaxa.3971.1.1, http://zenodo.org/record/288816, {"references":["Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. & Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218"]}

Eurythenes obesus (Chevreux, 1905) (Fig. 46) Katius obesus Chevreux, 1905: 1, figs. 1���3.��� Schellenberg, 1926: 217, fig. 26 d.��� K.H. Barnard, 1932: 36, fig. 21, pl. 1 fig. 1.��� Chevreux, 1935: 63 ���65, pl. 10 fig. 4, 6, pl. 11 fig. 10.��� Shoemaker, 1956: 177. Eurythenes gryllus.��� Stephensen, 1933: 12, in part, fig. 6 only. Eurythenes obesus.��� Barnard, 1961: 38, fig. 8.��� Bellan-Santini & Ledoyer, 1974: 680, pl. 25.��� Stoddart & Lowry, 2004: 445, figs. 12���15 (ubi syn.).��� Senna & Serejo, 2008: 374, figs. 1���2.��� Senna, 2009: 88, fig. 3. Material examined. Tjalfe sta. 15, off SE Greenland, 58 ��08'N 39 �� 24 'W, 500 m wire, ring trawl, 26.05.1908: 2 specimens, TSZCr. 2722.���Station ANO 315 -D 704 [or DT04???] (the coordinates could not be traced), no date: 2 specimens, with a label concerning colour notes: small one, gray and pale pink; large one, bright red, leg. J.B., TSZCr 19070. ���RV Polarstern, expedition PS 79, ANT-XXVIII/ 3, Southern Ocean, mid of Atlantic sector, sta. 141 -7, 51�� 15.95 ���S 12 �� 37.70 ���W, 4109.5 m, Agassiz Trawl, 18.ii. 2012: 1 specimen, leg. C. Havermans, RBINS, INV. 122852, Eob-C 103, ANT 283 - 103 (COI).���ANT-XXVIII/ 3, NW of South Georgia, sta. 172 -3, 49�� 12.81 ���S 38 �� 12.97 ���W, 0 m, Rectangular Midwater Trawl, 01.iii. 2012: 1 specimen, leg. C. Havermans, RBINS, INV. 122853, Eob-C 112, ANT 283 - 112 (COI). Voucher DNA sequences. Eob-C 103, COI: TGAGCTAGCGTTGTAGGCACATCCCTAAGCCTAGTTATTCGATCTGAGCTCAGTGGGCCAGGAAATCT AATTGGAGATGACCAAATCTATAACGTAATAGTAACTGCTCACGCCTTCGTAATAATCTTCTTTATAGTT ATACCTATTATAATCGGAGGATTTGGCAATTGACTGGTCCCCCTTATACTAGGGAGCCCTGACATAGCTT TCCCACGGATAAATAACATAAGATTCTGACTACTGCCCCCCTCACTAACCTTGTTACTGATAAGGGGAT TAGTAGAGAGAGGCGTAGGAACAGGCTGGACCGTTTACCCCCCCCTAGCCGCAGCCGCAGCTCATAG CGGAGGATCTGTTGACCTAGCTATCTTCTCCCTTCATCTAGCGGGAGCCTCTTCTATTTTAGGGGCTATC AACTTTATCTCTACCGTAATTAACATGCGAGCCCCTGGGATATATATAGACCGCGTCCCTTTATTTGTCT GGTCGGTCTTCATCACAGCCATTCTTCTACTCTTATCCCTACCAGTATTAGCGGGTGCAATTACAATACT CTTAACAGACCGAAATCTAAATACCTCCTTTTTCGACCCTGGCGGGGGAGGTGACCCCATTCTTTACC AGCACCTATTT Type specimens and localities. Types not examined. Chevreux���s holotype specimen of E. obesus was a 12 mm male sampled south of the Azores, in the eastern North Atlantic Ocean: Prince of Monaco sta. 1849, 36�� 17 'N 28 �� 53 'W, 0���3000m over 3400m, filet Richard �� grande ouverture, 8.9.1904, 08: 25 ��� 11: 55 hrs. This specimen has been lost and Stoddart & Lowry (2004) have designated a neotype: female 48 mm, with setose oostegites and hatchlings (BMNH 2003.1059), RRS Discovery, stn 9541 # 30, NE of Cape Verde Islands, eastern North Atlantic Ocean, 20 �� 1.8 ���N 21 �� 19.8 ���W to 20 �� 1.3 ���N 21 ��20.0���W, 995���1500 m over bottom depth 3800���3850 m, rectangular midwater trawl RMT 8, 22.4.1977, 19: 21���23: 21 hrs. Description. See e.g. Stoddart & Lowry (2004). Diagnostic characters. E. obesus is characterized by the extremely long dactylus of its pereopods 3���7. The eye of E. obesus is narrowly linear instead of being broad and nearly L-shaped' as in the Eurythenes of the gryllus - complex. Colour pattern. Specimen of ANT-XXVIII/ 3, sta. 172 - 3: pale orange; merus, carpus, propodus and dactylus of pereopods 6���7 pale pink; eye whitish (see figure 46). The label of the two specimens of Station ANO 315 -D 704 indicates: small one, gray and pale pink; large one, bright red. So, it seems that E. obesus exhibits colour variation similar to E. gryllus and E. andhakarae sp. nov. Size. Up to 80 mm (Stoddart & Lowry 2004). Distribution and depth range. Cosmopolitan, exceptionally near the surface (present material), normally between 128 m and 1600 m, most commonly below 1000 m (Stoddart & Lowry 2004; Senna & Serejo 2008). One of the specimens recorded here was found in a trawl used at 4110 m, but it is likely that it was caught in the water column when the net was hauled up. Biology. It suffices to repeat herein the account of Stoddart & Lowry (2004). ���Very little is known of the life habits of E. obesus. It has never been taken in baited traps; has frequently been taken in midwater trawls; and has once been recorded as burrowing into a salp (Stephensen 1915), once as having coelenterate remains in the stomach (Hopkins 1985), once with possibly siliceous sponge spicules in the stomach (Brusca 1967), and once as attacking fish taken in midwater trawls (Thurston & Bett 1995).��� Remarks. In the absence of relevant studies, it is not known whether E. obesus is genetically homogeneous or not across its nearly cosmopolitan range of distribution., Published as part of D'Acoz, C��dric D'Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), pp. 1-80 in Zootaxa 3971 (1) on pages 64-65, DOI: 10.11646/zootaxa.3971.1.1, http://zenodo.org/record/288816, {"references":["Chevreux, E. (1905) Description d'un amphipode (Katius obesus, nov. gen. et sp.), suivie d'une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grande ouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bulletin du Musee oceanographique de Monaco, 35, 1 - 7.","Schellenberg, A. (1926) Amphipoda 3: Die Gammariden der Deutschen Tiefsee-Expedition. Wissenschaftliche Ergebnisse der Deutschen Tiefsee-Expedition auf dem Dampfer Valdivia 1898 - 1899, 23 (5), 193 - 243, pl. 5.","Barnard, K. H. (1932) Amphipoda. Discovery Reports, 5, 1 - 326.","Chevreux, E. (1935) Amphipodes provenant des campagnes du Prince Albert Ier de Monaco. Resultats des Campagnes scientifiques accomplies sur son Yacht par Albert Ier Prince Souverain de Monaco, 90, 1 - 214, pls. 1 - 16.","Shoemaker, C. R. (1956) Notes on the amphipods Eurythenes gryllus (Lichtenstein) and Katius obesus Chevreux. Proceedings of the Biological Society of Washington, 69, 177 - 178.","Stephensen, K. (1933) The Godthaab expedition 1928. Meddelelser om Gronland, 79 (7), 1 - 88.","Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128.","Bellan-Santini, D. & Ledoyer, M. (1974) Gammariens (Crustacea - Amphipoda) des iles Kerguelen & Crozet. Tethys, 5 (4), 635 - 708.","Stoddart, H. E. & Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468.","Senna, A. R. & Serejo, C. S. (2008) First record of Eurythenes obesus (Chevreux, 1905) (Amphipoda, Lysianassoidea, Eurytheneidae) in Brazilian waters. Arquivos do Museu Nacional, Rio de Janeiro, 66 (2), 373 - 379.","Senna, A. R. (2009) The giant deep-sea amphipods (Lysianassoidea: Eurytheneidae) from Brazilian waters. Nauplius, 17 (2), 86 - 96.","Stephensen, K. (1915) Isopoda, Tanaidacea, Cumacea, Amphipoda (excl. Hyperiidea). Report on the Danish Oceanographical Expeditions 1908 - 10 to the Mediterranean and Adjacent Seas, Biology (D 1), 2, 1 - 53.","Hopkins, T. L. (1985) Food web of an Antarctic midwater ecosystem. Marine Biology, 89, 197 - 212. http: // dx. doi. org / 10.1007 / BF 00392890","Brusca, G. J. (1967) The ecology of pelagic Amphipoda. I. Species accounts, vertical zonation and migration of Amphipoda from the waters off Southern California. Pacific Science, 21 (3), 382 - 393.","Thurston, M. H. & Bett, B. J. (1995) Hatchling size and aspects of biology in the deep-sea amphipod genus Eurythenes (Crustacea: Amphipoda). Internationale Revue der Gesamten Hydrobiologie, 80 (2), 201 - 216. http: // dx. doi. org / 10.1002 / iroh. 19950800209"]}

Key to Eurythenes specimens larger than 25 mm This key should be used with caution, for three reasons: (1) some characters are hard to observe, (2) material examined was limited and (3) the analysis of DNA sequences of specimens not examined morphologically strongly suggests the existence of further, undescribed species. 1. Dactylus of pereopods 3���7 short (less than 0.3 of propodus).................................................... 2 - Dactylus of pereopods 3���7 long (more than 0.6 of propodus)............................................ E. obesus 2. Anterodorsal margin of head not forming an upturned ridge; palm of gnathopod 2 not or weakly protruding; junction between ventral and posteroventral border of coxa 4 distinct; posterodistal lobe of basis of pereopod 7 short or fairly short; pleonite 3 notched dorsally...................................................................................... 3 - Anterodorsal margin of head forming an upturned ridge; palm of gnathopod 2 very protruding; junction between ventral and posteroventral border of coxa 4 indistinct; posterodistal lobe of basis of pereopod 7 very long; pleonite 3 not notched dorsally, showing only a scarcely distinct concavity........................................................ E. thurstoni 3. Coxa 2 ventrally broad and weakly curved................................................................. 4 - Coxa 2 ventrally narrow and strongly curved....................................................... E. maldoror 4. Pereonites 6���7 and pleonites 1���3 not keeled to slightly keeled; pereonites 6���7 and pleonite 1���2 dorsally not sigmoid (without anterior concavity), pleonite 3 with distinct anterior concavity.................................................. 5 - Pereonites 6���7 and pleonites 1���3 strongly keeled and sigmoid (anteriorly slightly to distinctly concave)....... E. sigmiferus 5. Anterior lobe of head protruding; lower lobe of eye rounded and pointing obliquely backwards; inner plate of maxilliped with 3 to 6 nodular spines.................................................................................. 6 - Anterior lobe of head not protruding; lower lobe of eye acute and pointing downwards; inner plate of maxilliped with 3 (sometimes 4 on one side) nodular spines................................................................ E. gryllus 6. Maxilliped with 3 non-protruding nodular spines; pereopod 7 with basis posteriorly strongly expanded, with merus narrow........................................................................................... E. andhakarae - Maxilliped with 4���6 protruding nodular spines; pereopod 7 with basis posteriorly not strongly expanded, with merus rather stout.................................................................................... E. magellanicus, Published as part of D'Acoz, C��dric D'Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), pp. 1-80 in Zootaxa 3971 (1) on pages 9-10, DOI: 10.11646/zootaxa.3971.1.1, http://zenodo.org/record/288816

Eurythenes andhakarae sp. nov. (Figs 1���11) Eurythenes gryllus clade Eg 2.��� Havermans et al., 2013: 14, fig. 5 (13 A)(14 A)(15 A), table 4. Material examined. HOLOTYPE. RV Polarstern, expedition PS 61, ANT-XIX/ 3, ANDEEP II, sta. 131 - 1, East of Antarctic Peninsula, 65 �� 17 ' 50 "S 51 �� 35 ' 13 "W to 65 �� 17 ' 53 "S 51 �� 35 ' 17 "W, 3069���3076 m, baited trap T6, 05��� 08.iii. 2002: 1 immature, sex unknown, 34 mm, dissected, absolute alcohol, RBINS, INV. 122772; Ant-a 1, EG- 0 112105, JX 887112 (COI), JX 887065 (16 S), JX 887078 (28 S). PARATYPES. Same station as holotype: 2 specimens, absolute alcohol, RBINS, INV. 122775; Ant-a 2, EG- 0 112104, JX 887116 (COI), JX 887077 (28 S), JX 887065 (16 S).���RV Polarstern, expedition PS 67, ANT-XXII/ 3, ANDEEP III, eastern Weddell Sea, sta. 59 - 1 / 59 - 15, baited trap, 67 �� 30 '00"S 00��00'06"E to 67 �� 30 '03"S 00��00'02"E, 4625 m, 14���16.ii. 2005: 1 specimen, absolute alcohol, RBINS, INV. 122777; WDL-a 2, EG-0112101, JX 887138 (COI), JX 887075 (28 S), JX 887065 (16 S).���Same station: 1 specimen, left pereopod 5 and pereopod 6 dissected and illustrated, absolute alcohol, RBINS, INV. 122776.���Same station: 7 specimens, absolute alcohol, RBINS, INV. 122774; one specimen (not isolated) has been sequenced: WDL-a 1, EG- 21101012, JX 887114 (COI), JX 887079 (28 S), JX 887065 (16 S).���Same station: 95 specimens, absolute alcohol, RBINS, INV. 122770.���Same station: 10 specimens, absolute alcohol, ZMH K 44263.���Same station: 10 specimens, absolute alcohol, CMNC 2014 -0097.���ANT-XXII/ 3, northern Weddell Sea, sta. 110 - 1 / 110 -9, 64�� 56 ' 21 "S 43 ��08'01"W to 64 �� 56 ' 26 "S 43 ��08'07"W, 4693���4696 m, baited trap, 10.iii. 2005: 18 specimens, absolute alcohol, RBINS, INV. 122771; 5 specimens were sequenced: WDL-b 1, EG- 28071113: JX 887116 (COI), JX 887081 (28 S), JX 887065 (16 S); WDLb 2, EG- 28071114: JX 887119 (COI), JX 887066 (16 S); WDL-b 3, EG- 28071115: JX 887116 (COI), JX 887081 (28 S), JX 887065 (16 S); WDL-b 4, EG- 28071116: JX 887115 (COI), JX 887078 (28 S), JX 887065 (16 S); WDL-b 5, EG- 28071117: JX 887065 (16 S).���ANT-XXII/ 3, Weddell Sea / Scotia Sea, sta. 142 - 1 / 142 -8, 62�� 12.40 'S 49 �� 31.67 'W to 62 �� 12.18 'S 49 �� 28.18 'W, 3407���3411 m, baited trap, 18.iii. 2005: 5 specimens, RBINS, INV. 122773; 4 specimens were sequenced: WDL-c 1, EG- 2807118, JX 887117 (COI), JX 887065 (16 S); WDL-c 2, EG- 2807119, JX 887113 (COI), JX 887065 (16 S); WDL-c 3, EG- 28071110, JX 887116 (COI), JX 887080 (28 S), JX 887065 (16 S); WDL-c 4, EG- 28071111, JX 887118 (COI), JX 887078 (28 S), JX 887065 (16 S). NON-TYPE SPECIMENS. RV Polarstern, expedition PS 67, ANT-XXII/ 3, ANDEEP III, eastern Weddell Sea, sta. 81 - 1 / 81 - 10, trap M14, 70�� 31.63 'S 14 ��35.00'W to 70 �� 33.72 'S 14 ��30.00'W, 4412���4449 m, 23���24.ii. 2005, initial fixation in formalin, coll. C. De Broyer and B. Danis: 15 medium-sized and adults (some specimens photographed), RBINS, INV. 122767.���Same station: about 60 small and medium-sized specimens, RBINS, INV. 122768.���Same station: about 100 small and medium-sized specimens, RBINS, INV. 122769. Voucher DNA sequences. HOLOTYPE, Ant-a 1, EG-0112105. COI (GenBANK JX 887112): AACCTTGTACTTCGTTTTAGGTGCCTGAGCTAGAGTTGTTGGCACATCTCTTAGTGTTATTATTCGGTCT GAACTCAGTGGACCGGGAAACCTAATTGGAGATGATCAAATCTATAACGTAATAGTAACTGCCCACGC CTTTGTTATAATCTTCTTTATAGTTATACCTATTATAATTGGCGGATTTGGAAATTGGTTAGTCCCCCTAAT ACTTGGAAGCCCCGACATAGCTTTCCCGCGCATAAACAACATAAGATTTTGACTGCTGCCCCCCTCAC TGACCCTATTATTAATAAGAGGTCTGGTAGAAAGCGGTGTAGGAACCGGTTGAACAGTCTACCCACCC TTGGCCGCAGCCGCGGCCCACAGCGGGGGCTCTGTTGACCTGGCTATCTTCTCTCTTCACCTAGCAGG TGCTTCTTCCATCTTGGGCGCCATTAACTTCATCTCCACTGTAATTAACATGCGAACCCCTGGTATATAT A 28 S (GenBANK JX 887078): GGCCTGCGGCGGAATGTTGCGTTAAGGGAAAGGTCGTAGTCAAACCCTACAACCACACGAACTCTAA GTCTGCCACGAATAGGCTATCCCAACTAACGGCGGGAGTGACTCCACGGAGGGTGTAAGACCCGTGT GGGCGTGTGTCAATGTTGTATGGGCTCGGCCTCTTCCCTGAGAGTCGCGTTGCTTGAGCATGCAGCGC TAAGCAGGTCGTAAACTCGATCTAAGGCTAAATATTTCCACAGGACCGATAGCAAACAAGTACCGTGA GGGAAAGTTGAAAAGCACTCTGAAGAGAGAGTCAAAAGACCGTGAAACCGCTCAGAGTATAAGCCC ATGGAGCTTGGAAGGCTTCCGCAGCGGCGTGCATCCCTTGTGGGTGTACGTGAGGACATTGTGAAAG GTTCGCTAGGCAGGGGGCAATCGAGTTTGTTACCCACCGCCGTGCTGGTGAATTGCCTGGGAGGAGT CGTGCCTCGGTGCGGCTCTCTTTTGGGTCGTTCTCATGTGTATGAACGTTCAAGGACAATGACCTAATG CGGTACGCCCACCACAGTTTGTTGTGAGGTCACCCACAGGCTCAAACTGTCGATCGTGTGTTCAGTG CGTGGCCTGAATTGTGTGCCGTTCGTAATATAGTGCCACCGTTATCTGTGTGGCGCTCCGGCATGCAGT CGCGCGCTGGACCAGGCGACGAAACGAGTATATCCTGGTATGATCCTCGTGCGACAATCTGATTCTGA CCGAGTGTACATCGCTACCGTTTGGCTCTGCCCATGTGTCGGGCGGAGTCAGGAGGTGCAACCTGATT GTCTGGTCCTCTGAACGATGTAACAGTCGATAAGATCTCAGTCGAGGTAGCGAACGACTCGCGTGGT GTTAAGTCCAGCACCATCGGTCACGTCTCGAAACACGGGCCAAGGAGTATAGCATGTGTGCAAGTCT AAGGGTCTCACAAAACCCGCAGGCGAAGTGAAAGCAAATGGTGTGGCGGGAGCGCTACGGCAATCT CGTCAGCCTTGTGGTGGTCAAAAACTACTCGGCTTAAACCGAGCTGATCCTGTTCTGTTGGCAATGTC TCAAGGCAGGCGCAAGCTCCGGGCTCACATACCAACACTGGCATCCTCACGGGTGCTGTGTTGTGAG CACCGTGGAGCATGCATGCTATAACCCGAAAGATAGTGAACTATGCCTGGCGAGGGCGAAGCCCCAG GAAACTGGGGTGGAGGCC 16 S (GenBANK JX 887065): TGCTATAAGGGCAGTTTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAATCATTTGTCTTTTAATTGGAGGCTGGAATGAAGGGTTTAACAAAGGATAGTGTCT TTATTTTAAATTTGTAATTTGTAATAAGAGTAAAAATACTCTGGTGCAATTAAGGGACGACAAGACCCT AAAAGCTTTATTTTTAATATAAGTTTGAGTTTAAAGCAGAACAGAGAGTTTAACTGGGGTAGTTTTTTT GTAAAATCTGAGGTTGTAAAAGACATGTAAAGTGGGGTTAGGTCCTTTAGATAAGGATAATTTGAGTG AGTTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGGCTGATTGCGACCTCGA TGTTGAATTAAAAGCTCAGTGTAGAGCAGAAGCTACAGGGTGAGGGTTTGTTCAACCTTTAAATTTTT A Type locality. East of Antarctic Peninsula, 65 �� 17 ' 50 "S 51 �� 35 ' 13 "W to 65 �� 17 ' 53 "S 051�� 35 ' 17 "W, 3069���3076 m. Etymology. Andhakāra, Sanskrit noun meaning darkness or complete darkness, Latinized as andhakara, - ae. The name, which is a genitive, alludes to the absolute darkness of the Antarctic abyss, where this species is thriving. Description. If not specified, the description applies both to the 34 mm immature holotype and to the 95 mm adult male examined and dissected. Body: pleosomite 3 with anterior concavity; other pleosomites and pereonites without anterior concavity. Head: anterior lobe of head strongly produced; ventral corner of eye blunt and pointing obliquely backwards. Mandible: article 2 of palp moderately expanded posteriorly and moderately tapering distally. Maxilliped: inner plate with 3 nodular spines, which are not protruding. Gnathopod 1: coxa straight anteriorly; basis broad, 2.3 (adult) to 3.0 (immature holotype) x as long as wide; palm normally developed, scarcely produced. Gnathopod 2: coxa broad ventrally and weakly curved; propodus elongate, not expanded distally, 2.8 (immature holotype) to 3.4 (adult) x as long as wide, palm slightly curved and transverse, defined by 2 (immature holotype) to 5 (adult) spines. Pereopod 3: coxa broad, 1.6 (adult) to 1.8 (immature holotype) x as deep as wide; basis stout, 2.8 x as long as wide; propodus stout, 4.5 (immature holotype) to 4.7 (adult) x as long as wide; dactylus stout. Pereopod 4: coxa broad, 1.1 x as deep as wide (adult) to fairly broad, 1.2 x as deep as wide (immature holotype); junction between anterior and ventral border rounded but well distinct; ventral border slightly curved; posteroventral border straight and distinctly oblique (adult), straight and weakly oblique (immature holotype); leg almost identical with pereopod 3. Pereopod 5: basis with posterior border slightly crenulated; merus narrow, 1.9 x as long as wide, with posterior border forming a regular curve; propodus of normal stoutness, 6.0 (immature holotype) to 6.3 (adult) x as long as wide, with 7 (immature holotype) to 12 (adult) groups of spines anteriorly; dactylus rather stout. Pereopod 6: basis with posterior border distinctly crenulated (more strongly in immature holotype than in adult); merus narrow, 1.9 (adult) to 2.0 (immature holotype) x as long as wide, with posterior border forming a moderately convex and regular curve; propodus of normal stoutness, 6.5 (immature) to 6.9 (adult) x as long as wide, with 9 (immature holotype) to 13 (adult) groups of spines anteriorly; dactylus rather stout. Pereopod 7: basis stout, with posterior border strongly expanded, with posterior border distinctly crenulated (much more strongly in immature holotype than in adult), with ornamentation of anterior border normal, 1.45 (immature holotype) to 1.5 (adult) x as long as wide, with posterodistal corner of lobe not produced and regularly rounded, ratio length of lobe of basis / total length of basis = 0.20 (adult) to 0.21 (immature holotype); merus narrow, 1.9 x as long as wide, with posterior border forming a regular curve; propodus of normal stoutness, 5.4 (immature) to 6.8 (adult) x as long as wide, with 9 (immature holotype) to 15 (adult) groups of spines anteriorly; dactylus rather stout. Epimeron 3: ventrally well rounded, with small posteroventral tooth in specimens ��� 35 mm. Uropod 3: spines of distolateral angle of peduncle rather short and stout. Colour pattern. Adults pure white or dull pink with coxae, appendages and some parts of the body tinged with bright red; eyes pale yellow. Size. Up to 100 mm. Distribution and depth range. Antarctica: Weddell Sea, 3070���4693 m. Biology. The species is a scavenger, which enters baited traps in large numbers. Considerable size differences were observed between samples, suggesting a spatial segregation between size classes, which is in agreement with previous observations on the genus Eurythenes (e.g. Christiansen et al. 1990). Remarks. In a genus like Eurythenes, which includes cryptic and very similar species, it is important to know at least one DNA sequence of the holotype. Adult specimens of E. andhakarae sp. nov. available for study were fixed in formaline, so they were unsuitable for DNA sequencing. Therefore a sequenced immature specimen was selected as holotype. E. andhakarae sp. nov. is very similar to E. gryllus and E. magellanicus. The comparatively narrow merus of pereopods 6���7 and the regularly curved posterior border of the same articles separate E. andhakarae sp. nov. from these two related species. In E. gryllus and E. magellanicus, the merus of pereopods 6���7 is stout, with the distal half of its posterior border straight and steeply oblique, so that the merus is strongly tapering distally. The basis of pereopod 7 is also posteriorly more expanded in E. andhakarae sp. nov. compared with the two other species. The average number of groups of spines on the anterior border of the propodus of pereopod 5���7 seems to be higher in adult E. andhakarae sp. nov. than in other Eurythenes species, but this character is too variable to be used for identification purposes. E. andhakarae sp. nov. can also be separated from E. gryllus by the more produced anterior lobe of the head and by the ventral lobe of the eye which is rounded and directed obliquely backwards instead of being pointed and directed ventrally. The inner plate of maxilliped of E. andhakarae sp. nov. bears only three weakly protruding nodular spines, instead of at least 4 strongly protruding nodular spines in the case of E. magellanicus., Published as part of D'Acoz, C��dric D'Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), pp. 1-80 in Zootaxa 3971 (1) on pages 10-23, DOI: 10.11646/zootaxa.3971.1.1, http://zenodo.org/record/288816, {"references":["Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. & Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218","Christiansen, B., Pfannkuche, O. & Thiel, H. K. (1990) Vertical distribution and population structure of the necrophagous amphipod Eurythenes gryllus in the West European Basin. Marine Ecology Progress Series, 66, 35 - 45. http: // dx. doi. org / 10.3354 / meps 066035"]}

Eurythenes sigmiferus sp. nov. (Figs 47 ���52) Eurythenes gryllus.��� ? Barnard, 1961: 35, in part, fig. 5.���? Bowman & Manning, 1972: 193, figs. 2���5, in part (Guadeloupe and Andros material only).��� Escobar-Briones et al., 2010: 177, in part. Eurythenes gryllus clade Eg 6.��� Havermans et al., 2013: 12 ���13, fig. 5 (1 A). Material examined. HOLOTYPE. RV Meteor, expedition DIVA 3, ME 79 - 1, sta. 542, 26�� 33 ' 21 "S 035�� 11 ' 29 "W, 4480 m, baited trap, 21.vii. 2009: 1 specimen, 53 mm, fixed first 96 % denatured ethanol, coll. Ed Hendrycks, DZMB-HH 7991, ZMH K 44286; BraB- 8, EG- 2101108, JX 887070 (16 S). Voucher DNA sequences. HOLOTYPE, BraB- 8, EG- 2101108. 16 S (GenBANK JX 887070): TGCTATAAGGGTAGTGTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAGTCATTTGTCTTTTAATTGGGGGCTGGAATGAAGGGTTTAACAAAAGATAGTGTCT TTATTTTAAATTTGTAATTTATAATAAGGGTAAAAATACTTTGGTGTGATTAAGGGACGACAAGACCCTA AAAGCTTTATTTTTAATATGAGTTTGAGTTTAAAATAAAACAGAAAGTTTAACTGGGGTAGTTTTTTTG TAAAATCTGAGGTTGTAAAAGGCATATAAAATGGAGTTAGGTTCTTTAGATAAGGATAATTTGAGTGAG TTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGATTGATTGCGACCTCGATG TTGAATTAAAAGCTCAGTGTAGAGCAGAAGCTACGGGGTGAGGGTTTGTTCAACCTTTAAATTTTTA Type locality. Southwestern Atlantic, off Brazil, Brazil Basin, 26 �� 33 ' 21 "S 035�� 11 ' 29 "W, 4480 m. Etymology. Sigmiferus, - a, - um, adjective created in combining Sigma, which is the eighteenth letter of the Greek alphabet, and the suffix - ferus, which means bearing. The name alludes to the dorsal sigmoid profile of most segments of the pereon and pleosome of the species. Description. Holotype, 53 mm, presumed female. Body: pereonites 2���7 and pleosomites 1���3 posteriorly carinate; the most carinate body segment, i.e. pereonites 6���7 and pleosomites 1���3 have a sigmoid profile: they present a slight anterior concavity (which is deeper in pleosomite 3). Head: anterior lobe of head strongly produced; ventral corner of eye blunt and pointing obliquely backwards. Mandible: article 2 of palp posteriorly not expanded and distally not tapering. Maxilliped: Inner plate with 9���10 nodular spines, which are distinctly protruding. Gnathopod 1: coxa straight anteriorly; basis broad, 2.9 x as long as wide; palm well developed, weakly produced. Gnathopod 2: coxa broad and weakly curved ventrally; propodus stout, expanded distally, 2.4 x as long as wide, palm distinctly curved and intrusively oblique, defined by 4 spines. Pereopod 3: Coxa rather narrow, 1.9 x as deep as wide; basis stout, 3.1 x as long as wide; propodus stout, 4.5 x as long as wide; dactylus stout. Pereopod 4: coxa fairly broad, 1.1 x as deep as wide; junction between anterior and ventral border rounded but well distinct; ventral border nearly straight; posteroventral border with inconspicuous concavity, scarcely oblique; leg almost identical with pereopod 3. Pereopod 5: basis with posterior border slightly crenulated; merus of normal width, 1.8 x as long as wide, with posterior border forming a regular curve; propodus rather stout, 5.6 x as long as wide, with 9 groups of spines anteriorly; dactylus rather stout. Pereopod 6: missing in the only specimen available (used for the DNA study). Pereopod 7: basis stout, with posterior border expanded normally, with posterior border strongly crenulated, with ornamentation of anterior border normal, 1.5 x as long as wide, with posterodistal corner of lobe a bit produced and bluntly angular, ratio length of lobe of basis / total length of basis = 0.21; merus stout, 1.6 x as long as wide, with posterior border forming a regular curve; propodus stout, 5.3 x as long as wide, with 9 groups of spines anteriorly; dactylus rather stout. Epimeron 3: weakly rounded ventrally, without posteroventral tooth. Uropod 3: spines of distolateral angle of peduncle rather long and slender. Colour pattern. Colour of holotype unrecorded. Photographs previously uploaded on the WWW of specimens possibly belonging to E. sigmiferus sp. nov. (crested Eurythenes) show completely white animals with pale yellowish eyes; e.g. ECOMARE Cruise diary, 7 th August 2007, http://www.oceanlab.abdn.ac.uk/blog/?p= 244 [accessed 21.x. 2011]. Size. The holotype is 53 mm long. The two possible E. sigmiferus specimens recorded by Barnard (1961) as E. gryllus were respectively 50 mm and 75 mm long. The possible E. sigmiferus specimen of the ECOMARE Cruise previously illustrated at http://www.oceanlab.abdn.ac.uk/blog/wp-content/fig- 1.JPG [accessed 21.x. 2011] was nearly 140 mm long. Distribution and depth range. The only absolutely certain record of the species is that of the holotype in the Brazil Basin (26 �� 33 ' 21 "S 035�� 11 ' 29 "W) at 4480 m. However, the species may be widely distributed, since it presumably also occurs in the Gulf of Mexico around 3300 m depth, based on Escobar-Briones et al. (2010), who record Eurythenes specimens with extremely similar DNA sequences (Havermans et al. 2013). Biology. The species is a scavenger, which sometimes enters baited traps. Remarks. Besides genetically confirmed records of E. sigmiferus sp. nov., there is a number of records of crested Eurythenes, which are possibly conspecific but require further studies. Barnard (1961) recorded and illustrated two crested Eurythenes specimens collected in the Indian Ocean, off Natal at 29 �� 39 'S 37 ��01'E, 4880��� 5090 m, which could be E. sigmiferus. Bowman & Manning (1972) also recorded crested Eurythenes (without giving illustrations of the crests) from Guadeloupe and Andros Island, but from a much shallower depth (around 1800 m); their identity with E. sigmiferus sp. nov. seems possible but requires confirmation, the concept of ���crest��� remaining too imprecise when not substantiated by illustrations. There are also several pictures accessible on WWW showing Eurythenes specimens with a dorsal crests more or less similar to those of E. sigmiferus sp. nov. The specimen illustrated at http://lysianassidae.myspecies.info/sites/lysianassidae.myspecies.info/files/ KAH0910_ 6 % 20 Eurythenes.jpg [accessed on 23.ix. 2014] comes from the Kermadec Trench, 36 �� 10.07 ���S 179 ��00.27���W, 6000 m, and that of http://lysianassidae.myspecies.info/sites/lysianassidae.myspecies.info/files/ Eurythenes % 202.JPG [accessed on 23.ix. 2014] from the Peru-Chile Trench, 04�� 27.016 ���S 81 �� 54.719 ���W, 5329 m] (Kilgallen comm. pers.). The specimen previously illustrated by a photograph at http://www.oceanlab.abdn.ac.uk/ blog/wp-content/fig- 1.JPG [accessed 21.x. 2011] presumably comes from the Atlantic Ocean, possibly from the Mid-Atlantic Ridge. If it is genetically confirmed that these specimens are indeed E. sigmiferus sp. nov., this would mean that it is a cosmopolitan tropical/subtropical abyssal (and possibly hadal) species., Published as part of D'Acoz, C��dric D'Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), pp. 1-80 in Zootaxa 3971 (1) on pages 67-74, DOI: 10.11646/zootaxa.3971.1.1, http://zenodo.org/record/288816, {"references":["Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128.","Bowman, T. E. & Manning, R. B. (1972) Two arctic bathyal crustaceans: the shrimp Bythocaris cryonesus new species, and the amphipod Eurythenes gryllus, with in situ photographs from Ice Island T- 3. Crustaceana, 23 (2), 187 - 201, pl. 1.","Escobar-Briones, E., Najera-Hillman, E. & & Alvarez, F. (2010) Unique 16 S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain. Revista Mexicana de Biodiversidad, 81, S 177 - S 185.","Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. & Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218"]}

Genus Eurythenes S.I. Smith in Scudder, 1882 Eurytenes Lilljeborg, 1865 a: 11 (non Eurytenes F��rster, 1862, Hymenoptera); 1865 b: 6. Type species: Lysianassa magellanica H. Milne Edwards, 1848; by original designation. Eurythenes S.I. Smith in Scudder, 1882: 135 (Supplemental list of genera in Zo��logy), 122 (Universal index to genera in Zo��logy).��� S.I. Smith, 1884 a: 54.��� Stoddart & Lowry, 2004: 428 (ubi syn.). Type species: Lysianassa magellanica H. Milne Edwards, 1848 (nom. nov. for Eurytenes Lilljeborg, 1865). Eurysthenes S.I. Smith, 1884 b: 181. Type species: Lysianassa magellanica H. Milne Edwards, 1848 (probable typographical error for Eurythenes S.I. Smith in Scudder, 1882). Euryporeia G.O. Sars, 1891: 85. Type species: Lysianassa magellanica H. Milne Edwards, 1848 (nom. nov. for Eurytenes Lilljeborg, 1865). Katius Chevreux, 1905: 1 (type species: Katius obesus Chevreux, 1905). Etymology. Lilljeborg (1965 a) indicated the following etymology of Eurytenes: 'On account of its extensive geographical distribution, we give to this genus the name Eurytenes, from the Greek 'ε����υ��ε��ς, which signifies widely stretched'. Description. See description of family Eurytheneidae by Stoddart & Lowry (2004). Composition. In the present paper, seven Eurythenes species are recognized: E. andhakarae sp. nov., E. gryllus (Lichtenstein in Mandt, 1822), E. magellanicus (H. Milne Edwards, 1848), E. maldoror sp. nov., E. obesus (Chevreux, 1905), E. sigmiferus sp. nov., and E. thurstoni Stoddart & Lowry, 2004. DNA sequences of specimens not directly examined and morphological observations published in literature are indicative of the existence of further species. Nomenclature issues. The name Eurythenes was erected in very unusual manner, and has been a source of confusion for more than a century. Lilljeborg (1865 a) created the genus Eurytenes (without "h") for Lysianassa magellanica H. Milne Edwards, 1848 (currently Eurythenes magellanicus) but this name was preoccupied by Eurytenes F��rster, 1862 (Hymenoptera). On page 135 of the first part of the book by Scudder (1882) (Supplemental list of genera in Zo��logy), ' Eurythenes Lilljeborg. Nova Acta Soc. Sc. Upsal., vii, p. 11. 1865. Crust., Amph. Smith.' is listed. Column 3 of page 122 of the second part of Scudder (1882) (Universal index to genera in Zo��logy) lists ' Eurytenes F��rst., Hym. 1862 M.' and two lines below ' Eurythenes Lillj. Crust. 1865. S.' Chevreux (1889) made the following statement (freely translated from French): 'Since Eurytenes was used by F��rster for a new genus of Hymenoptera, Smith has slightly modified the spelling of the name proposed by Lilljeborg (1865), so that it remains phonetically identical. In this paper, I keep that spelling of Smith, although I consider the procedure which he followed highly inappropriate'. G.O. Sars (1891) proposed the name Euryporeia G.O. Sars, 1891 as a replacement name for Eurytenes Lilljeborg, 1865, with the following justification: 'In 1865 Prof. Lilljeborg established this genus to include the remarkable gigantic form described by Milne Edwards under the name of Lysianassa magellanica. The denomination Eurytenes proposed by him having, however, been before adopted for a genus of Hymenoptera, I have changed the latter half of the compound, still conserving the signification of the name as intended by Prof. Lilljeborg.' Fifteen years later, in his classical revision of gammaridean amphipods, Stebbing (1906) implicitly treated Eurythenes S.I. Smith, 1882 as a replacement name validly introduced for Eurytenes Lilljeborg, 1865. Between 1893 and 1925, a few authors adopted Euryporeia (see the list given by Stoddart & Lowry 2004), but otherwise the point of view of Stebbing (1906) became prevalent and, after 1925, universally accepted. The listing of both ' Eurytenes F��rst. ' and ' Eurythenes Lillj. ' in the second part of the book of Scudder (1882), which was overlooked by previous authors, clearly indicates that the spelling modification was deliberate and was intended to be a replacement name sensu ICZN (1999) Art. 60.3. As the change operated by Smith has been done within a book authored by Scudder and not by him, it seems advisable to indicate the authority of the genus Eurythenes as 'Smith in Scudder, 1882 ' and not simply as ' Smith, 1882 ' as it is usually the case. The name Eurysthenes S.I. Smith, 1884 b has been interpreted as a typographical error (Stoddart & Lowry 2004), since the paper of S.I. Smith (1884 b) is a reprint of S.I. Smith (1884 a), where the spelling Eurythenes is used. Biology. Eurythenes obesus is a pelagic species, of which the biology is poorly known, whilst other Eurythenes species are benthopelagic, E. thurstoni being more confined to the pelagic realm than the species of the E. gryllus - complex or E. gryllus s.l. (Stoddart & Lowry 2004). A substantial corpus of biological literature exists for this species complex. It has to be reviewed collectively because the pseudocyptic species described herein have not been previously separated, assuming that their overall biology is reasonably similar. Barnard (1962) stated that, "morphologically, E. gryllus s.l. is more pelagic than benthic, but obviously feeds on the bottom���, but Bowman & Manning (1972) found that ���the heavy compact body seems poorly adapted for a continuous pelagic existence, even though the heavily muscled pleon indicates that E. gryllus is a strong swimmer". Subsequent papers repeatedly confirmed that E. gryllus s.l. is a benthopelagic species and Thurston (1990) gave an extensive list of papers recording E. gryllus s.l. in the water column, often far above the abyssal sea floor. An extreme case is the record 1800 m above the bottom by Baldwin & Smith (1987). According to observations in the European Basin by Christiansen et al. (1990), it is predominantly found in the first 15 m above the sea floor; juveniles and large females being exclusively found in the first 50 m above the bottom; adult males have a bimodal distribution with maxima at 15 and 300 m above the bottom; isolated specimens were observed 1000 m above the sea floor. Baldwin & Smith (1987), who made fairly similar observations on populations from the central and eastern North Pacific, suspected that juvenile Eurythenes remain close to the bottom due to larger food supplies and the possibility to seek refuge in the sediment as a protection from predation. Concerning pelagic specimens, Ingram & Hessler (1983) state that: "The bathymetric distribution of E. gryllus implies that individuals probably spend long periods above the sediment searching for food. Those that live hundreds of meters above the sediment might only rarely, if ever, descend to the sediment. Such behavior would be energetically expensive unless E. gryllus were neutrally buoyant or nearly so. Their primary energy store, lipids, may aid in maintaining the neutral buoyancy that would require little if any energy expenditure for staying in the water column." The data of Baldwin & Smith (1987) suggest that Eurythenes gryllus s.l. has a continuous recruitment, as there is no size class progression along with the annual cycle. Hatchlings are 11 mm long (Thurston & Bett 1995) and according to Ingram & Hessler (1987), in E. gryllus s.l. from the central North Pacific, males mature at instar VIII (mean length 70 mm) and females at instar XV (mean length 109 mm); both males and females are mature through several instars and females can have multiple broods; they estimate that females mature at 9 years and males at 4 years. However, according to Thurston & Bett (1995) the relationship between the size and the instars as calculated by Ingram & Hessler (1987) requires minor adjustments. Adult females with setose oostegites are uncommonly recorded and have very soft teguments compared to males and females in non-brooding intermoult (Ingram & Hessler 1987, Thurston & Bett 1995). The only brooding female ever caught (bearing hatchlings, not eggs) was caught with a midwater trawl 1500 m above the seafloor, suggesting pelagic incubation, at a depth range where predators are scarce (Thurston & Bett 1995). We hypothesise that soft (i.e. lighter) teguments would ensure a better buoyancy���hence a reduced energetic budget���during the presumably non-feeding pelagic brooding stage and that females descend to the bottom for releasing their hatchlings. Eurythenes spp. enter baited traps in swarms (e.g. Shulenberger & Hessler 1974, Premke et al. 2003) and Dauby et al. (2001) considered E. gryllus s.l. to be an exclusive scavenger. However, it has also been shown to predate on fishes caught by long lines (Templeman 1967) and to ingest mud (Barnard 1962). Anatomical studies of E. gryllus s.l. have revealed well-developed chemosensory organs on the antennae (Dahl, 1979), mandibles welladapted for rapidly devouring pieces of carrion (Thurston 1979, Dahl, 1979) and a midgut capable of storing a large amount of food, as the fall of carcasses is sporadic (Dahl, 1979). According to Smith & Baldwin (1984), the short range detection of carrion by Eurythenes gryllus s.l. would obviously result from chemoreception, but they suspect that the noise and vibrations of their feeding and swimming would then attract specimens located beyond the odour boundary. Subsequent authors (e.g. Premke et al. 2003) only retained chemoreception and no longer consider the acoustic/vibratory hypothesis. Ingram & Hessler (1983) think that E. gryllus s.l. are hovering above the bottom, like vultures, in order to survey a larger area increasing the probability of detecting odour diffusion plumes of carcasses. E. gryllus s.l. is known to reach carcasses quickly and it has been reported that up to 618 specimens have been caught in a trap, only 12 minutes after its deposition on the sea floor (Premke et al. 2003). This is however an exceptional case and the arrival of E gryllus s.l. usually takes a longer time (Thurston 1979). Brooding females of E. gryllus s.l. have so far never entered a trap (Ingram & Hessler 1983, Charmasson & Calmet 1987). On several occasions, Eurythenes gryllus s.l. has been found in the stomach of flying sea birds (Lichtenstein in Mandt 1822; Stephensen 1925, 1949; Chevreux 1935; Ainley et al. 1986; Klages & Cooper 1997). Since these sea birds are obviously unable to dive at the minimal depths were living specimens have been recorded (i.e. below 500 m), it has been suggested that dead Eurythenes would drift towards the surface, where birds would consume them (Bowman & Manning 1972, Ingram & Hessler 1983). This statement remains however purely speculative. If dead Eurythenes would be drifting towards the surface, they should occasionally wash ashore, which, as far we know, is not corroborated by any records. Ainley et al. (1986) record E. gryllus s.l. in bird stomachs only where pack ice is present and conclude that they presumably occur near the surface level in such environments. Sexual dimorphism, allometry, individual variations. In Eurythenes there is almost no sexual dimorphism, except for antenna 2, which increases considerably in length in males that reach sexual maturity. The number of setae on the inner plate of maxilla 1 increases with size. The propodus of gnathopod 2 lengthens slightly when specimens increase in size (but the proportions of that article is also partly species-dependent). The spines and setae of pereopods 3���7 and uropods drastically shorten and widen when specimens increase in size. The propodus of pereopods 5���7 becomes slightly longer and narrower when size increases. The number of spines on the anterior border of the propodus of pereopods 5���7 increases with body size. The acuity of the posteroventral tooth of the first and second epimeral plate reduces when size increases. In some species, small specimens (E. magellanicus, some individual variations were observed in the size of the palm of gnathopod 1, the shape of coxa 4 and the strength of crenulation of the posterior basis of pereopods 5���7. In agreement with literature data on Eurythenes gryllus s.l. (e.g. Smith & Baldwin 1984, Baldwin & Smith 1987, Thoen et al. 2011), we observed that the colour pattern of Eurythenes of the same species (in our case E. andhakarae sp. nov. and E. gryllus s.s.) is extremely variable and may range from white to yellow, orange and red. Baldwin & Smith (1987) propose the following links: (1) pigmentation deposition in animals with increasing length of intermoult period and (2) lower food supply resulting in a longer intermoult period, therefore allowing an increased time to incorporate pigments. This idea of a correlation between the colour and the moult/intermoult cycle is supported by observations on the green shore crab, Carcinus maenas (Linnaeus, 1758), where only specimens in long intermoult get a red ventral colour (Reid et al. 1997, Styrishave et al. 2004, Lewis 2011). Interspecific differences. E. obesus exhibits profound differences with other Eurythenes species. Especially the very long dactylus of its pereopods 3���7 allows for an immediate distinction from all other Eurythenes species. Its ventrally deeply convex coxa 4 and the very elongate shape of its eyes are also very characteristic. E. thurstoni exhibit clear-cut, albeit much less pronounced, differences from the remaining Eurythenes species. Especially, the palm of gnathopod 2 is considerably more protruding than in gryllus and its relatives, the ventral border of its coxa 4 is more rounded and the postero-distal border of the basis of its pereopod 7 is much more elongated than in the remaining species. A group of extremely similar species remained to be studied, which can be referred as the gryllus -complex. Bowman & Manning (1972) and Stoddart & Lowry (2004) observed and illustrated minute differences between specimens of different origins but considered them as insufficient to justify the recognition of different species. On the other hand, Ingram & Hessler (1983), who also observed differences, did not rule out that they might be of specific nature, but did not investigate the problem in any detail. Molecular data definitely settles the issue and indicates beyond doubt that E. gryllus s.l. consists of several species-level clades (Havermans et al. 2013). Hence, it was necessary to reconsider the question by a morphological comparison of the different molecular clades and to re-consider the elusive characters previously considered as intraspecific variation, which is commonly referred to as the reverse taxonomy approach (e.g. Kanzaki et al. 2012). Indeed, with the exception of shape of coxa 2 which is markedly different in E. maldoror sp. nov. compared to all other species, other differences are rather difficult to appreciate and should be used with the greatest caution, when trying to identify specimens. Specific characters in the gryllus -complex include: - degree of carination of body segments and the number of body segments with a sigmoid profile (i.e. with a slight anterior concavity) - shape of the eyes - development of the anterior lobe of head - width and shape of article 2 of the mandibular palp - number of nodular spines on the anterior border of the inner plate of the maxilliped - degree of protrusion of the aforementioned nodular spines - ratio length/width of the basis of gnathopod 1 - degree of protrusion of the palm of gnathopod 1 - shape of the ventral border of coxa 2 - proportions of the propodus of gnathopod 2 (this character is also partly allometric) - level of protrusion or intrusion of the palm of gnathopod 2 - number of spines defining the palm of gnathopod 2 - proportions and shape of coxa 4 (difficult to phrase in simple and unambiguous terms) - degree of posterior expansion of the basis of pereopod 7 (and its shape) - degree of development and shape of the posterodistal lobe of the basis of pereopod 7 - degree of crenulation of the posterior border of the basis of pereopods 5���7 (in keeping in mind that the crenulation is usually more developed in immatures than in adults and that the posterior border of the basis is fragile and hence easily eroded) - degree of broadening of the merus of pereopod 5���7 (and to a certain extent its shape) - presence/absence of a posteroventral tooth on the third epimeral plate in specimens, Published as part of D'Acoz, C��dric D'Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), pp. 1-80 in Zootaxa 3971 (1) on pages 6-9, DOI: 10.11646/zootaxa.3971.1.1, http://zenodo.org/record/288816, {"references":["Lilljeborg, W. (1865 a) On the Lysianassa magellanica H. Milne Edwards and on the Crustacea of the suborder Amphipoda and subfamily Lysianassina found an [sic] the coast of Sweden and Norway. The royal academy press, Uppsala, 37 pp., 5 pls.","Forster, A. (1862) Synopsis der Familien und Gattungen der Braconen. Verhandlungen des naturhistorischen Vereines der preussischen Rheinlande und Westphalens, 19, 225 - 288.","Milne Edwards, H. (1848) Sur un crustace amphipode, remarquable par sa grande taille. Annales des Sciences naturelles, Serie 3, 9, 398.","Smith, S. I. (1884 a) Crustacea of the Albatross dredgings in 1883. American Journal of Science, Series 3, 28, 53 - 56. http: // dx. doi. org / 10.2475 / ajs. s 3 - 28.163.53","Stoddart, H. E. & Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468.","Smith, S. I. (1884 b) Crustacea of the Albatross dredgings in 1883. Annals and Magazine of Natural History, Series 5, 14, 179 - 183. [reprinted from the American Journal of Science] http: // dx. doi. org / 10.5962 / bhl. title. 62604","Chevreux, E. (1905) Description d'un amphipode (Katius obesus, nov. gen. et sp.), suivie d'une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grande ouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bulletin du Musee oceanographique de Monaco, 35, 1 - 7.","Chevreux, E. (1889) Quatrieme campagne de l' Hirondelle, 1888. Sur la presence d'une rare et interessante espece d'amphipode, Eurythenes gryllus Mandt, dans les eaux profondes de l'ocean, au voisinage des Acores. Bulletin de la Societe zoologique de France, 14, 298 - 300.","Stebbing, T. R. R. (1906) Amphipoda. I. Gammaridea. Das Tierreich, 21, 1 - 806.","Smith, S. I. (1882) Eurythenes Lilljeborg. In: Scudder, S. H. (Ed.), Nomenclator Zoologicus. An alphabetical list of all generic names that have been employed by naturalists for recent and fossil animals from the earliest times to the close of the year 1879. I. Supplemental list. II. Universal index. Government Printing Office, Washington. Bulletin of the United States National Museum, 19, pp. 135 (Supplemental list of genera in Zoology) & pp. 122 (Universal index to genera in Zoology). [i - xix, 1 - 376 (Supplemental list of genera in Zoology) & 1 - 340 (Universal index to genera in Zoology)]","ICZN [International Commission on Zoological Nomenclature] (1999) International Code of Zoological Nomenclature. Fourth Edition adopted by the International Union of Biological Sciences. The International Trust for Zoological Nomenclature, the Natural History Museum, London. xxix pp., 306 pp.","Barnard, J. L. (1962) South Atlantic abyssal amphipods collected by R. V. Vema. In: Barnard, J. L., Menzies, R. J. & Bacescu, M. C. (Eds.), Abyssal Crustacea. Columbia University Press, New York and London, pp. 1 - 78.","Bowman, T. E. & Manning, R. B. (1972) Two arctic bathyal crustaceans: the shrimp Bythocaris cryonesus new species, and the amphipod Eurythenes gryllus, with in situ photographs from Ice Island T- 3. Crustaceana, 23 (2), 187 - 201, pl. 1.","Thurston, M. H. (1990) Abyssal necrophagous amphipods (Crustacea: Amphipoda) in the northeast and tropical Atlantic Ocean. Progress in Oceanography, 24, 257 - 274. http: // dx. doi. org / 10.1016 / 0079 - 6611 (90) 90036 - 2","Baldwin, R. J. & Smith, K. L. Jr. (1987) Temporal variation in the catch rate, length, color and sex of the necrophagous amphipod, Eurythenes gryllus, from the central and eastern North Pacific. Deep-Sea Research, 34 (3), 425 - 439. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90146 - 4","Christiansen, B., Pfannkuche, O. & Thiel, H. K. (1990) Vertical distribution and population structure of the necrophagous amphipod Eurythenes gryllus in the West European Basin. Marine Ecology Progress Series, 66, 35 - 45. http: // dx. doi. org / 10.3354 / meps 066035","Ingram, C. L. & Hessler, R. R. (1983) Distribution and behavior of scavenging amphipods from the central North Pacific. Deep- Sea Research Part A. Oceanographic Research Papers, 30 (7), 683 - 706. http: // dx. doi. org / 10.1016 / 0198 - 0149 (83) 90017 - 1","Thurston, M. H. & Bett, B. J. (1995) Hatchling size and aspects of biology in the deep-sea amphipod genus Eurythenes (Crustacea: Amphipoda). Internationale Revue der Gesamten Hydrobiologie, 80 (2), 201 - 216. http: // dx. doi. org / 10.1002 / iroh. 19950800209","Ingram, C. L. & Hessler, R. R. (1987) Population biology of the deep-sea amphipod Eurythenes gryllus: inferences from instar analyses. Deep-Sea Research Part A. Oceanographic Research Papers, 34 (12), 1889 - 1910. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90090 - 2","Shulenberger, E. & Hessler, R. R., (1974) Scavenging abyssal benthic amphipods trapped under oligotrophic cental North Pacific gyre waters. Marine BioIogy, 28, 185 - 187. http: // dx. doi. org / 10.1007 / BF 00387296","Premke, K., Muyakshin, S., Klages, M. & Wegner, J. (2003) Evidence for long-range chemoreceptive tracking of food odour in deep-sea scavengers by scanning sonar data. Journal of Experimental Marine Biology and Ecology, 285 - 286, 283 - 294. http: // dx. doi. org / 10.1016 / S 0022 - 0981 (02) 00533 - 6","Dauby, P., Scailteur, Y. & De Broyer, C. (2001) Trophic diversity within the eastern Weddell Sea amphipod community. Hydrobiologia, 443, 69 - 81. http: // dx. doi. org / 10.1023 / A: 1017596120422","Templeman, W. (1967) Predation on living fishes on longline in Baffin Bay by the amphipod Eurythenes gryllus (Lichtenstein) and a new distribution record. Journal of the Fishery Research Board of Canada, 5, 234 - 237.","Dahl, E. (1979) Deep-sea carrion feeding amphipods: evolutionary patterns in niche adaptation. Oikos, 33, 167 - 175. http: // dx. doi. org / 10.2307 / 3543994","Thurston, M. H. (1979) Scavenging abyssal amphipods from the north-east Atlantic Ocean. Marine BioIogy, 51, 55 - 68. http: // dx. doi. org / 10.1007 / BF 00389031","Smith, K. L. & Baldwin, R. J. (1984) Vertical distribution of the necrophagous amphipod, Eurythenes gryllus, in the North Pacific: spatial and temporal variation. Deep-Sea Research Part A. Oceanographic Research Papers, 31 (10), 1179 - 1196. http: // dx. doi. org / 10.1016 / 0198 - 0149 (84) 90057 - 8","Charmasson, S. S. & Calmet, D. P. (1987) Distribution of scavenging Lysianassidae amphipods Eurythenes gryllus in the northeast Atlantic: comparison with studies held in the Pacific. DeepSea Research Part A. Oceanographic Research Paper, 34 (9), 1509 - 1523. http: // dx. doi. org / 10.1016 / 0198 - 0149 (87) 90106 - 3","Stephensen, K. (1925) Crustacea Malacostraca, VI: (Amphipoda I). The Danish Ingolf-Expedition, 3 (9), 101 - 178.","Stephensen, K. (1949) The Amphipoda of Tristan da Cunha. Results of the Norwegian scientific Expedition to Tristan da Cunha 1937 - 1938, 19, 1 - 61.","Chevreux, E. (1935) Amphipodes provenant des campagnes du Prince Albert Ier de Monaco. Resultats des Campagnes scientifiques accomplies sur son Yacht par Albert Ier Prince Souverain de Monaco, 90, 1 - 214, pls. 1 - 16.","Ainley, D. G., Fraser, W. R., Sullivan, C. W., Torres, J. J., Hopkins, T. L. & Smith, W. O. (1986) Antarctic mesopelagic micronekton: evidence from seabirds that pack ice affects community structure. Science, 232, 847 - 849. [N. Y.]","Klages, N. T. W. & Cooper, J. (1997) Diet of the Atlantic petrel Pterodroma incerta during breeding at South Atlantic Gough Island. Marine Ornithology, 25, 13 - 16.","Thoen, H. H., Johnsen, G. & Berge, J. (2011) Pigmentation and spectral absorbance in the deep-sea arctic amphipods Eurythenes gryllus and Anonyx sp. Polar Biology, 34, 83 - 93. http: // dx. doi. org / 10.1007 / s 00300 - 010 - 0861 - 5","Reid, D. G., Abello, P., Kaiser, M. J. & Warman, C. G. (1997) Carapace colour, inter-moult duration and the behavioural and physiological ecology of the shore crab Carcinus maenas. Estuarine, Coastal and Shelf Science, 44 (2), 203 - 211. http: // dx. doi. org / 10.1006 / ecss. 1996.0212","Styrishave, B., Rewitz, K. & Andersen, O. (2004) Frequency of moulting by shore crabs Carcinus maenas (L.) changes their colour and their success in mating and physiological performance. Journal of Experimental Marine Biology and Ecology, 313 (2), 317 - 336. http: // dx. doi. org / 10.1016 / j. jembe. 2004.08.013","Lewis, J. (2011) Red and green Carcinus: how different? The Plymouth Student Scientist, 4 (1), 423 - 431.","Havermans, C., Sonet, G., d'Udekem d'Acoz, C., Nagy, Z. T., Martin P., Brix, S., Riehl, T., Agrawal, S. & Held, C. (2013) Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE, 8 (9), e 74218. http: // dx. doi. org / 10.1371 / journal. pone. 0074218","Kanzaki, N., Giblin-Davis, R. M., Scheffrahn, R. H., Taki, H., Esquivel, A., Davies, K. A., Herre, E. A. (2012) Reverse taxonomy for elucidating diversity of insect-associated nematodes: a case study with termites. PLoS ONE, 7 (8), e 43865. http: // dx. doi. org / 10.1371 / journal. pone. 0043865"]}

The genus Eurythenes S.I. Smith in Scudder, 1882 was previously considered as consisting of three highly distinctive species: E. gryllus (Lichtenstein in Mandt, 1822), E. thurstoni Stoddart & Lowry, 2004 and E. obesus (Chevreux, 1905). E. gryllus has been considered as a common cosmopolitan and eurybathic species recorded down to a depth of 7800 m. However, the analysis of DNA sequences (COI, 16S, 28S) of newly collected specimens combined with GenBank sequences revealed the existence of nine genetic lineages within E. gryllus sensu lato. Specimens were recovered by tree-construction methods in distinct, well-supported clades and were separated by genetic divergences in the same range as interspecific values documented for other lysianassoid species. Furthermore, in some cases, different lineages were found at the same sampling locality. Specimens of six of the nine clades were examined directly. With one exception, these clades are separated by small but consistent morphological differences. As a consequence, five morphospecies are recognized herein within the E. gryllus complex: E. andhakarae sp. nov. (West Antarctica, abyssal), E. gryllus (bipolar, bathyal), E. magellanicus H. Milne Edwards, 1848 (Cape Horn and Brazil Basin, abyssal), E. maldoror sp. nov. (nearly cosmopolitan, abyssal), E. sigmiferus sp. nov. (at least West Atlantic, possibly nearly cosmopolitan, abyssal).

1. 1. Deep sea benthic amphipods ( Paralicella caparesca, Eurythenes grillus ) from depths of 4000–4300 m which experienced decompression and slight warming during retrieval were immobilized when observed at atmospheric pressure and 5°C. 2. 2. Compression to 400 atm at 5°C (equivalent to 4000 m depth) resuscitated more than half the 155 individuals examined. Groups of animals which experienced minimal exposure to sub-ambient pressures during retrieval showed full recovery in all individuals. 3. 3. Further high pressure and decompression tests were carried out on the resuscitated animals.