Search

Ephedrine (EPH) and cocaine (COC) are illegal stimulant drugs, and have been frequently detected in aquatic environments. EPH and COC have negative effects on the nervous system and cause abnormal behaviors in mammals and fish at high concentrations, but their mechanisms of neurotoxicity remain unclear in larvae fish at low concentrations. To address this issue, zebrafish embryos were exposed to EPH and COC for 14 days post-fertilization (dpf) at 10, 100, and 1000 ng L -1 . The bioaccumulation, development, behavior, cell neurotransmitter levels and apoptosis were detected to investigate the developmental neurotoxicity (DNT) of EPH and COC. The results showed that EPH decreased heart rate, while COC increased heart rate. EPH caused cell apoptosis in the brain by AO staining. In addition, behavior analysis indicated that EPH and COC affected spontaneous movement, touch-response, swimming activity and anxiety-like behaviors. EPH and COC altered the levels of the neurotransmitters dopamine (DA) and γ-aminobutyric acid (GABA) with changes of the transcription of genes related to the DA and GABA pathways. These findings indicated that EPH and COC had noticeable DNT in the early stage of zebrafish at environmentally relevant concentrations., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Ephedra sinica is one of the most famous Chinese medicinal plants. The insufficient supply of wild resources has led to the increased use of cultivated products. However, the related medicinal quality differs significantly. Although the influence of external environment on the quality of E. sinica has been studied, the impact of endophytic microbes on it remains vague. This study characterized differential metabolites and microbial community compositions in wild and cultivated E. sinica by combining metabolomics with microbiomics, and explored the effect of endophytes on the formation of differential metabolites further. The results showed that the difference in quality between wild and cultivated E. sinica was mainly in the productions of alkaloids, flavonoids, and terpenoids. The associated endophytes had special compositional characteristics. For instance, the distribution and abundance of dominant endophytes varied between wild and cultivated E. sinica. Several endophytes had significant or highly significant correlations with the formations of ephedrine, pseudoephedrine, D-cathinone, methcathinone, coumarin, kaempferol, rhamnetin, or phenylacetic acid. This study will deepen our understanding of the plant-endophyte interactions and provide a strategy for the quality control of E. sinica products., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Purpose: It was aimed to investigate the biochemical and immunohistochemical effects of ephedrine (EPH) in bilateral ovariectomized rats., Methods: Twenty-four Sprague Dawley female rats were divided into three groups: control group: The abdomen was opened and closed without any treatment; ischemia-reperfusion (IR) group: 2 h of ischemia followed by 2 h of reperfusion were allowed to cause IR injury; IR+EPH group: oral EPH solution (5 mg/kg) was administered for 28 days., Results: Biochemical parameters were statistically significant in group comparisons. Increased interleukin-6 (IL-6) expression, degenerative preantral and antral follicle cells and inflammatory cells around blood vessels were seen in IR group. Negative IL-6 expression was observed in seminal epithelial cells, preantral and antral follicle cells in IR+EPH group. While caspase-3 activity increased in granulosa cells and stromal cells in IR group, caspase-3 expression was negative in preantral and antral follicle cells in the germinal epithelium and cortex in IR+EPH group., Conclusions: The effect of apoptosis, which occurs with the signaling that starts in the cell nucleus, caused the cessation of the stimulating effect at the nuclear level after EPH administration, and a decrease in the antioxidative effect in IR damage and inflammation in the apoptotic process.

Most drugs, especially those with acidic or neutral moieties, are bound to the plasma protein albumin, whereas basic drugs are preferentially bound to human alpha-1-acid glycoprotein (AGP). The protein binding of the long-established drugs ephedrine and pseudoephedrine, which are used in the treatment of hypotension and colds, has so far only been studied with albumin. Since in a previous study a stereoselective binding of ephedrine and pseudoephedrine to serum but not to albumin was observed, the aim of this study was to check whether the enantioselective binding behavior of ephedrine and pseudoephedrine, in addition to the derivatives methylephedrine and norephedrine, is due to AGP and to investigate the influence of their different substituents and steric arrangement. Discontinuous ultrafiltration was used for the determination of protein binding. Characterization of ligand-protein interactions of the drugs was obtained by saturation transfer difference nuclear magnetic resonance spectroscopy. Docking experiments were performed to analyze possible ligand-protein interactions. The more basic the ephedrine derivative is, the higher is the affinity to AGP. There was no significant difference in the binding properties between the individual enantiomers and the diastereomers of ephedrine and pseudoephedrine., Competing Interests: Conflict of Interests None of the authors of this paper does have a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper., (Copyright © 2022. Published by Elsevier B.V.)

Mast cells (MCs) play an important role in allergies, leading to the development of MC-targeted therapies. Ephedra herb (Mao) has potent anti-allergic activity, but contains ephedrine alkaloids (EAs); therefore, its hazardous effects are taken into consideration during its clinical use. We previously reported that Mao attenuates robust MC degranulation by an allergen through high-affinity immunoglobulin E (IgE) receptor (FcεRI) internalization, in which an EA-independent mechanism was suggested to be at play. This study aimed to deepen our understanding of the potential of Mao against FcεRI internalization using two strains with different EA contents. Mao extracts were administered to bone marrow-derived MCs (BMMCs), and their cellular responses, including FcεRI internalization, were analyzed. In addition, physiological events were evaluated using a passive cutaneous anaphylactic (PCA) reaction mouse model. BMMCs mediate the production of diverse inflammatory mediators. Among these, the potent chemokine CCL2 is thought to be differentially regulated from other pro-inflammatory mediators. We found that Mao significantly induces CCL2 expression in BMMCs despite suppressing robust degranulation through FcεRI internalization. Importantly, this was a distinctly EAs-independent response. In the PCA reaction, local MC activation following allergen challenge was suppressed by Mao treatment, which strengthened the view that Mao sufficiently decreased the rapid activation of MCs and promoted CCL2 secretion. Collectively, these observations provide additional insights into the mechanism of Mao-induced silent FcεRI internalization in MCs and the complex and heterogeneous secretory responses operating in MCs.

Objective: We investigated the protective effects of ephedra herb (HEPH) on adriamycin-induced testicular toxicity in rats and explored the potential mechanisms underlying these effects., Methods: A rat model of adriamycin injury was established, and sperm motility-related indicator and oxidative stress levels in the testis were evaluated. Serum levels of sex hormones and levels of testicular cell apoptosis were detected by enzyme-linked immunosorbent assay and flow cytometry, respectively. Western blotting (WB), immunofluorescence analyses, and reverse transcription-polymerase chain reaction (RT-PCR) were performed to evaluate the gonadotropin-releasing hormone (GnRH) signalling pathway- and meiosis-related genes and proteins. In subsequent in vitro experiments, adriamycin was used to stimulate GC-1 cells, which were treated with HEPH, ephedrine, or pseudoephedrine. Cell viability was assessed using flow cytometry to detect apoptosis and reactive oxygen species, whereas the GnRH signalling pathway and levels of meiosis-related genes and proteins were evaluated by InCell WB, a high-content imaging system, and RT-PCR., Results: Per in vivo experiments, HEPH restored testicular weight and function, sperm characteristics, serum and tissue hormonal levels, and antioxidant defences and significantly activated the GnRH signalling pathway- and meiosis-related protein levels. All protective effects of HEPH against adriamycin-induced injury were antagonised by the GnRH antagonist cetrorelix. In vitro, HEPH, ephedrine, and pseudoephedrine significantly reduced adriamycin-induced GC-1 cell apoptosis and reactive oxygen species levels and increased the expression of GnRH signalling pathway- and meiosis-related proteins. The effect of pseudoephedrine was greater than that of ephedrine, and these findings may be an important basis for understanding the effects of HEPH., (Copyright © 2022 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra -containing products.

Mass spectrometry-based molecular imaging has been utilized to map the spatial distribution of target metabolites in various matrixes. Among the diverse mass spectrometry techniques, matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) is the most popular for molecular imaging due to its powerful spatial resolution. This unparalleled high resolution, however, can paradoxically act as a bottleneck when the bio-imaging of large areas, such as a whole plant, is required. To address this issue and provide a more versatile tool for large scale bio-imaging, direct analysis in real-time-time of flight-mass spectrometry (DART-TOF-MS), an ambient ionization MS, was applied to whole plant bio-imaging of a medicinal plant, Ephedrae Herba. The whole aerial part of the plant was cut into 10-20 cm long pieces, and each part was further cut longitudinally to compare the contents of major ephedra alkaloids between the outer surface and inner part of the stem. Using optimized DART-TOF-MS conditions, molecular imaging of major ephedra alkaloids of the whole aerial part of a single plant was successfully achieved. The concentration of alkaloids analyzed in this study was found to be higher on the inner section than the outer surface of stems. Moreover, side branches, which are used in traditional medicine, represented a far higher concentration of alkaloids than the main stem. In terms of the spatial metabolic distribution, the contents of alkaloids gradually decreased towards the end of branch tips. In this study, a fast and simple macro-scale MS imaging of the whole plant was successfully developed using DART-TOF-MS. This application on the localization of secondary metabolites in whole plants can provide an area of new research using ambient ionization mass spectroscopy and an unprecedented macro-scale view of the biosynthesis and distribution of active components in medicinal plants.

Dried terrestrial stems of Ephedra sinica are called 'Ephedra herb,' whose pharmacological effects are due mainly to two major ingredients, (-)-ephedrine and (+)-pseudoephedrine (total alkaloids which are defined in Japanese Pharmacopoeia (TA)). Ephedra herb is an important crude drug in Japan. However, E. sinica is widely distributed in arid areas of northeastern China and Mongolia. Recently, E. sinica has started to be cultivated in Japan. This study aimed to assess the validity of selection breeding on TA content of E. sinica in several locations in Japan. In this experiment, we grew approximately 350 seedlings and divided them randomly into seven groups. Nearly fifty plants were cultivated at each of seven locations. In Ibaraki, Yamanashi, and Shizuoka, average TA content of whole samples satisfied the criteria for Ephedra herb defined in Japanese Pharmacopoeia (7.0 mg/g of dry weight (DW)). Plants with high and intermediate TA content at four locations were selected and transplanted to Ibaraki. There were significant differences in TA content between selected plants with high and intermediate TA content before and after transplanting (p < 0.05). TA content of high-TA plants was significantly higher than that of control plants cultivated continuously at Ibaraki (p < 0.05). These results suggest that the selection on content of ephedrine alkaloids in E. sinica under various locations in Japan is valid, and high- TA E. sinica plants can be selected at various locations.

The Gram-positive soil bacterium Arthrobacter sp. strain TS-15 (DSM 32400), which is capable of metabolizing ephedrine as a sole source of carbon and energy, was isolated. According to 16S rRNA gene sequences and comparative genomic analysis, Arthrobacter sp. TS-15 is closely related to Arthrobacter aurescens Distinct from all known physiological paths, ephedrine metabolism by Arthrobacter sp. TS-15 is initiated by the selective oxidation of the hydroxyl function at the α-C atom, yielding methcathinone as the primary degradation product. Rational genome mining revealed a gene cluster potentially encoding the novel pathway. Two genes from the cluster, which encoded putative short-chain dehydrogenases, were cloned and expressed in Escherichia coli The obtained enzymes were strictly NAD + dependent and catalyzed the oxidation of ephedrine to methcathinone. Pseudoephedrine dehydrogenase (PseDH) selectively converted ( S,S )-(+)-pseudoephedrine and ( S,R )-(+)-ephedrine to ( S )- and ( R )-methcathinone, respectively. Ephedrine dehydrogenase (EDH) exhibited strict selectivity for the oxidation of the diastereomers ( R , S )-(-)-ephedrine and ( R , R )-(-)-pseudoephedrine. IMPORTANCE Arthrobacter sp. TS-15 is a newly isolated bacterium with the unique ability to degrade ephedrine isomers. The initiating steps of the novel metabolic pathway are described. Arthrobacter sp. TS-15 and its isolated ephedrine-oxidizing enzymes have potential for use in decontamination and synthetic applications., (Copyright © 2020 American Society for Microbiology.)

Ephedrae Herba and Ephedrae Radix et Rhizoma (Mahuang) have been used as Chinese herbal medicines. Ephedra plants mainly live in deserts and have good governance of desertification. Despite their important medicinal and environmental protection value, dietary supplements containing ephedrine from Ephedra species may threaten the health of people. Morphological resemblance amongst species causes difficulty in identifying the original species of Ephedra herbs. Chloroplast (CP) genome shows good prospects in identification and phylogenetic analysis. This study introduced the structures of the CP genomes of three Ephedra species and analysed their phylogenetic relationships. Three complete CP genomes of Ephedra showed four-part annular structures, namely, two single-copy regions and two inverted repeat regions. The entire CP genomes of three Ephedra species in terms of size were 109,550 bp ( E. sinica ), 109,667 bp ( E. intermedia ), and 109,558 bp ( E. equisetina ). Each CP genome of the three Ephedra species encoded 118 genes, including 73 protein-coding genes, 37 tRNA genes and 8 ribosomal RNA genes. Eleven high-variation regions were screened through mVISTA to be potential specific DNA barcodes for identifying Ephedra species. Maximum likelihood and maximum parsimony trees showed that CP genomes could be used to identify Ephedra species. The Ephedra species had a close phylogenetic relationship with Gnetum species and Welwitschia mirabilis . This research provided valuable information for the identification and phylogenetic analysis of gymnosperms and drug safety of Ephedra .

Ephedrine and its diastereomer pseudoephedrine have long been used in therapy and are part of over-the-counter combination drugs against colds or allergies. Nonetheless, there is scarcely any information on their plasma protein binding in literature. Plasma protein binding is an important parameter from a pharmacokinetic and pharmacodynamic point of view and can play a crucial role in therapy. The aim of this study was to determine the extent of plasma protein binding using ultrafiltration and different types of plasma proteins like human (HSA) and bovine serum albumin (BSA) and human serum. Two orthogonal methods - continuous and discontinuous ultrafiltration - were used to confirm our findings. To get some structural and stereochemical insights into binding affinity towards plasma proteins, all four stereoisomers of ephedrine and pseudoephedrine were included in this study. Since all four stereoisomers exhibit a low affinity towards albumin, other sympathomimetic drugs of structural similarity were tested to investigate the influence of the basic character of the Ephedra alkaloids in their binding to plasma proteins., (Copyright © 2018 Elsevier B.V. All rights reserved.)

Phenylalkylamines, such as the plant compounds ephedrine and pseudoephedrine and the animal neurotransmitters dopamine and adrenaline, compose a large class of natural and synthetic molecules with important physiological functions and pharmaceutically valuable bioactivities. The final steps of ephedrine and pseudoephedrine biosynthesis in members of the plant genus Ephedra involve N -methylation of norephedrine and norpseudoephedrine, respectively. Here, using a plant transcriptome screen, we report the isolation and characterization of an N -methyltransferase (NMT) from Ephedra sinica able to catalyze the formation of (pseudo)ephedrine and other naturally occurring phenylalkylamines, including N -methylcathinone and N -methyl(pseudo)ephedrine. Phenylalkylamine N -methyltransferase (PaNMT) shares substantial amino acid sequence identity with enzymes of the NMT family involved in benzylisoquinoline alkaloid (BIA) metabolism in members of the higher plant order Ranunculales, which includes opium poppy ( Papaver somniferum ). PaNMT accepted a broad range of substrates with phenylalkylamine, tryptamine, β-carboline, tetrahydroisoquinoline, and BIA structural scaffolds, which is in contrast to the specificity for BIA substrates of NMT enzymes within the Ranunculales. PaNMT transcript levels were highest in young shoots of E. sinica , which corresponded to the location of NMT activity yielding (pseudo)ephedrine, N -methylcathinone, and N -methyl(pseudo)ephedrine, and with in planta accumulation of phenylalkylamines. Co-expression of recombinant genes encoding PaNMT and an ω-transaminase (PP2799) from Pseudomonas putida in Escherichia coli enabled the conversion of exogenous ( R )-phenylacetylcarbinol (PAC) and ( S )-PAC to ephedrine and pseudoephedrine, respectively. Our work further demonstrates the utility of plant biochemical genomics for the isolation of key enzymes that facilitate microbial engineering for the production of medicinally important metabolites., (© 2018 Morris et al.)

Para-methoxymethamphetamine (PMMA) has caused numerous fatal poisonings worldwide and appears to be more toxic than other ring-substituted amphetamines. Systemic metabolism is suggested to be important for PMMA neurotoxicity, possibly through activation of minor catechol metabolites to neurotoxic conjugates. The aim of this study was to examine the metabolism of PMMA in humans; for this purpose, we used human liver microsomes (HLMs) and blood samples from three cases of fatal PMMA intoxication. We also examined the impact of CYP2D6 genetics on PMMA metabolism by using genotyped HLMs isolated from CYP2D6 poor, population-average, and ultrarapid metabolizers. In HLMs, PMMA was metabolized mainly to 4-hydroxymethamphetamine (OH-MA), whereas low concentrations of para-methoxyamphetamine (PMA), 4-hydroxyamphetamine (OH-A), dihydroxymethamphetamine (di-OH-MA), and oxilofrine were formed. The metabolite profile in the fatal PMMA intoxications were in accordance with the HLM study, with OH-MA and PMA being the major metabolites, whereas OH-A, oxilofrine, HM-MA and HM-A were detected in low concentrations. A significant influence of CYP2D6 genetics on PMMA metabolism in HLMs was found. The catechol metabolite di-OH-MA has previously been suggested to be involved in PMMA toxicity. Our studies show that the formation of di-OH-MA from PMMA was two to seven times lower than from an equimolar dose of the less toxic drug MDMA, and do not support the hypothesis of catechol metabolites as major determinants of fatal PMMA toxicity. The present study revealed the metabolite pattern of PMMA in humans and demonstrated a great impact of CYP2D6 genetics on human PMMA metabolism., (Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.)

Aim: Extracts from Ephedra species have been reported to be effective as antidiabetics. A previous in silico study predicted that ephedrine and five ephedrine derivatives could contribute to the described antidiabetic effect of Ephedra extracts by inhibiting dipeptidyl peptidase IV (DPP-IV). Finding selective DPP-IV inhibitors is a current therapeutic strategy for Type 2 diabetes mellitus management. Therefore, the main aim of this work is to experimentally determine whether these alkaloids are DPP-IV inhibitors. Materials & methods: The DPP-IV inhibition of Ephedra's alkaloids was determined via a competitive-binding assay. Then, computational analyses were used in order to find out the protein-ligand interactions and to perform a lead optimization., Results: Our results show that all six molecules are DPP-IV inhibitors, with IC 50 ranging from 124 μM for ephedrine to 28 mM for N-methylpseudoephedrine., Conclusion: Further computational analysis shows how Ephedra's alkaloids could be used as promising lead molecules for designing more potent and selective DPP-IV inhibitors.

Background: Inexpensive medicines with a long history of use may currently be prescribed off-label for rare indications. Reimbursement is at the discretion of health insurance companies, and may be unpredictable. The example addressed was ephedrine as add-on treatment for myasthenia gravis. Stakeholders from academia, a patient organization, the Dutch National Health Care Institute (NHCI) and Dutch Medicines Evaluation Board (MEB) advised on the trial design. The NHCI and MEB agreed to provide scientific advice on the suitability of the evidence generated by the trial, for regulatory decisions. This paper describes the feasibility of the trial and the utility of its aggregated results., Results: The trialists experienced the trial as feasible. Retrospective interviews showed that the trial as performed was acceptable to patients. The treatment effect in the primary outcome measure, muscle strength, was statistically significant when inferred to the population level, though the effect size was modest. Secondary outcomes were statistically significant in a preplanned, fixed effects analysis within the four patients. The NHCI advised that it could potentially make reimbursement decisions based on the Fitting Evidence framework, should the trialists decide to apply for reimbursement. The MEB advised that for a licensing decision, the N-of-1 design is a last-resort option for demonstrating treatment benefit in a rare disease. N-of-1 trials alone do not provide enough evidence on potential risk. The MEB found the current trial inconclusive. It suggested doing a 2-armed trial of longer duration, possibly with a different outcome measure (postponement of corticosteroid use). It suggested engaging a consultancy or commercial sponsor, should the trialists decide to seek market authorization of the drug., Conclusions: In theory, evidence from aggregated N-of-1 trials is suitable for use in licensing and reimbursement decisions. The current example illustrates differences in interpretation of N-of-1 results by health authorities. In the era of personalized medicine, consensus is required on the interpretation of data from study designs geared to small groups. Demonstrating effectiveness of inexpensive medicines in small populations may require involvement of non-commercial parties, to preserve affordability.

This study aims to study the changes of metabolism of Ephedra sinica Stapf caused by processing. A sensitive and rapid high-performance liquid chromatographic tandem mass spectrometry (LC-MS-MS) method was developed for the quantitation of the major metabolite of ephedrine, 4-hydroxyephedrine, utilizing lidocaine as the internal standard in rat urine. Urine samples were precipitated with acetonitrile. Chromatographic separation was achieved on an Ultimate C18 analytical column. Detection was performed by a multiple reaction monitoring mode via an electrospray ionization source operating in the positive ionization mode. The method was linear over the concentration range of 0.05-1.0c for all components. The intra- and inter-day precision values were <13.2% and the deviations ranged from -8.4% to 7.5%. The recoveries at three levels were more than 66.2%. The fully validated method was used to study the pharmacokinetic profile of 4-hydroxyephedrine in rat urine to investigate the effects caused by processing., (© The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.)

The Ephedra herb, which has been used in Kampo medicines, originates from terrestrial stems of Ephedra species. It is important to establish cultivation methods and cultivars to secure a stable supply of the Ephedra herb that would meet the quality standards for the ephedrine alkaloids content. In this study, we first grew Ephedra sinica plants derived from seeds in the field for 5 years. Then, for selective breeding of cultivars that could meet the quality standards for the ephedrine alkaloids content, we measured the content of total alkaloids (TAs), ephedrine (Eph), and pseudoephedrine (PEph) in individual plants derived from seedlings and grown for 4 years in the field. The range of the TA content in each individual plant was narrower than that among individual plants grown in the field. Therefore, individual plants were selected according to their TA content, Eph/PEph ratio, and stolon-formation capability. The selected individuals were propagated using stolons, and their TA content was studied for 2 years. In the second year, the TA content in terrestrial stems derived from stolons of the selected individuals was as high as that of their parents. Therefore, it was confirmed that the selected individuals that were propagated using stolons could produce TA reproducibly. This study suggested that selective breeding using stolon propagation is effective for stabilizing Ephedra herb TA content.

This work involves the study of the solid-phase and solution crystallization behavior of the N-methylephedrine enantiomers. A systematic investigation of the melt phase diagram of the enantiomeric N-methylephedrine system was performed considering polymorphism. Two monotropically related modifications of the enantiomer were found. Solubilities and the ternary solubility phase diagrams of N-methylephedrine enantiomers in 2 solvents [isopropanol:water, 1:3 (Vol) and (2R, 3R)-diethyl tartrate] were determined in the temperature ranges between 15°C and 25°C, and 25°C and 40°C, respectively. Preferential nucleation and crystallization experiments at higher supersaturation leading to an unusual oscillatory crystallization behavior as well as a successful preferential crystallization experiment at lower supersaturation are presented and discussed., (Copyright © 2016. Published by Elsevier Inc.)

Ephedra sinica Stapf (Ephedraceae) is a broom-like shrub cultivated in arid regions of China, Korea and Japan. This plant accumulates large amounts of the ephedrine alkaloids in its aerial tissues. These analogs of amphetamine mimic the actions of adrenaline and stimulate the sympathetic nervous system. While much is known about their pharmacological properties, the mechanisms by which they are synthesized remain largely unknown. A functional genomics platform was established to investigate their biosynthesis. Candidate enzymes were obtained from an expressed sequence tag collection based on similarity to characterized enzymes with similar functions. Two aromatic aminotransferases, EsAroAT1 and EsAroAT2, were characterized. The results of quantitative reverse transcription-polymerase chain reaction indicated that both genes are expressed in young stem tissue, where ephedrine alkaloids are synthesized, and in mature stem tissue. Nickel affinity-purified recombinant EsAroAT1 exhibited higher catalytic activity and was more homogeneous than EsAroAT2 as determined by size-exclusion chromatography. EsAroAT1 was highly active as a tyrosine aminotransferase with α-ketoglutarate followed by α-ketomethylthiobutyrate and very low activity with phenylpyruvate. In the reverse direction, catalytic efficiency was similar for the formation of all three aromatic amino acids using L-glutamate. Neither enzyme accepted putative intermediates in the ephedrine alkaloid biosynthetic pathway, S-phenylacetylcarbinol or 1-phenylpropane-1,2-dione, as substrates.

Background: Maternal hypotension after spinal anesthesia for cesarean delivery is common. Many studies performed on the b2-adrenoceptor (b2AR) gene variants and their association with vasopressor requirements during and after neuroaxial block have contradictory conclusions., Objectives: The aim of the study was to evaluate the influence of the b2AR in codons 16 and 27 on the incidence of maternal hypotension and ephedrine consumption after spinal anesthesia for cesarean delivery in an Arab ethnic group., Design: A prospective gene association study., Setting: Jordan University Hospital from 1 July 2013 to 31 January 2014., Patients and Methods: We enrolled parturients who underwent cesarean delivery under spinal anesthesia. Spinal anesthesia was performed with 10 mg plain bupivacaine along with 25 micro g fentanyl. Hypotension was treated with ephedrine and the amount consumed in the first 30 minutes after spinal anesthesia was calculated. The b2AR genotype at codons 16 and 27 was determined. We studied the correlation between the b2AR genotype and the amount of ephedrine consumption after spinal anesthesia., Main Outcome Measures: Amount of ephedrine used., Results: Of 250 patients enrolled in the study, genotype and clinical data were available for 234 cases. Ephedrine was used in 94% of patients. There was a significant effect of b2AR genotype on ephedrine dose in the first 30 minutes after spinal anesthesia in codon 16 and 27. Arg16 homozygotes received less ephedrine (14.0 [11.2] mg) than Gly16 homozygotes (38.6 [25.7] mg) and Arg16Gly heterozygotes (33.42 [22.70] mg) (P < .0001). Gln27 homozygotes received less ephedrine (18.2 [12.8] mg) than Glu 27 homozygotes (47.5 [27.0] mg) and Gln27Glu heterozygotes (48.2 [23.7] mg). (P < .0001)., Conclusion: In an Arab ethnic group, the b2AR gene has a role in maternal hypotension after spinal anesthesia. The Gly16 and Glu27 alleles have a higher incidence of arterial hypotension and required a greater amount of vasopressor to treat hypotension compared with homozygous Arg16 and Gln27 carriers., Limitations: Fasting time and hydration protocol, the use of a fixed dose of ephedrine, and relatively small sample size.

Introduction: Cardiac resynchronization therapy (CRT) is an accepted treatment in patients with end-stage heart failure. PET permits the absolute quantification of global and regional homogeneity in cardiac sympathetic innervation. We evaluated the variation of cardiac adrenergic activity in patients with idiopathic heart failure (IHF) disease (NYHA III-IV) after CRT using (11)C-hydroxyephedrine (HED) PET/CT., Methods: Ten IHF patients (mean age = 68; range = 55-81; average left ventricular ejection fraction 26 ± 4%) implanted with a resynchronization device underwent three HED PET/CT studies: PET 1 one week after inactive device implantation; PET 2, one week after PET 1 under stimulated rhythm; PET 3, at 3 months under active CRT. A dedicated software (PMOD 3.4 version) was used to estimate global and regional cardiac uptake of HED through 17 segment polar maps., Results: At baseline, HED uptake was heterogeneously distributed throughout the left ventricle with a variation coefficient of 18 ± 5%. This variable markedly decreased after three months CRT (12 ± 5%, p < 0.01). Interestingly, subdividing the 170 myocardial segments (17 segments of each patient multiplied by the number of patients) into two groups, according to the median value of tracer uptake expressed as % of maximal myocardial uptake (76%), we observed a different behaviour depending on baseline innervation: HED uptake significantly increased only in segments with "impaired innervation" (SUV 2.61 ± 0.92 at PET1 and 3.05 ± 1.67 at three months, p < 0.01)., Conclusion: As shown by HED PET/CT uptake and distribution, improvement in homogeneity of myocardial neuronal function reflected a selective improvement of tracer uptake in regions with more severe neuronal damage., Advances in Knowledge: These finding supported the presence of a myocardial regional variability in response of cardiac sympathetic system to CRT and a systemic response involving remote tissues with rich adrenergic innervation., Implication for Patient Care: This work might contribute to identify imaging parameters that could predict the response to CRT therapy., (Copyright © 2015 Elsevier Inc. All rights reserved.)

A new oriented method using a diazonium salt reaction was developed for linking β2-adrenoceptor (β2-AR) on the surface of macroporous silica gel. Stationary phase containing the immobilised receptor was used to investigate the interaction between β2-AR and ephedrine plus pseudoephedrine by zonal elution. The isotherms of the two drugs best fit the Langmuir model. Only one type of binding site was found for ephedrine and pseudoephedrine targeting β2-AR. At 37 °C, the association constants during the binding were (5.94±0.05)×103/M for ephedrine and (3.80±0.02) ×103/M for pseudoephedrine, with the binding sites of (8.92±0.06) ×10-4 M. Thermodynamic studies showed that the binding of the two compounds to β2-AR was a spontaneous reaction with exothermal processes. The ΔGθ, ΔHθ and ΔSθ for the interaction between ephedrine and β2-AR were -(22.33±0.04) kJ/mol, -(6.51±0.69) kJ/mol and 50.94±0.31 J/mol·K, respectively. For the binding of pseudoephedrine to the receptor, these values were -(21.17±0.02) kJ/mol, -(7.48±0.56) kJ/mol and 44.13±0.01 J/mol·K. Electrostatic interaction proved to be the driving force during the binding of the two drugs to β2-AR. The proposed immobilised method will have great potential for attaching protein to solid substrates and realizing the interactions between proteins and drugs.

Purpose: (11)C-Hydroxyephedrine (HED) and radioiodinated metaiodobenzylguanidine ((123)I/(131)I-MIBG) are catecholamine analogue tracers for sympathetic nerve positron emission tomography/single photon emission computed tomography (PET/SPECT) imaging. In contrast to humans, rat hearts demonstrate high nonneural catecholamine uptake-2 in addition to neural uptake-1, the contributions of which to tracer accumulation are not fully elucidated., Methods: Wistar rats were studied using the following pretreatments: uptake-1 blockade with desipramine 2 mg/kg IV, both uptake-1 and -2 blockade with phenoxybenzamine 50 mg/kg IV, or control with saline IV. HED or (123)I-MIBG was injected 10 min after pretreatment, and rats were sacrificed 10 min later. Heart to blood tissue count ratio (H/B ratio) was obtained using a gamma counter. To determine regional tracer uptake, dual-tracer autoradiography was performed with HED and (131)I-MIBG in Wistar rats with chronic infarction by transient coronary occlusion and reperfusion and in healthy control rats. Local tracer distributions were analyzed, and the infarcted rats' local tracer distributions were compared with histology., Results: The H/B ratios in control hearts were 34.4 ± 1.7 and 25.5 ± 2.1 for HED and (123)I-MIBG, respectively. Desipramine led to a significant decrease in HED (3.2 ± 0.5, p < 0.0001), while there was no change in (123)I-MIBG (25.5 ± 6.4, p = n.s.). Phenoxybenzamine led to a significant decrease in both HED and (123)I-MIBG (3.5 ± 0.02, 4.3 ± 0.7, p < 0.0001). Only HED showed a subepicardium-subendocardium gradient in healthy control hearts which is consistent with physiological innervation, while (131)I-MIBG was evenly distributed throughout the myocardium. (131)I-MIBG uptake defect closely matched the scar area determined by histology [3.8 ± 2.3% ((131)I-MIBG defect) vs 4.0 ± 2.4% (scar)]. However, the scar area was clearly exceeded by the HED uptake defect (9.1 ± 2.2%, p < 0.001)., Conclusion: HED uptake showed high specificity to neural uptake-1 in rat hearts. On the other hand, (123)I/(131)I-MIBG demonstrated distinct characters of regional tracer distribution and uptake mechanism that are compatible with significant contribution of nonneural uptake-2.

Introduction: The norepinephrine analogue (11)C-meta-hydroxyephedrine (HED) has been used to interrogate sympathetic neuronal reuptake in cardiovascular disease. Application for longitudinal studies in small animal models of disease necessitates an understanding of test-retest variability. This study evaluated the repeatability of multiple quantitative cardiac measurements of HED retention and washout and the pharmacological response to reuptake blockade and enhanced norepinephrine levels., Methods: Small animal PET images were acquired over 60 min following HED administration to healthy male Sprague Dawley rats. Paired test and retest scans were undertaken in individual animals over . Additional HED scans were conducted following administration of norepinephrine reuptake inhibitor desipramine or continuous infusion of exogenous norepinephrine. HED retention was quantified by retention index, standardized uptake value (SUV), monoexponential and one-compartment washout. Plasma and cardiac norepinephrine were measured by high performance liquid chromatography., Results: Test retest variability was lower for retention index (15% ± 12%) and SUV (19% ± 15%) as compared to monoexponential washout rates (21% ± 13%). Desipramine pretreatment reduced myocardial HED retention index by 69% and SUV by 85%. Chase treatment with desipramine increased monoexponential HED washout by 197% compared to untreated controls. Norepinephrine infusion dose-dependently reduced HED accumulation, reflected by both retention index and SUV, with a corresponding increase in monoexponential washout. Plasma and cardiac norepinephrine levels correlated with HED quantitative measurements., Conclusion: The repeatability of HED retention index, SUV, and monoexponential washout supports its suitability for longitudinal PET studies in rats. Uptake and washout of HED are sensitive to acute increases in norepinephrine concentration., (Copyright © 2013 Elsevier Inc. All rights reserved.)

Introduction: Most radiotracers for imaging of cardiac sympathetic innervation are substrates of the norepinephrine transporter (NET). The goal of this study was to characterize the NET transport kinetics and binding affinities of several sympathetic nerve radiotracers, including [(11)C]-(-)-meta-hydroxyephedrine, [(11)C]-(-)-epinephrine, and a series of [(11)C]-labeled phenethylguanidines under development in our laboratory. For comparison, the NET transport kinetics and binding affinities of some [(3)H]-labeled biogenic amines were also determined., Methods: Transport kinetics studies were performed using rat C6 glioma cells stably transfected with the human norepinephrine transporter (C6-hNET cells). For each radiolabeled NET substrate, saturation transport assays with C6-hNET cells measured the Michaelis-Menten transport constants Km and Vmax for NET transport. Competitive inhibition binding assays with homogenized C6-hNET cells and [(3)H]mazindol provided estimates of binding affinities (KI) for NET., Results: Km, Vmax and KI values were determined for each NET substrate with a high degree of reproducibility. Interestingly, C6-hNET transport rates for 'tracer concentrations' of substrate, given by the ratio Vmax/Km, were found to be highly correlated with neuronal transport rates measured previously in isolated rat hearts (r(2)=0.96). This suggests that the transport constants Km and Vmax measured using the C6-hNET cells accurately reflect in vivo transport kinetics., Conclusion: The results of these studies show how structural changes in NET substrates influence NET binding and transport constants, providing valuable insights that can be used in the design of new tracers with more optimal kinetics for quantifying regional sympathetic nerve density., (Copyright © 2013 Elsevier Inc. All rights reserved.)

Ephedrine and pseudoephedrine are phenylpropylamino alkaloids widely used in modern medicine. Some Ephedra species such as E. sinica Stapf (Ephedraceae), a widely used Chinese medicinal plant (Chinese name: Ma Huang), accumulate ephedrine alkaloids as active constituents. Other Ephedra species, such as E. foeminea Forssk. (syn. E. campylopoda C.A. Mey) lack ephedrine alkaloids and their postulated metabolic precursors 1-phenylpropane-1,2-dione and (S)-cathinone. Solid-phase microextraction analysis of freshly picked young E. sinica and E. foeminea stems revealed the presence of increased benzaldehyde levels in E. foeminea, whereas 1-phenylpropane-1,2-dione was detected only in E. sinica. Soluble protein preparations from E. sinica and E. foeminea stems catalyzed the conversion of benzaldehyde and pyruvate to (R)-phenylacetylcarbinol, (S)-phenylacetylcarbinol, (R)-2-hydroxypropiophenone (S)-2-hydroxypropiophenone and 1-phenylpropane-1,2-dione. The activity, termed benzaldehyde carboxyligase (BCL) required the presence of magnesium and thiamine pyrophosphate and was 40 times higher in E. sinica as compared to E. foeminea. The distribution patterns of BCL activity in E. sinica tissues correlates well with the distribution pattern of the ephedrine alkaloids. (S)-Cathinone reductase enzymatic activities generating (1R,2S)-norephedrine and (1S,1R)-norephedrine were significantly higher in E. sinica relative to the levels displayed by E. foeminea. Surprisingly, (1R,2S)-norephedrine N-methyltransferase activity which is a downstream enzyme in ephedrine biosynthesis was significantly higher in E. foeminea than in E. sinica. Our studies further support that benzaldehyde is the metabolic precursor to phenylpropylamino alkaloids in E. sinica., (Copyright © 2012 Elsevier Ltd. All rights reserved.)

Amphetamine analogs are produced by plants in the genus Ephedra and by Catha edulis, and include the widely used decongestants and appetite suppressants pseudoephedrine and ephedrine. A combination of yeast (Candida utilis or Saccharomyces cerevisiae) fermentation and subsequent chemical modification is used for the commercial production of these compounds. The availability of certain plant biosynthetic genes would facilitate the engineering of yeast strains capable of de novo pseudoephedrine and ephedrine biosynthesis. Chemical synthesis has yielded amphetamine analogs with myriad functional group substitutions and diverse pharmacological properties. The isolation of enzymes with the serendipitous capacity to accept novel substrates could allow the production of substituted amphetamines in synthetic biosystems. Here, we review the biology, biochemistry and biotechnological potential of amphetamine analogs in plants., (Copyright © 2012 Elsevier Ltd. All rights reserved.)

Recent abuse of designer drugs such as mephedrone has presented a requirement for sensitive, reliable and reproducible methods for the detection of these controlled drugs in different matrices. This study focuses on a fully developed validated method for the quantitative analysis of mephedrone and its two metabolites 4-methylephedrine and 4-methylnorephedrine in human hair. The calibration curve was found to be linear in the range 5-100 pg/mg for mephedrone and 10-150 pg/mg for 4-methylephedrine and 4-methylnorephedrine. The method was successfully validated for the intraday precision, interday precision, limit of detection, accuracy and extraction recovery. Five out of 154 hair samples were confirmed to be positive for mephedrone. Due to the structural similarities to other methcathinones and amphetamines, one can propose the metabolism for mephedrone based on a similar pathway that has been previously used for these psychoactive drugs. The outlined method can be valuable for the future detection of mephedrone and its two metabolites in hair., (Copyright © 2011 Elsevier B.V. All rights reserved.)

Metabolome analysis of four varieties of Ephedra plants, which contain different amounts of ephedrine alkaloids, was demonstrated in this study. The metabolites were comprehensively analyzed by using ultra performance liquid chromatography (UPLC) coupled with quadrupole time-of-flight mass spectrometry (Q-TOF-MS) and the ephedrine alkaloids were also profiled. Subsequently, multivariate analyses of principal component analysis (PCA) and batch-learning self-organizing mapping (BL-SOM) analysis were applied to the raw data of the total ion chromatogram (TIC). PCA was performed to visualize the fingerprints characteristic for each Ephedra variant and the independent metabolome clusters were formed. The metabolite fingerprints were also visualized by BL-SOM analysis and were displayed as a lattice of colored individual cells which was characteristic for each Ephedra variant. BL-SOM analysis was also used for identification of chemical marker peaks because the information assigned to a cell represented either increases or decreases in peak intensities. Using this analysis, ephedrine alkaloids were successfully selected from the TICs as chemical markers for each Ephedra variant and this result suggested that BL-SOM analysis was an effective method for the selection of marker metabolites. We report our study here as a practical case of metabolomic study on medicinal resources., (Georg Thieme Verlag KG Stuttgart, New York.)

The genomic DNA from Ephedra glauca was randomly transferred to Saccharomyces cerevisiae and Hansenula anomala by argon and nitrogen ion implantation. Through repeated subculturing and using reversed phase high-performance liquid chromatography analysis to quantify the concentrations of the secondary metabolites, l-ephedrine and d-pseudoephedrine, 12 recombinant strains of genetically stable yeast were obtained, each using glucose as a carbon source, NaNO3 as a nitrogen source and producing l-ephedrine and/or d-pseudoephedrine. After culturing in liquid medium for 72 h, extracellular l-ephedrine and d-pseudoephedrine concentrations of 18.85 and 4.11 mg/L, respectively, were detected. Using l-ephedrine and d-pseudoephedrine as the target products, the transformation efficiencies of the genomic DNA from E. glauca transferred to S. cerevisiae and H. anomala were 1.15% (1/87) and 2.13% (8/376), respectively. The addition of the amino acid, L-Phe, to culture media substantially changed the amount of l-ephedrine and/or d-pseudoephedrine produced by the recombined yeasts. However, the change in metabolite production was not consistent among strains, rising in some, while dropping to nondetectable levels in others. After random amplification of polymorphic DNA (RAPD) analysis, four RAPD primers were obtained from the initial 100 RAPD primers, each amplifying different fragments with the recombined yeast Ar&#95;Han0458 genome. Using one primer as polymerase chain reaction primer, the result showed that the recombined yeast Ar&#95;Han0458 genome matched E. glauca genomic DNA at 150 bp, indicating a successful transfer of genetic information, facilitated by ion implantation.

Introduction: Recently, neurological abnormalities in methcathinone users have been attributed to manganese. We report similar toxicity in three patients following the use of a mixture similar to methcathinone: potassium permanganate, ephedrine, and aspirin., Case Reports: Three teenagers (15 to 19 years old) presented with extrapyramidal abnormalities and movement disorders following chronic intravenous use of a mixture known as "Russian Cocktail". All three patients had multiple movement disorders. One patient had normal blood manganese concentration (<19 microg/L) and MRI. The other two had elevated blood manganese (2100 microg/L and 3176 microg/L) and MRIs showing bilateral symmetric hyper-intensities on T1-weighted-images in the dentate nucleus, subcortical white substance of cerebellar hemisphere, globus pallidus, and putamen. Abstinence and treatment with EDTA, levodopa, and para-aminosalicylic acid was associated with decreasing blood manganese concentrations and subjective improvement, but no change in objective findings., Discussion: The "Russian Cocktail" likely contains manganese as a result of the oxidation of ephedrine by potassium permanganate in water acidified by acetylsalicylic acid. We believe that manganese with the possible contribution of methcathinone caused the neurological impairments., Conclusions: Three toxic substances have been made into a mixture administered intravenously, similar to methcathinone. Our patients learned of this mixture, called "Russian Cocktail", from their friends. The toxicity from repeated use of this mixture is one of extrapyramidal abnormalities and movement disorders. Standard therapies were unsuccessful in reversing the clinical toxicity.

Reports on dynamic combinatorial chemistry have almost exclusively involved small libraries of 10-100 compounds. We now show how more than 9000 compounds can be screened in a single LC-MS analysis to reveal a series of new receptors that bind ephedrine in water. These results demonstrate the feasibility of screening DCLs that are substantially larger than the solution-phase libraries reported thus far.

Fourier transform mid-infrared spectroscopy (FT-MIR) coupled with a homemade attenuated total reflectance (ATR) flow-cell was used for on-line monitoring of a biotransformation reaction. The reaction was also monitored off-line by gas chromatography-mass spectrometry (GC-MS) enabling to establish a multivariate model for the infrared data based on partial least squares (PLS) regression. The method developed allowed the simultaneous determination of the substrate, two intermediates and the final product involved in the reduction reaction of 1-phenyl 1,2-propanedione at an initial concentration of 0.5% (v/v). The reaction was accomplished with a whole-cell suspension of Saccharomyces cerevisiae in a phosphate buffer of pH 3.0 at 32+/-1 degrees C. The ATR infrared monitoring was performed directly on the suspension cell without any separation process or extraction over 3h, totaling 188 spectra. The data were split into two subsets, with 158 times for calibration and 30 times for validation. The results showed that the proposed method may be used for on-line monitoring of the biotransformation reactions when the initial concentration is very low.

The genome DNA from Ephedra glauca was randomly transferred into Hansenula anomala, respectively, by argon ion bombardment. Then, after screening by the motheds of bromothymol blue indicator selection, slant cultivation, l-ephedrine and d-pseudoephedrine copper chromic salt qualitative test and RP-HPLC determination, 3 strains, producing recombined yeasts were obtained, which can use glucose as a carbon source, NaNO3 as nitrogen source and be genetically stable. After cultivated in liquid medium for 72 hours and analyzed by the RP-HPLC, the recombined strains can produce l-ephedrine 11.87 mg/L and d-pseudoephedrine 4.11 mg/L excellular, d-pseudoephedrine 294.86 mg/g dry cell incellular, but l-ephedrine not detected incellular. The transformation efficiency of Ephedra genome DNA transferred into yeasts via argon ion bombardment was 0.65%. The effects of Ephedra genome DNA macromolecule integrity on yeast transformation system were discussed. The results shown that DNA macromolecule with integrated structure used as exogenous donor can obtain higher transformation efficiency than DNA macromolecule random fragments by ion implantation mediated DNA transformation. It was inferred that biosynthesis of l-ephedrine and the d-pseudoephedrin were controlled by linked together genes or gene clusters.

A liquid chromatography stationary phase containing immobilized membranes obtained from a cell line that expresses the human organic cation transporter (hOCT1-IAM) has been used to study the binding of the enantiomers of propranolol, atenolol, pseudoephedrine, and alpha-methylbenzylamine to the immobilized hOCT1. Frontal displacement chromatography was used to determine the binding affinities (K(d) values), and the data demonstrate that there was an enantioselective difference in the K(d) values of the enantiomers of propranolol, atenolol, and pseudoephedrine, while alpha-methylbenzylamine did not significantly bind to the transporter. Competitive inhibition studies with the cell line used to create the chromatographic column demonstrated that, for the enantiomers of propranolol, the ratio of the chromatographically determined K(d) values [K(d (+)-(R)-propranolol)/K(d (-)-(S)-propranolol) = 2.98] reflected an enantioselective difference in the functional activity of the two enantiomers [IC(50 (+)-(R)-propranolol)/IC(50 (-)-(S)-propranolol) = 2.75]. The chromatographically determined K(d) values were used to construct an initial pharmacophore which contains a hydrogen bond donating site that appears to be responsible for the observed enantioselectivity.

Aim: To estabilish a rapid and sensitive LC-ESI-ITMSn method for the identification of ephedrine and its main metabolites in rat urine., Methods: After optimizing the detection condition of LC-ESI-ITMSn chromatography and mass spectrometry by using a standard ephedrine, the ionization and cleavage rules of ephedrine in ESI-MS and ESI-MSn modes were summarized, and then serving as the basis for the metabolite analysis of ephedrine in rat urine. Rat urine samples of 0-48 h were collected after ig 10 mg x kg(-1) ephedrine, then the samples were purified through C18 solid-phase extraction cartridge. The purified samples were analyzed by LC-ESI-ITMSn., Results: The structures of ephedrine metabolites were elucidated according to the changes of the molecular weights of the metabolites (deltaM) and their cleavage pattern in ESI-ITMSn. As a result, three phase I metabolites and the parent drug ephedrine were identified existing in rat urine, but no phase II metabolites were found., Conclusion: The LC-ESI-ITMSn method is rapid and highly sensitive and sepecific, it is suitable for the identification of ephedrine and its metabolites in rat urine.

Preparations containing caffeine and ephedrine have become increasingly popular among sportspersons in recent years as a means to enhance athletic performance. This is due to a slowly accumulating body of evidence suggesting that combination of the two drugs may be more efficacious than each one alone. Caffeine is a compound with documented ergogenicity in various exercise modalities, while ephedrine and related alkaloids have not been shown, as yet, to result in any significant performance improvements. Caffeine-ephedrine mixtures, however, have been reported in several instances to confer a greater ergogenic benefit than either drug by itself. Although data are limited and heterogeneous in nature to allow for reaching consensus, the increase in performance is a rather uniform finding as it has been observed during submaximal steady-state aerobic exercise, short- and long-distance running, maximal and supramaximal anaerobic cycling, as well as weight lifting. From the metabolic point of view, combined ingestion of caffeine and ephedrine has been observed to increase blood glucose and lactate concentrations during exercise, wheareas qualitatively similar effects on lipid fuels (free fatty acids and glycerol) are less pronounced. In parallel, epinephrine and dopamine concentrations are significantly increased, wheareas the effects on norepinephrine are less clear. With respect to pulmonary gas exchange during short-term intense exercise, no physiologically significant effects have been reported following ingestion of caffeine, ephedrine or their combination. Yet, during longer and/or more demanding efforts, some sporadic enhancements have indeed been shown. On the other hand, a relatively consistent cardiovascular manifestation of the latter preparation is an increase in heart rate, in addition to that caused by exercise alone. Finally, evidence to date strongly suggests that caffeine and ephedrine combined are quite effective in decreasing the rating of perceived exertion and this seems to be independent of the type of activity being performed. In general, our knowledge and understanding of the physiological, metabolic and performance-enhancing effects of caffeine-ephedrine mixtures are still in their infancy. Research in this field is probably hampered by sound ethical concerns that preclude administration of potentially hazardous substances to human volunteers. In contrast, while it is certainly true that caffeine and especially ephedrine have been associated with several acute adverse effects on health, athletes do not seem to be concerned with these, as long as they perceive that their performance will improve. In light of the fact that caffeine and ephedra alkaloids, but not ephedrine itself, have been removed from the list of banned substances, their use in sports can be expected to rise considerably in the foreseeable future. Caffeine-ephedra mixtures may thus become one of most popular ergogenic aids in the years to come and while they may indeed prove to be one of the most effective ones, and probably one of the few legal ones, whether they also turn out to be one of the most dangerous ones awaits to be witnessed.

A patient with a history of ingesting large quantities of an over-the-counter stimulant developed renal calculi that on further analysis, after stone passage, revealed increased amounts of ephedrine. Over the course of 7 months, all of the patient's ephedrine stones were managed successfully by alkalinization. Similar to previously reported ephedrine calculi, these stones were radiolucent on x-ray imaging, but their course was monitored on serial nonenhanced computed tomography scans. We believe this to be the first reported use of alkaline therapy for the dissolution of renal stones containing ephedrine.

(+)- and (-)-Chloroephedrine, and their respective aziridines, cis- and trans-1,2-dimethyl-3-phenylaziridine, have been reported present in clandestinely synthesized methamphetamine. Since methamphetamine and structurally related compounds are potential substrates for human liver CYP2D6, the possible interaction of the chloroephedrines with human liver CYP2D6 was evaluated. Computational methods (using Flexidock and HINT in SYBYL) were used to determine the feasibility of (+)- or (-)-chloroephedrine and cis- or trans-1,2-dimethyl-3-phenylaziridine binding in the active site of a three dimensional CYP2D6 molecular model. Although modeling indicates both (+)- and (-)-chloroephedrine would bind comparably to methamphetamine, the binding energies of cis- or trans-1,2-dimethyl-3-phenylaziridine products indicate a preference for trans-1,2-dimethyl-3-phenylaziridine, the product formed from (-)-chloroephedrine. The effects of (+)- and (-)-chloroephedrine on the metabolism of dextromethorphan in human liver microsomes were then experimentally evaluated. (+)-Chloroephedrine (50 micro M) had no effect on human CYP2D6. (-)-Chloroephedrine appeared to be selective for human CYP2D6 versus CYP1A2 and CYP3A4/5. The inhibition of CYP2D6 was time-dependent, not dependent on metabolic activation, and irreversible. It appeared to bind at the active site of CYP2D6 with an apparent K(i) of 226 micro M, with a k(int) of 0.039 min(-1), and a t(1/2) of 23 min. Due to the irreversible nature of this inhibition, this impurity in clandestinely synthesized methamphetamine may be important and warrant further study.

The optimization of a continuous enzymatic reaction yielding (R)-phenylacetylcarbinol (PAC), an intermediate of the L-ephedrine synthesis, is presented. We compare the suitability of three pyruvate decarboxylases (PDC), PDC from Saccharomyces cerevisiae, PDC from Zymomonas mobilis, and a potent mutant of the latter, PDCW392M, with respect to their application in the biotransformation using acetaldehyde and benzaldehyde as substrates. Among these, the mutant enzyme was the most active and most stable one. The reaction conditions of the carboligation reaction were investigated by determining initial rate velocities with varying substrate concentrations of both aldehydes. From the resulting data a kinetic model was inferred which fits the experimental data with sufficient reliability to deduce the optimal concentrations of both substrates for the enzymatic process. The results demonstrate that the carboligation is most efficiently performed using a continuous reaction system and feeding both aldehydes in equimolar concentration. Initial studies using a continuously operated enzyme-membrane reactor gave (R)-PAC with a space-time yield of 81 g L(-1). d(-1) using a substrate concentration of 50 mM of both aldehydes. The yield was easily increased by cascadation of enzyme-membrane reactors. The new strategy allows the synthesis of (R)-PAC from cheap substrates in an aqueous reaction system. It thereby overcomes the limitation of by-product formation that severely limits the current fermentative process.

Objective: The optimal biosynthesis of L-PAC by immobilized Sc-5 yeast cell was systematically studied in this paper., Method: Biosynthesis., Result and Conclusion: The average of L-PAC yield produced by the immobilized Sc-5 yeast cell is > or = 2 g.L-1 and half life > or = 240 h.

Objective: To determine if an herbal dietary supplement for weight loss increases metabolism., Design: Measurement of peak oxygen consumption in response to the supplement followed by a double-blind placebo-controlled crossover measurement of oxygen consumption in response to the supplement., Setting: The study was conducted in an academic research clinic., Subjects: Ten obese females (aged 41 +/- 4 years [body mass index (BMI)] 33.3 +/- 2.6 kg/m2) participated in the peak oxygen consumption test; six of these females participated in the crossover trial., Interventions and Outcome Measures: Peak oxygen consumption was measured for 45 minutes after taking two herbal dietary supplement capsules orally, each containing the equivalent of 10 mg of caffeine and 5 mg of ephedrine. The crossover trial measured oxygen consumption for 45 minutes after taking two herbal dietary supplement capsules or two placebo capsules orally., Results: The herbal dietary supplement increased peak oxygen consumption 0.178 +/- 0.03 (SEM) kcal/min (8.01 +/- 1.35 kcal/min expressed over 45 minutes) above baseline (p < 0.0001), and 2.0 +/- 0.56 kcal/min over 45 minutes compared to placebo (p < 0.006)., Conclusions: The herbal dietary supplement increased oxygen consumption when taken according to the package directions. The significance of this rise for weight loss requires further research.

Herbs have been used throughout history to enhance physical performance, but scientific scrutiny with controlled clinical trials has only recently been used to study such effects. The following herbs are currently used to enhance physical performance regardless of scientific evidence of effect: Chinese, Korean, and American ginsengs; Siberian ginseng, mahuang or Chinese ephedra; ashwagandha; rhodiola; yohimbe; CORDYCEPS: fungus, shilajit or mummio; smilax; wild oats; Muira puama; suma (ecdysterone); Tribulus terrestris; saw palmetto berries; beta-sitosterol and other related sterols; and wild yams (diosgenin). Controlled studies of Asian ginsengs found improvements in exercise performance when most of the following conditions were true: use of standardized root extracts, study duration (>8 wk, daily dose >1 g dried root or equivalent, large number of subjects, and older subjects. Improvements in muscular strength, maximal oxygen uptake, work capacity, fuel homeostasis, serum lactate, heart rate, visual and auditory reaction times, alertness, and psychomotor skills have also been repeatedly documented. Siberian ginseng has shown mixed results. Mahuang, ephedrine, and related alkaloids have not benefited physical performance except when combined with caffeine. Other herbs remain virtually untested. Future research on ergogenic effects of herbs should consider identity and amount of substance or presumed active ingredients administered, dose response, duration of test period, proper experimental controls, measurement of psychological and physiologic parameters (including antioxidant actions), and measurements of performance pertinent to intended uses.

l-Ephedrine is an active ingredient in several herbal formulations with a mechanism of action similar to amphetamine and methamphetamine. However, its potential to damage dopaminergic terminals in the caudate/putamen (CPu) has yet to be fully evaluated. The studies here used in vivo brain microdialysis experiments to determine the systemic doses and extracellular brain levels of l-ephedrine necessary to produce similar increases in CPu extracellular dopamine and marked hyperthermia that were previously shown necessary for amphetamine-induced neurotoxicity in male Sprague-Dawley rats. At an environmental temperature of 23 degrees C, a single 40 mg/kg intraperitoneal (ip) dose of l-ephedrine produced marked hyperthermia (>/= 40 degrees C), peak microdialysate ephedrine levels of 7.3 +/- 1.2 microM, and a 20-fold increase in microdialysate dopamine levels. Twenty-five mg/kg produced a lesser degree of hyperthermia, peak microdialysate ephedrine levels of 2.6 +/- 0.4 microM, and a 10-fold increase in dopamine levels. Three doses of 40 mg/kg given at 3-h intervals or 4 doses of 25 mg/kg l-ephedrine given at 2-h intervals were compared with 4 doses of 5 mg/kg d-amphetamine given at 2-h intervals. Multiple doses of either ephedrine or amphetamine caused severe hyperthermia (>/= 41.3 degrees C) but striatal tissue levels of dopamine 7 days after dosing were reduced only 25% or less by ephedrine compared to the 75% reductions produced by amphetamine. The increases in CPu microdialysate levels of serotonin produced by either 4 x 25 mg/kg l-ephedrine or 4 x 5 mg/kg d-amphetamine did not significantly differ, but elevation of dopamine levels by d-amphetamine were over 2-fold times the level caused by l-ephedrine. Microdialysate glutamate levels were elevated to the same extent by either 25 mg/kg l-ephedrine or 4 x 5 mg/kg d-amphetamine. l-Ephedrine may not be as neurotoxic to dopaminergic terminals as d-amphetamine, because non-lethal doses of l-ephedrine do not sufficiently increase the CPu dopamine levels within nerve terminals or the extracellular space to those necessary for a more pronounced long-term dopamine depletion.

We examined the role that aromatic residues located in the transmembrane helices of the alpha(1a)-adrenergic receptor play in promoting antagonist binding. Since alpha(1)-antagonists display low affinity binding at beta(2)-adrenergic receptors, two phenylalanine residues, Phe-163 and Phe-187, of the alpha(1a)-AR were mutated to the corresponding beta(2)-residue. Neither F163Q nor F187A mutations of the alpha(1a) had any effect on the affinity of the alpha(1)-antagonists. However, the affinity of the endogenous agonist epinephrine was reduced 12.5- and 8-fold by the F163Q and F187A mutations, respectively. An additive loss in affinity (150-fold) for epinephrine was observed at an alpha(1a) containing both mutations. The loss of agonist affinity scenario could be reversed by a gain of affinity with mutation of the corresponding residues in the beta(2) to the phenylalanine residues in the alpha(1a). We propose that both Phe-163 and Phe-187 are involved in independent aromatic interactions with the catechol ring of agonists. The potency but not the efficacy of epinephrine in stimulating phosphatidylinositol hydrolysis was reduced 35-fold at the F163Q/F187A alpha(1a) relative to the wild type receptor. Therefore, Phe-163 and Phe-187 represent novel binding contacts in the agonist binding pocket of the alpha(1a)-AR, but are not involved directly in receptor activation.

Background: The goal of the present study was to directly compare the new radiopharmaceutical agent [(11)C]epinephrine (EPI) with [(11)C]hydroxyephedrine (HED) through the use of PET., Methods and Results: Seven healthy volunteers and 10 patients were investigated after heart transplantation. PET images of both tracers were of excellent quality in the volunteers. Values for radiolabeled metabolites (measured in percent of blood activity) at 5, 20, and 60 minutes after injection were approximately 35%, approximately 82%, and approximately 86% for EPI and approximately 13%, approximately 47%, and approximately 78% for HED, respectively. At 35 minutes, metabolite-corrected mean myocardial retention fraction of EPI (0. 235+/-0.022 min(-1)) was significantly greater (P<0.01) than that of HED (0.142+/-0.012 min(-1)). Corrected tracer retention fractions of both EPI and HED were significantly reduced in transplant recipients (0.055+/-0.004 min(-1), P<0.0001; and 0.050+/-0.006 min(-1), P<0. 0001, respectively) compared with volunteers. Normalization of retention fractions of patients with transplantation within 1 year to volunteers resulted in a value (ratio expressed in percent) of 20. 6+/-1.8% for EPI, significantly (P<0.03) smaller than 27.8+/-0.8% for HED. In patients with transplantation later than 1 year, the values were 26.0+/-2.9% for EPI compared with 44.2+/-5.6% for HED (P<0.014)., Conclusions: Both tracers showed high selectivity for neuronal uptake in the heart, with a significant reduction in tracer retention in transplant recipients compared with volunteers. Compared with HED, EPI showed greater retention in volunteers and a lower retention ratio in transplant recipients, suggesting that EPI may be the superior tracer with higher sensitivity to neuronal abnormalities. Because EPI reflects neuronal uptake, metabolism, and storage, it may be more suitable for the study of neuronal integrity than HED, which primarily traces uptake-1 capacity.