Search

The study was carried out in the Kivach Nature Reserve (62°17′ N, 33°58′ E) from September 2019 to October 2022 in the mature middle-taiga spruce forests on Albic Stagnosols developed from varved clays. The dynamics of litter decomposition was estimated by the litterbags method. The samples of ten different litter fractions were studied: needles, leaves, bark of the dominant tree species (Picea abies, Populus tremula, Betula pendula), and leaves of a subshrub (Vaccinium myrtillus). The sample mass loss and changes in chemical composition of the plant material were analyzed over 9, 14, 28, and 38 months of the experiment. The impact of different factors on the litter decay rate was studied, taking into account its volume, diversity, and quality. We estimated the rates of litter input and decay, as well as the forest floor turnover rate in relation to the parcella (unit of the biogeocenosis horizontal structure) heterogeneity. Forest floor volumes varied among zones of the tree phytogenic field from 26 to 108 t/ha. The forest floor turnover period was between 13–14 and 34 years in the spruce forest studied. [ABSTRACT FROM AUTHOR]

Plant biomass, in particular forestry wastes, is a promising renewable feedstock for deep chemical processing. Organosolv methods allow the use of underutilized lignin. The synthesis of modified polymers by azo coupling with the use of aspen (Populus tremula) ethanol lignin and its sulfated modification is studied. The success of the synthesis has been proven and the features of the structure and properties of the synthesized samples were studied by the physicochemical techniques, including Fourier transform infrared and nuclear magnetic resonance spectroscopy, gel permeation chromatography and thermogravimetric analysis. It was shown that the new azopolymers have the ability to photoisomerize, which opens up prospects for their high-tech applications. The modified lignins are proven to be bioactive antioxidants. [ABSTRACT FROM AUTHOR]

The article discusses the findings from the Kosilovo mire in north-western Russia, focusing on the pollen data and sediment description. The mire is located in a temperate continental climate zone with mixed coniferous-broadleaved forests. The sediment core collected from the mire revealed changes in vegetation over the past 10,000 years, indicating shifts in tree species composition and climate conditions. The study also highlights the impact of human activity on the mire ecosystem. [Extracted from the article]

Summary Wood of broad‐leaf tree species is a valued source of renewable biomass for biorefinery and a target for genetic improvement efforts to reduce its recalcitrance. Glucuronoxylan (GX) plays a key role in recalcitrance through its interactions with cellulose and lignin. To reduce recalcitrance, we modified wood GX by expressing GH10 and GH11 endoxylanases from Aspergillus nidulans in hybrid aspen (Populus tremula L. × tremuloides Michx.) and targeting the enzymes to cell wall. The xylanases reduced tree height, modified cambial activity by increasing phloem and reducing xylem production, and reduced secondary wall deposition. Xylan molecular weight was decreased, and the spacing between acetyl and MeGlcA side chains was reduced in transgenic lines. The transgenic trees produced hypolignified xylem having thin secondary walls and deformed vessels. Glucose yields of enzymatic saccharification without pretreatment almost doubled indicating decreased recalcitrance. The transcriptomics, hormonomics and metabolomics data provided evidence for activation of cytokinin and ethylene signalling pathways, decrease in ABA levels, transcriptional suppression of lignification and a subset of secondary wall biosynthetic program, including xylan glucuronidation and acetylation machinery. Several candidate genes for perception of impairment in xylan integrity were detected. These candidates could provide a new target for uncoupling negative growth effects from reduced recalcitrance. In conclusion, our study supports the hypothesis that xylan modification generates intrinsic signals and evokes novel pathways regulating tree growth and secondary wall biosynthesis. [ABSTRACT FROM AUTHOR]

Summary The mutualistic interaction between ectomycorrhizal fungi and trees is characterized by the coordinated exchange of soil nutrients with soluble sugars. Despite the importance of this process, the precise mechanism by which sugars are transported from host roots to colonizing hyphae remains unclear. This study aimed to identify the specific membrane transporters responsible for the unloading of sugars at the symbiotic interface, with a focus on the role of the root Sugars Will Eventually Be Exported Transporter (SWEET) uniporters. Our study used RNA sequencing and quantitative PCR to identify PtaSWEET gene expression in Populus tremula × alba–Laccaria bicolor ectomycorrhizal root tips. Our results suggest that symbiosis‐induced PtaSWEET1c is primarily responsible for transporting glucose and sucrose, as demonstrated by the yeast assays. Moreover, we used a promoter‐YFP reporter to confirm the localization of the PtaSWEET1c expression in cortical cells of ectomycorrhizal rootlets, supporting its major role in supplying glucose at the symbiotic interface. Furthermore, our observations confirmed the localization of PtaSWEET1c‐GFP in the plasma membrane. The inactivation of PtaSWEET1c reduced ectomycorrhizal root formation and 13C translocation to ectomycorrhizal roots. Our findings highlight the crucial role of PtaSWEET1c in facilitating glucose and sucrose transport at the symbiotic interface of Populus–L. bicolor symbiosis. [ABSTRACT FROM AUTHOR]

Wood chips and sawdust are used for cultivating Ganoderma lucidum mushrooms. In Northern Europe, side-streams of Pinus sylvestris are highly abundant, however as cultivation substrate they inhibit the growth of G. lucidum. To identify the changes in lignocellulosic composition after fungal degradation, the major lignocellulosic components in P. sylvestris and an optimal substrate for G. lucidum, Populus tremula were analyzed. Populus tremula was evenly degraded while the glucan fraction of P. sylvestris was not degraded and its lignin fraction was consumed almost completely. Despite not being an optimal substrate, P. sylvestris was successfully delignified by G. lucidum. [ABSTRACT FROM AUTHOR]

Background: Trees are associated with a broad range of microorganisms colonising the diverse tissues of their host. However, the early dynamics of the microbiota assembly microbiota from the root to shoot axis and how it is linked to root exudates and metabolite contents of tissues remain unclear. Here, we characterised how fungal and bacterial communities are altering root exudates as well as root and shoot metabolomes in parallel with their establishment in poplar cuttings (Populus tremula x tremuloides clone T89) over 30 days of growth. Sterile poplar cuttings were planted in natural or gamma irradiated soils. Bulk and rhizospheric soils, root and shoot tissues were collected from day 1 to day 30 to track the dynamic changes of fungal and bacterial communities in the different habitats by DNA metabarcoding. Root exudates and root and shoot metabolites were analysed in parallel by gas chromatography-mass spectrometry. Results: Our study reveals that microbial colonisation triggered rapid and substantial alterations in both the composition and quantity of root exudates, with over 70 metabolites exclusively identified in remarkably high abundances in the absence of microorganisms. Noteworthy among these were lipid-related metabolites and defence compounds. The microbial colonisation of both roots and shoots exhibited a similar dynamic response, initially involving saprophytic microorganisms and later transitioning to endophytes and symbionts. Key constituents of the shoot microbiota were also discernible at earlier time points in the rhizosphere and roots, indicating that the soil constituted a primary source for shoot microbiota. Furthermore, the microbial colonisation of belowground and aerial compartments induced a reconfiguration of plant metabolism. Specifically, microbial colonisation predominantly instigated alterations in primary metabolism in roots, while in shoots, it primarily influenced defence metabolism. Conclusions: This study highlighted the profound impact of microbial interactions on metabolic pathways of plants, shedding light on the intricate interplay between plants and their associated microbial communities. 2SWtA3_gUD-Xt4Z7N25436 Video Abstract [ABSTRACT FROM AUTHOR]

Aspen (Populus tremula L.) is a keystone species and a model system for forest tree genomics. We present an updated resource comprising a chromosome‐scale assembly, population genetics and genomics data. Using the resource, we explore the genetic basis of natural variation in leaf size and shape, traits with complex genetic architecture. We generated the genome assembly using long‐read sequencing, optical and high‐density genetic maps. We conducted whole‐genome resequencing of the Umeå Aspen (UmAsp) collection. Using the assembly and re‐sequencing data from the UmAsp, Swedish Aspen (SwAsp) and Scottish Aspen (ScotAsp) collections we performed genome‐wide association analyses (GWAS) using Single Nucleotide Polymorphisms (SNPs) for 26 leaf physiognomy phenotypes. We conducted Assay of Transposase Accessible Chromatin sequencing (ATAC‐Seq), identified genomic regions of accessible chromatin, and subset SNPs to these regions, improving the GWAS detection rate. We identified candidate long non‐coding RNAs in leaf samples, quantified their expression in an updated co‐expression network, and used this to explore the functions of candidate genes identified from the GWAS. A GWAS found SNP associations for seven traits. The associated SNPs were in or near genes annotated with developmental functions, which represent candidates for further study. Of particular interest was a ~177‐kbp region harbouring associations with several leaf phenotypes in ScotAsp. We have incorporated the assembly, population genetics, genomics, and GWAS data into the PlantGenIE.org web resource, including updating existing genomics data to the new genome version, to enable easy exploration and visualisation. We provide all raw and processed data to facilitate reuse in future studies. [ABSTRACT FROM AUTHOR]

Expansins are cell wall (CW) proteins that mediate the CW loosening and regulate salt tolerance in a positive or negative way. However, the role of Populus trichocarpa expansin A6 (PtEXPA6) in salt tolerance and the relevance to cell wall loosening is still unclear in poplars. PtEXPA6 gene was transferred into the hybrid species, Populus alba × P. tremula var. glandulosa (84K) and Populus tremula × P. alba INRA '717-1B4' (717-1B4). Under salt stress, the stem growth, gas exchange, chlorophyll fluorescence, activity and transcription of antioxidant enzymes, Na+ content, and Na+ flux of root xylem and petiole vascular bundle were investigated in wild-type and transgenic poplars. The correlation analysis and principal component analysis (PCA) were used to analyze the correlations among the characteristics and principal components. Our results show that the transcription of PtEXPA6 was downregulated upon a prolonged duration of salt stress (48 h) after a transient increase induced by NaCl (100 mM). The PtEXPA6-transgenic poplars of 84K and 717-1B4 showed a greater reduction (42–65%) in stem height and diameter growth after 15 days of NaCl treatment compared with wild-type (WT) poplars (11–41%). The Na+ accumulation in roots, stems, and leaves was 14–83% higher in the transgenic lines than in the WT. The Na+ buildup in the transgenic poplars affects photosynthesis; the activity of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT); and the transcription of PODa2, SOD [Cu-Zn], and CAT1. Transient flux kinetics showed that the Na+ efflux of root xylem and leaf petiole vascular bundle were 1.9–3.5-fold greater in the PtEXPA6-transgenic poplars than in the WT poplars. PtEXPA6 overexpression increased root contractility and extensibility by 33% and 32%, indicating that PtEXPA6 increased the CW loosening in the transgenic poplars of 84K and 717-1B4. Noteworthily, the PtEXPA6-promoted CW loosening was shown to facilitate Na+ efflux of root xylem and petiole vascular bundle in the transgenic poplars. We conclude that the overexpression of PtEXPA6 leads to CW loosening that facilitates the radial translocation of Na+ into the root xylem and the subsequent Na+ translocation from roots to leaves, resulting in an excessive Na+ accumulation and consequently, reducing salt tolerance in transgenic poplars. Therefore, the downregulation of PtEXPA6 in NaCl-treated Populus trichocarpa favors the maintenance of ionic and reactive oxygen species (ROS) homeostasis under long-term salt stress. [ABSTRACT FROM AUTHOR]

We compared the biological and economic effects of simultaneous artificial regeneration of mixtures of pioneers (birch – Betula pendula Roth or aspen – Populus tremula L.) and beech (Fagus sylvatica L.) with plots of monospecific beech. During the period of two years, the height of young beech trees, their mortality, and the regeneration cost were analysed in the following treatments: monospecific beech (9 000 pcs·ha−1), monospecific beech (5 000 pcs·ha−1), beech/birch (5 000/2 500 pcs·ha−1) and beech/aspen (5 000/2 500 pcs·ha−1). Four plots (differing in soil and altitude) were established in the region of the Czech Republic in autumn 2021. The positive biological effect of these pioneers was detected only in the treatments where the initial planting stock of the pioneers was substantially higher than in that of beech (on average 39 cm vs. 100 cm, respectively). However, the expenses of simultaneous regeneration were about 15% lower compared to plots with monospecific beech in densities like 9 000 pcs·ha−1, and around 35% higher than in the monospecific beech plots with a density of 5 000 pcs·ha−1. [ABSTRACT FROM AUTHOR]

This paper deals with the bonding characteristics of cross-laminated timber (CLT) panels made of Silver birch (Betula pendula Roth.), European aspen (Populus tremula L.), and Norway spruce (Picea abies (L.) H. Karst.) wood. Three-layered single-species CLT panels were manufactured using birch, aspen, and spruce lamellae bonded with a one-component polyurethane (PUR) adhesive. Spruce CLT panels were used as reference. The bonding characteristics of CLT were assessed based on bond shear strength, total and maximum delamination, and wood failure percentage. The reference spruce CLT met both criteria (Delamtot ≤ 10%, Delammax ≤ 40%) for passing the delamination test, where up to 80% of the test samples passed. The aspen and birch CLTs met the criterion for maximum delamination (26.5% and 33.2%, respectively), but exceeded the maximum allowed value for total delamination (12.7% and 13.2%, respectively). However, the minimum requirement of 70% wood failure percentage (WFP) was met for all CLT types, with aspen CLTs achieving 83.7% and birch CLTs 76.9%. The spruce CLTs achieved an average bond shear strength of 1.9 N/mm2, while both hardwood CLTs had significantly higher values, with the aspen CLT at 3.3 N/mm2 and the birch CLT at up to 3.9 N/mm2. Based on the results obtained, it can be concluded that cross-laminated timber (CLT) made from hardwoods like aspen and birch is suitable for environments with low humidity fluctuations. [ABSTRACT FROM AUTHOR]

We compared the biological and economic effects of simultaneous artificial regeneration of mixtures of pioneers (birch - Betula pendula Roth or aspen - Populus tremula L.) and beech (Fagus sylvatica L.) with plots of monospecific beech. During the period of two years, the height of young beech trees, their mortality, and the regeneration cost were analysed in the following treatments: monospecific beech (9 000 pcs.ha-1), monospecific beech (5 000 pcs.ha-1), beech/birch (5 000/2 500 pcs.ha-1) and beech/aspen (5 000/2 500 pcs.ha-1). Four plots (differing in soil and altitude) were established in the region of the Czech Republic in autumn 2021. The positive biological effect of these pioneers was detected only in the treatments where the initial planting stock of the pioneers was substantially higher than in that of beech (on average 39 cm vs. 100 cm, respectively). However, the expenses of simultaneous regeneration were about 15% lower compared to plots with monospecific beech in densities like 9 000 pcs.ha-1, and around 35% higher than in the monospecific beech plots with a density of 5 000 pcs.ha-1.

For trees originating from boreal and temperate regions, the dormancy‐to‐active transition, also known as bud dormancy release and bud break, are crucial processes that allow trees to reactive growth in the spring. The molecular mechanisms underlying these two processes remain poorly understood. Here, through integrative multiomics analysis of the transcriptome, DNA methylome, and proteome, we gained insights into the reprogrammed cellular processes associated with bud dormancy release and bud break. Our findings revealed multilayer regulatory landscapes governing bud dormancy release and bud break regulation, providing a valuable reference framework for future functional studies. Based on the multiomics analysis, we have determined a novel long intergenic noncoding RNA named Phenology Responsive Intergenic lncRNA 1 (PRIR1) plays a role in the activation of bud break. that the molecular mechanism of PRIR1 has been preliminary explored, and it may partially promote bud break by activating its neighbouring gene, EXORDIUM LIKE 5 (PtEXL5), which has also been genetically confirmed as an activator for bud break. This study has revealed a lncRNA‐mediated regulatory mechanism for the control of bud break in Populus, operating independently of known regulatory pathways. Summary statement: we report the multilayer regulatory landscapes of dormancy release and bud break regulation in hybrid poplar (Populus tremula x alba). We also identify a long intergenic noncoding RNA PRIR1 and characterise its role in dormancy release. Our study provides a useful reference framework for dormancy release and bud break regulation studies. [ABSTRACT FROM AUTHOR]

Summary: Wood formation, which occurs mainly through secondary xylem development, is important not only for supplying raw material for the 'ligno‐chemical' industry but also for driving the storage of carbon. However, the complex mechanisms underlying the promotion of xylem formation remain to be elucidated. Here, we found that overexpression of Auxin‐Regulated Gene involved in Organ Size (ARGOS) in hybrid poplar 84 K (Populus alba × Populus tremula var. glandulosa) enlarged organ size. In particular, PagARGOS promoted secondary growth of stems with increased xylem formation. To gain further insight into how PagARGOS regulates xylem development, we further carried out yeast two‐hybrid screening and identified that the auxin transporter WALLS ARE THIN1 (WAT1) interacts with PagARGOS. Overexpression of PagARGOS up‐regulated WAT1, activating a downstream auxin response promoting cambial cell division and xylem differentiation for wood formation. Moreover, overexpressing PagARGOS caused not only higher wood yield but also lower lignin content compared with wild‐type controls. PagARGOS is therefore a potential candidate gene for engineering fast‐growing and low‐lignin trees with improved biomass production. [ABSTRACT FROM AUTHOR]

The analysis of the main biogenic elements in the thalli of the epiphytic cephalolichen Lobaria pulmonaria of different ontogenetic stages was conducted. Thallus for research was collected in the spruce forests of the Paanajärvi National Park, which disturbance age varied from 190 to 270 years from the tree trunks (living and dead) of Populus tremula, Salix caprea, Sorbus aucuparia, Betula spp. Chemical analysis of thalli samples showed that N content increased (r = 0.43, p = 0.0039) and K content decreased (r = −0.42, p = 0.0046) in the ontogenetic stages from virginal 1 to senile. We revealed different elements were accumulated in lichen thalli, depending on the elements' content in the substrate: C, K, Mn – in the young thalli, Ca, Cu, Zn – in old ones, Fe – in both groups. The results indicated the necessity to consider the ontogenetic stages of lichen thalli when analysing the element content, because the ignoring of this parameter can lead to results that did not reflect reality. [ABSTRACT FROM AUTHOR]

Nonstructural carbohydrate reserves of stems and roots underpin overall tree fitness and productivity under short-rotation management practices such as coppicing for bioenergy. While sucrose and starch comprise the predominant stem carbohydrate reserves of Populus , utilization for fitness and agricultural productivity is understood primarily in terms of starch turnover. The tonoplast sucrose transport protein SUT4 modulates sucrose export from source leaves to distant sinks during photoautotrophic growth, but the possibility of its involvement in remobilizing carbohydrates from storage organs during heterotrophic growth has not been explored. Here, we used PtaSUT4- knockout mutants of Populus tremula × P. alba (INRA 717-1B4) in winter (cool) and summer (warm) glasshouse coppicing experiments to assess SUT4 involvement in reserve utilization. Conditions preceding and supporting summer sprouting were considered favorable for growth, while those preceding and supporting cool temperature sprouting were suboptimal akin to conditions associated with coppicing as generally practiced. Epicormic bud emergence was delayed in sut4 mutants following lower temperature 'winter' but not summer coppicing. Winter xylem hexose increases were observed in control but not in sut4 stumps after coppicing. The magnitude of starch and sucrose reserve depletion was similar in control and sut4 stumps during the winter and did not explain the sprouting and xylem hexose differences. However, winter maintenance costs appeared higher in sut4 based partly on Krebs cycle intermediate levels. In control plants, bark accrual of abundant defense metabolites, including salicinoids and condensed tannins, was higher in summer than in winter, but this increase of summer defense allocations was attenuated in sut4 mutants. Temperature-sensitive trade-offs between growth and other priorities may therefore depend on SUT4 in Populus. [ABSTRACT FROM AUTHOR]

The genus Quercus, including species like pedunculate oak (Quercus robur L.), can play a key role in maintaining climate-resistant mixed forests due to its broad ecological spectrum and drought tolerance. Unfortunately, in some parts of Europe, clearcutting has drastically reduced the oak population. An example of this event is our survey of heritage Oak—Lime forests in European Russia, which were transformed into pure aspen stands. The aim of our study was to provide forecasts and silvicultural recommendations for the passive restoration of these forests. We took a chronosequence approach to assess changes associated with natural succession over 60 years. In our survey of the development of oaks, limes and accompanying tree species (aspen, birches, maples, elms), we used 190 plots ranging across a wide spectrum of forest disturbance due to clearcutting. We demonstrate that aspen reproduce rapidly by root suckers after cutting and occupy more than 60% of the space. But the dominance of aspen decreases continuously from the age of 30, and then the lime trees begin to dominate. Oak does not show successful natural regeneration. Therefore, we recommend planting oak seedlings or sowing acorns, i.e., active restoration, in combination with the natural restoration of lime. [ABSTRACT FROM AUTHOR]

European aspen is a keystone species in boreal forests, which support numerous ecologically important and endangered species. As detection of those species by remote sensing is impossible, we instead investigated the detection of large aspen trees using airborne laser scanning and aerial image data. However, this is a challenge due to their low quantity and scattered occurrence. The performance was assessed with representative and unrepresentative (where aspens were over-represented) samples of the population. First, we detected individual trees and then the random forest (RF) classifier was used to identify large aspens. The RF classification was implemented with and without synthetic minority oversampling technique (SMOTE) to balance the training data due to the rarity of large aspens. At the tree-level, the best F1-score (0.44) was obtained when the unrepresentative plot data were used with SMOTE. However, the F1-score decreased to 0.21 when the representative data were used. The best plot-level (plots with at least one aspen tree) F1-score with the representative plot data was 0.41. We conclude that although data augmentation may improve the result, it is difficult to detect large aspen trees in genuine populations. [ABSTRACT FROM AUTHOR]

Increasing environmental awareness and the carbon-storing capability of wood have amplified its relevance as a building material. The demand for high-quality wood species necessitates exploring alternative, underutilized wood sources due to limited forest areas and premium wood volume. Consequently, the veneer-based industry is considering lower-value hardwood species like grey alder (Alnus Incania), black alder (Alnus glutinosa), and aspen (Populus tremula) as substitutes for high-quality birch (Betula pendula). Initially less appealing due to their lower density and mechanical properties, these species show promise through densification, which enhances their density, strength, and hardness. This study aims to enhance plywood screw withdrawal capacity and surface hardness by densifying low-density wood species and using them in plywood face-veneer layers, or in all layers. The relationship between the wood density, surface hardness, and screw withdrawal capacity of plywood made of low-value species like aspen and black alder is examined. Experimental work with a pilot-scale veneer and plywood production line demonstrates improved surface hardness (65% and 93% for aspen and black alder, respectively) and screw withdrawal capacity (16% and 35% for aspen and black alder, respectively) in densified face veneer plywood. This research highlights the potential of densified low-value wood species to meet construction requirements, expanding their practical applications. [ABSTRACT FROM AUTHOR]

Summary: Synthetic promoters may be designed using short cis‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar (Populus tremula × Populus alba), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA) and Syn3‐10b‐2 (3′: GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter. [ABSTRACT FROM AUTHOR]

Plants and insects coevolved as an evolutionarily successful and enduring association. The molecular arms race led to evolutionary novelties regarding unique mechanisms of defence and detoxification in plants and insects. While insects adopt mechanisms to conquer host defence, trees develop well-orchestrated and species-specific defence strategies against insect herbivory. However, current knowledge on the molecular underpinnings of fine-tuned tree defence responses against different herbivore insects is still restricted. In the current study, using a multi-omics approach, we unveiled the defence response of Populus tremula against aphids (Chaitophorus populialbae) and spongy moths (Lymantria dispar) herbivory. Comparative differential gene expression (DGE) analyses revealed that around 272 and 1203 transcripts were differentially regulated in P. tremula after moth and aphid herbivory compared to uninfested controls. Interestingly, 5716 transcripts were differentially regulated in P. tremula between aphids and moth infestation. Further investigation showed that defence-related stress hormones and their lipid precursors, transcription factors, and signalling molecules were over-expressed, whereas the growth-related counterparts were suppressed in P. tremula after aphid and moth herbivory. Metabolomics analysis documented that around 37% of all significantly abundant metabolites were associated with biochemical pathways related to tree growth and defence. However, the metabolic profiles of aphid and moth-fed trees were quite distinct, indicating species-specific response optimization. After identifying the suitable reference genes in P. tremula, the omics data were further validated using RT-qPCR. Nevertheless, our findings documented species-specific fine-tuning of the defence response of P. tremula, showing conservation on resource allocation for defence overgrowth under aphid and moth herbivory. Such findings can be exploited to enhance our current understanding of molecular orchestration of tree responses against herbivory and aid in developing insect pest resistance P. tremula varieties. [ABSTRACT FROM AUTHOR]

Specialist and generalist insect herbivores evolved different strategies to process host‐plant metabolites. We explored frass composition in Laothoe populi (L.) caterpillars (Lepidoptera: Sphingidae), a specialist moth species that is closely associated with plants of the Salicaceae (Mirb.) family. We fed the caterpillars with leaves from three willow species (Salix caprea L., S. purpurea L. and S. viminalis L.), one willow hybrid (S. x rubens Schrank) and one poplar species (Populus tremula L.). Using untargeted metabolomics, we compared the chemical composition and variation among leaf and frass samples. We quantified the chemical variation using either a simple index based on the presence and concentration of metabolites (i.e., Bray‐Curtis) or an index that additionally accounts for chemical structural‐compositional similarity (CSCS) among metabolites. Due to the high degree of dietary specialisation, we expected low host‐specific variation in frass composition among the caterpillars. Based on literature, we further hypothesised that ingested salicinoids will be largely modified in the caterpillar gut while flavonoids will be often passively excreted. Finally, we compared chemical variation among the samples when quantified with Bray‐Curtis or CSCS metrics. As expected, we found relatively low host‐specific variation in the chemical composition of caterpillar frass. Our results further suggest that flavonoids were largely passively excreted by the caterpillars, while salicinoids were metabolised in the gut. Finally, we found that chemical composition measures based on Bray‐Curtis overestimated the differences in chemical composition between frass and leaves, suggesting that for these type of samples CSCS measures are better suited to reflect metabolic changes more realistically. [ABSTRACT FROM AUTHOR]

In this study, assortment yields were studied for Scots pine, Norway spruce, birch spp. (silver and downy birch), European aspen, black alder, and grey alder stand elements. Theoretical assortment yields were calculated using the Ozolinš’ stem taper curve, incorporating tree diameters and heights. The modelled results were compared with actual yields provided by the State Forest Management Centre. During the study, differences in timber assortments and firewood yields were modelled compared to actual data. Changes in wood assortment yields, compared with undamaged and straight trees, depended on the tree species, stand site index, and stand element age. For Scots pine, depending on the stand site index and age, the reduction in log volume ranged from 7 to 28% of the total volume of all assortments. For Norway spruce, it was 5–30%, for birch spp. 30–70%, for aspen 50–90%, for black alder 20–50% and grey alder 5–30%. The increase in firewood volume according to the volume of all assortments was 3–4% for Scots pine, 5–14% for Norway spruce and birch spp., and 5–16% for European aspen. The difference between log and firewood changes represents the change in pulpwood. Over time, the need for new studies arises to adapt to evolving industry practices, including changes in log diameters and quality criteria. The appendix outlines steps that programmers can take to utilize the developed model.

Background: Afforestation of non-forestland is a new measure by the European Union to enhance climate mitigation and biodiversity. Hybrid aspen (Populus tremula L. × P. tremuloides Michx.) is among the suitable tree species for afforestation to produce woody biomass. However, the best performing genotypic material for intensive biomass production and its physiological adaptation capacity is still unclear. We compared 22 hybrid aspen genotypes growth and leaf physiological characteristics (stomatal conductance, net photosynthesis, intrinsic water-use efficiency) according to their geographical north- or southward transfer (European P. tremula parent from 51° to 60° N and North American P. tremuloides parent from 45° to 54° N) to hemiboreal Estonia (58° N) in a completely randomized design progeny trial. We tested whether the growth ranking of genotypes of different geographical origin has changed from young (3-year-old) to mid-rotation age (13-year-old). The gas exchange parameters were measured in excised shoots in 2021 summer, which was characterised with warmer (+ 4 °C) and drier (17% precipitation from normal) June and July than the long-term average. Results: We found that the northward transfer of hybrid aspen genotypes resulted in a significant gain in growth (two-fold greater diameter at breast height) in comparison with the southward transfer. The early selection of genotypes was generally in good accordance with the middle-aged genotype ranking, while some of the northward transferred genotypes showed improved growth at the middle-age period in comparison with their ranking during the early phase. The genotypes of southward transfer demonstrated higher stomatal conductance, which resulted in higher net photosynthesis, and lower intrinsic water-use efficiency (iWUE) compared with northward transfer genotypes. However, higher photosynthesis did not translate into higher growth rate. The higher physiological activity of southern transferred genotypes was likely related to a better water supply of smaller and consequently more shaded trees under drought. Leaf nitrogen concentration did not have any significant relation with tree growth. Conclusions: We conclude that the final selection of hybrid aspen genotypes for commercial use should be done in 10–15 years after planting. Physiological traits acquired during periods of droughty conditions may not fully capture the growth potential. Nonetheless, we advocate for a broader integration of physiological measurements alongside traditional traits (such as height and diameter) in genotype field testing to facilitate the selection of climate-adapted planting material for resilient forests. [ABSTRACT FROM AUTHOR]

Background: The cultivation of short-rotation tree species on non-forest land is increasing due to the growing demand for woody biomass for the future bioeconomy and to mitigate climate change impacts. However, forest plantations are often seen as a trade-off between climate benefits and low biodiversity. The diversity and composition of soil fungal biota in plantations of hybrid aspen, one of the most planted tree species for short-rotation forestry in Northern Europe, are poorly studied. Methods: The goal of this study was to obtain baseline knowledge about the soil fungal biota and the edaphic, floristic and management factors that drive fungal richness and communities in 18-year-old hybrid aspen plantations on former agricultural soils and compare the fungal biota with those of European aspen stands on native forest land in a 130-year chronosequence. Sites were categorized as hybrid aspen (17--18-year-old plantations) and native aspen stands of three age classes (8--29, 30--55, and 65-131-year-old stands). High-throughput sequencing was applied to soil samples to investigate fungal diversity and assemblages. Results: Native aspen forests showed a higher ectomycorrhizal (EcM) fungal OTU richness than plantations, regardless of forest age. Short-distance type EcM genera dominated in both plantations and forests. The richness of saprotrophic fungi was similar between native forest and plantation sites and was highest in the middle-aged class (30--55-year-old stands) in the native aspen stands. The fungal communities of native forests and plantations were significantly different. Community composition varied more, and the natural forest sites were more diverse than the relatively homogeneous plantations. Soil pH was the best explanatory variable to describe soil fungal communities in hybrid aspen stands. Soil fungal community composition did not show any clear patterns between the age classes of native aspen stands. Conclusion: We conclude that edaphic factors are more important in describing fungal communities in both native aspen forest sites and hybrid aspen plantation sites than forest thinning, age, or former land use for plantations. Although first-generation hybrid aspen plantations and native forests are similar in overall fungal diversity, their taxonomic and functional composition is strikingly different. Therefore, hybrid aspen plantations can be used to reduce felling pressure on native forests; however, our knowledge is still insufficient to conclude that plantations could replace native aspen forests from the soil biodiversity perspective. [ABSTRACT FROM AUTHOR]

Condensed tannins are common in vegetative tissues of woody plants, including in roots. In hybrid poplar (Populus tremula x alba; also known as P. x canescens) CT assays indicated they were most concentrated in younger white roots and at the root tip. Furthermore, CT-specific staining of embedded tissue sections demonstrated accumulation in root cap cells and adjacent epidermal cells, as well as a more sporadic presence in cortex cells. In older, brown roots as well as roots with secondary growth (cork zone), CT concentration was significantly lower. The insoluble fraction of CTs was greatest in the cork zone. To determine if CT accumulation correlates with nutrient uptake in poplar roots, a microelectrode ion flux measurement (MIFE™) system was used to measure flux along the root axis. Greatest NH4+ uptake was measured near the root tip, but NO3- and Ca2+ did not vary along the root length. In agreement with earlier work, providing poplars with ample nitrogen led to higher accumulation of CTs across root zones. To test the functional importance of CTs in roots directly, CTmodified transgenic plants could be important tools. [ABSTRACT FROM AUTHOR]

The creation of artificial snags, so-called high stumps, within forest management operations is a recently established tool to enrich standing deadwood as a habitat for saproxylic species. In this study, we analysed the impact of active high stump management on saproxylic beetle species. We selected 63 high stumps in six Bavarian forest districts (Germany), which were felled and subjected to close examination, focusing on beetle (Coleoptera) colonization. We identified 63 emerged coleopteran species belonging to 29 families; a further 10 taxa were identified only at the genus or family level, respectively. Moreover, 17% of the obtained taxa are listed in the German Red List of Coleoptera. Furthermore, 32% of the examined high stump trunks, predominantly broad-leaved tree species, harboured Red List beetle taxa. In particular, trembling aspen (Populus tremula) showed a disproportionately high number of Red List beetle species. The total species richness of beetles was independent of the height, diameter and decay stage of the snags. High stumps (snags) containing Red List beetle species tended to have higher amounts of deadwood in their surroundings, but the difference was not significant. According to the results of our study, actively creating high stumps proved to be a suitable method for creating habitats and serve as stepping-stones for endangered saproxylic species. Proactive high stump management during harvest can be a valuable component of deadwood management and biodiversity protection in forests. [ABSTRACT FROM AUTHOR]

The main biochemical traits were estimated in poplar leaves under biotic attack (aphids and spongy moth infestation). Changes in the abundance of bioactive compounds in genetically uniform individuals of European aspen (Populus tremula), such as proline, polyphenolic compounds, chlorophylls a and b, and volatile compounds, were determined between leaves damaged by sucking insects (aphid—Chaitophorus nassonowi) and chewing insects (spongy moth—Lymantria dispar) compared to uninfected leaves. Among the nine analyzed phenolic compounds, only catechin and procyanidin showed significant differences between the control leaves and leaves affected by spongy moths or aphids. GC-TOF-MS volatile metabolome analysis showed the clear separation of the control versus aphids-infested and moth-infested leaves. In total, the compounds that proved to have the highest explanatory power for aphid-infested leaves were 3-hexenal and 5-methyl-2-furanone, and for moth-infested leaves, trans-α-farnesene and 4-cyanocyclohexane. The aphid-infested leaves contained around half the amount of chlorophylls and twice the amount of proline compared to uninfected leaves, and these results evidenced that aphids influence plant physiology more than chewing insects. [ABSTRACT FROM AUTHOR]

The giant noctule is a rare European bat about which we have little ecological information, but it is a priority species for which we need to determine the best conservation measures. Acoustic monitoring followed by a radio-tracking survey resulted in the localisation of two maternity colonies in different forest areas in the Western Carpathians, one in protected mixed stands in a national park (Muránska planina Mts) and the other in disturbed secondary spruce forests (Balocké vrchy Mts). The 95% home-range polygon of the roosts was about 3.5 km2 for both colonies. Eurasian aspen (Populus tremula) accounted for 100% of roosts (n = 18 trees) in mixed stands. However, even in the spruce monocultures, bats roosted in cavities of this tree whenever possible, although 76% of roosts (n = 21 trees) were still in Norway spruce (Picea abies). Regardless of forest type, the bats preferred to roost at the edges of the stands and on steep slopes that offered a free exit from the roost into open space. Small-scale salvage logging during bark beetle outbreaks can also create suitable open roosting habitats. Our observations indicate that structured stands with a higher proportion of aspen will positively affect tree-dwelling bats in mountain forests. [ABSTRACT FROM AUTHOR]

The research relevance of the complex, multi-stage process of natural regeneration of forest communities, as well as interactions and transformations, is determined by the rapidly growing challenges posed by climate change, deforestation and biodiversity loss. The study aims to assess the state and to identify the ecological and coenotic specificity of natural seed regeneration of the leading forest-forming species of the Left-Bank Polissya of Ukraine. The study was carried out using a set of methods, primarily geobotanical, population and mathematical and statistical. The process of natural recovery was studied in communities that are typical for the region and belong to 42 syntaxa in the rank of associations and 24 syntaxa in the rank of association groups. The study revealed the specifics of such forest-forming species as Pinus sylvestris L., Quercus robur L., Acer platanoides L., Betula pendula Roth., Populus tremula L., and Tilia cordata Mill. The study established that the representation of the undergrowth of the main forest-forming species in the forest plant communities of the Left-Bank Polissya of Ukraine varies quite significantly. The study described the determinants of the species composition of restoration, including the peculiarities of seed (fruit) dispersion and the adaptive potential of plants. The study determined that the condition of the understory and its population density are determined by the level of soil moisture (the highest values of understory density in most species were recorded in forests with soils moistened at the level of fresh and wet hygro-tops), and this process may intensify against the background of climate change. The results of the study can be used to develop effective strategies for forest management, biodiversity conservation and sustainable forest management in the Left Bank Polissia region, which will help improve the environmental situation and create favourable conditions for the restoration of forest ecosystems [ABSTRACT FROM AUTHOR]

Prolonged periods without precipitation in spring prevent timely and rapid germination of pioneer tree seeds and could lead to an accelerated loss of germination capacity (reduced lifespan). To get knowledge about the shortening of seed lifespan and, thus, the shortening of natural regeneration windows under climate change, an experiment was conducted. Seeds of Alnus glutinosa, Betula pendula, Populus tremula, Salix caprea, Larix decidua, Pinus sylvestris, and Picea abies were exposed to temperatures of 15 °C, 25 °C (past or present climate), and 40 °C (future climate) with low or high humidity for a period of 3 months. Regardless of air humidity, the initial germination percentage of Alnus glutinosa, Betula pendula, Larix decidua, and Pinus sylvestris seeds decreased only slightly by 5–15% over the 91-day period when stored at 15 °C and 25 °C. For Populus tremula and Salix caprea, time windows of maximum 14–49 days and 42–91 days were identified, respectively. However, as climate change progresses with rising temperatures and increasing absolute air humidity values, the window of opportunity for successful germination will shorten for all studied tree species. In the moist air humidity variant of 40 °C, the germination percentage dropped to 0% after 42 days for Alnus glutinosa, Betula pendula, and Larix decidua. The natural regeneration window will be reduced by half from more than three months to about three weeks under climate change. The lifespan of Populus tremula and Salix caprea seeds will be shortened to 1 week. For Picea abies, the time window will shorten to a maximum of 28 days. [ABSTRACT FROM AUTHOR]

Relationships between soil water saturation (SWS) and the accumulation of arsenic (As), cadmium (Cd), and lead (Pb) in soils and aboveground biomass of Populus tremula and Salix caprea were explored. SWS was computed with the hydrological model ParFlow/CLM and compared to data from field observations. Plant and soil samples collected at the main pollution sources contained the highest concentrations of As, Cd, and Pb. S. caprea contained higher concentrations of As, Cd, and Pb than P. tremula. In both species, metal(loid) concentrations in leaves were significantly higher than in branches. At strongly mining-affected locations, metalloid concentration in the trees largely reflected the pollution levels in the soil. In remote study locations, the soil–plant transfer of Cd and Pb was affected by water saturation: element accumulation increased significantly with soil moisture. Results demonstrate that coupling field observations with hydrological modelling is a promising approach for estimating element accumulation. [ABSTRACT FROM AUTHOR]

Knowledge of Eurasian aspen's (Populus tremula L.) ecological and growth characteristics is of high importance to plant and wildlife community ecology, and noncommercial forest ecosystem services. This research assessed these characteristics, identified aspen's habitat optimum, and examined causality of its current scarce distribution in central Europe. We analyzed a robust database of field measurements (4,656,130 stands) for forest management planning over 78,000 km2 of the Czech territory. Our analysis we used GIS techniques, with basic and multivariate statistics such as general linear models, ordination, and classification. Results describe a species of broad ecological amplitude that has heretofore attracted little research attention. Spatial analysis showed significant differences between aspen and other forest non-forest cover types. Additionally, we found significant association between the proportion of aspen in a stand, the size of forest property, and the forest category. The results demonstrate historic reasons for aspen's widespread presence, though contemporary occurrence is limited. This study advances the concept of a quantitatively based aspen ecological optimum (niche), which we believe may be beneficial for numerous aspen associates in the context of anticipated warming. Irrespective of local ecology (i.e., the realized aspen niche), the study confirms that profit-driven policy in forestry is chiefly responsible for historic aspen denudation in central Europe. Even so, we demonstrate that ample habitat is present. Further solutions for improving aspen resilience are provided to support these keystone systems so vital to myriad dependent flora and fauna. [ABSTRACT FROM AUTHOR]

This study describes the seasonal changes in cell-to-cell transport in three selected angiosperm tree species, Acer pseudoplatanus (maple), Fraxinus excelsior (ash), and Populus tremula × tremuloides (poplar), with an emphasis on the living wood component, xylem parenchyma cells (XPCs). We performed anatomical studies, dye loading through the vascular system, measurements of non-structural carbohydrate content, immunocytochemistry, inhibitory assays and quantitative real-time PCR to analyse the transport mechanisms and seasonal variations in wood. The abundance of membrane dye in wood varied seasonally along with seasonally changing tree phenology, cambial activity, and non-structural carbohydrate content. Moreover, dyes internalized in vessel-associated cells and 'trapped' in the endomembrane system are transported farther between other XPCs via plasmodesmata. Finally, various transport mechanisms based on clathrin-mediated and clathrin-independent endocytosis, and membrane transporters, operate in wood, and their involvement is species and/or season dependent. Our study highlights the importance of XPCs in seasonally changing cell-to-cell transport in both ring-porous (ash) and diffuse-porous (maple, poplar) tree species, and demonstrates the involvement of both endocytosis and plasmodesmata in intercellular communication in angiosperm wood. [ABSTRACT FROM AUTHOR]

The transcription of glycine-rich RNA-binding protein 2 (PeGRP2) transiently increased in the roots and shoots of Populus euphratica (a salt-resistant poplar) upon initial salt exposure and tended to decrease after long-term NaCl stress (100 mM, 12 days). PeGRP2 overexpression in the hybrid Populus tremula × P. alba '717-1B4' (P. × canescens) increased its salt sensitivity, which was reflected in the plant's growth and photosynthesis. PeGRP2 contains a conserved RNA recognition motif domain at the N-terminus, and RNA affinity purification (RAP) sequencing was developed to enrich the target mRNAs that physically interacted with PeGRP2 in P. × canescens. RAP sequencing combined with RT-qPCR revealed that NaCl decreased the transcripts of PeGRP2-interacting mRNAs encoding photosynthetic proteins, antioxidative enzymes, ATPases, and Na+/H+ antiporters in this transgenic poplar. Specifically, PeGRP2 negatively affected the stability of the target mRNAs encoding the photosynthetic proteins PETC and RBCMT; antioxidant enzymes SOD[Mn], CDSP32, and CYB1-2; ATPases AHA11, ACA8, and ACA9; and the Na+/H+ antiporter NHA1. This resulted in (i) a greater reduction in Fv/Fm, YII, ETR, and Pn; (ii) less pronounced activation of antioxidative enzymes; and (iii) a reduced ability to maintain Na+ homeostasis in the transgenic poplars during long-term salt stress, leading to their lowered ability to tolerate salinity stress. [ABSTRACT FROM AUTHOR]

In Central Europe, the most important pioneer species are silver birch and European aspen. Changes in disturbance regime and an economic interest for this species have led to studies on this species and stands. Two naturally regenerated dense stands of birch (Betula pendula Roth - silver birch monoculture) and aspen (Populus tremula L. - European aspen monoculture)were selected from a Querceto - Fagetum mesotrophicum site to observe responses under the same conditions in Central Europe. Both stands regenerated after the allochthonous Norway spruce stands dieback at the site in 1999. Within a 10m × 25m transect established in both stands, the diameter at breast height (DBH) of all the trees was measured between 2015 and 2020. In addition, the height and position were recorded for all trees, and sample trees of both species were felled for biomass measurement. A higher volume production of aspen at the beginning (107.48/96.80 m³ ) and at the end of the experiment (178.32/143.08 m³ ) was accompanied with a lower above-ground wood biomass (WAB). The WAB of birch increased from 81.9 t·ha-1 to 103.3 t·ha-1 and aspen allocated 79.5 t·ha-1 to 94.8 t·ha-1 of biomass. The current annual increment of biomass for these stands was 4.3 t·ha-1 and 3.1 t·ha-1 in the age range of 17 to 22 years. The culmination of the volume increment has not yet occurred in any of the stands, but the mean annual increment of wood biomass has already been reached for both stands. Furthermore, the aspen stand tended to be more dynamic in terms of biomass allocation and mortality. Also, the lower self-tolerance of aspen confirmed our hypothesis: the two native pioneer species differ in their social behaviour within monospecific stands. [ABSTRACT FROM AUTHOR]

Trees and shrubs expanded in the last decades in European mountains due to land abandonment and the decrease in grazing pressure, and are expected to further spread also due to climate change. As a consequence of low forage quality and topographic constraints, the management of mountain environments dominated by woody vegetation with livestock is often challenging. Silvopastoral systems based on cattle hardy breeds able to forage on woody plants, such as Highland cattle, could be a suitable option for the management and restoration of such environments. In this study, we used direct observations to explore the foraging behavior of Highland cattle in four study areas across the western Alps. In particular, we assessed: (1) cattle diet composition, (2) the selection for more than 30 tree and shrub species, and (3) the relationships between species consumption and their abundance in the environment. Highland cattle fed on a mixture of both woody and herbaceous species, including between 15 and 46% of woody plants in the diet. Some trees (e.g., Celtis australis, Fraxinus spp., and Populus tremula) and shrubs (e.g., Frangula alnus, Rhamnus spp., and Rubus idaeus) were positively selected by cattle, thus they could be an important forage supplement to their diet. Moreover, the results highlighted that relative species consumption generally increased with increasing species abundance in the environment, suggesting that this cattle breed could be suitable to control shrub expansion in highly encroached areas. The outcomes of this study can support the development of targeted silvopastoral systems in the Alps. [ABSTRACT FROM AUTHOR]

Abscisic acid (ABA) is the most important phytohormone involved in the response to drought stress. Subclass II of SNF1-related kinase 2 (SnRK2) is an important signaling kinase related to ABA signal transduction. It regulates the phosphorylation of the target transcription factors controlling the transcription of a wide range of ABA-responsive genes in Arabidopsis thaliana. The transgenic poplars (Populus tremula × P. tremuloides, clone T89) ectopically overexpressing AtSnRK2.8, encoding a subclass II SnRK2 kinase of A. thaliana, have been engineered but almost no change in its transcriptome was observed. In this study, we evaluated osmotic stress tolerance and stomatal behavior of the transgenic poplars maintained in the netted greenhouse. The transgenic poplars, line S22, showed a significantly higher tolerance to 20% PEG treatment than non-transgenic controls. The stomatal conductance of the transgenic poplars tended to be lower than the non-transgenic control. Microscopic observations of leaf imprints revealed that the transgenic poplars had significantly higher stomatal closures under the stress treatment than the non-transgenic control. In addition, the stomatal index was lower in the transgenic poplars than in the non-transgenic controls regardless of the stress treatment. These results suggested that AtSnRK2.8 is involved in the regulation of stomatal behavior. Furthermore, the transgenic poplars overexpressing AtSnRK2.8 might have improved abiotic stress tolerance through this stomatal regulation. [ABSTRACT FROM AUTHOR]

Hybrid aspen Populus tremula L. × Populus tremuloides Michx. is fast-growing and a potential source of biomass for bioenergy production in Europe. However, knowledge about the phytopathological risks to hybrid aspen clones, particularly about frost crack damage as a possible infection gateway of fungal infections, is scarce. Five clones, represented by 205 trees from three trials in Latvia, were studied; two wood samples (at root collar and 1.3 m height) were obtained from each tree. Wood-inhabiting fungi were isolated and identified by the morphology and sequencing of the ITS region with fungal-specific primers, and fungal communities were compared using PERMANOVA. Fungal communities from trees with stem cracks were richer in species, especially pathogens, and species richness was higher in samples collected at 1.3 m height. Plant pathogens were isolated from 52% of all samples. Soft rot-causing Alternaria and Fusarium were dominant; Alternaria was more common at the height of 1.3 m, while Fusarium was more common at the root collar. White rot fungi were isolated from less than 2% of all samples, indicating a low degree of tree infection in the 15- to 16-year-old plantations. Clonal differences were not significant for fungal communities in general; nevertheless, for the occurrence of the genus Cladosporium, clonal differences were observed. In conclusion, the differences in fungal communities in relation to stem cracks implied only indirect clonal effects on phytopathological risks, emphasizing the resistance to stem cracking as a crucial trait for the sustainability of hybrid aspen plantations. [ABSTRACT FROM AUTHOR]

The aim of the study is to analyze the studies that have been done and need to be done on the general characteristics, distribution areas, and silviculture of European aspen stands naturally distributed in Türkiye. In the study, data obtained from the General Directorate of Forestry, Department of Forest Administration, and Planning for the year 2019 was used as the material. With these data, the spatial extent of European aspen stands in Türkiye was determined. Based on the obtained data, pure stands of European aspen, primarily in the regions where they have the most extensive spatial distribution, were examined on-site. Additionally, by evaluating the planning data in comparison with the current situation, European aspen stands were analyzed from a silvicultural perspective. The study determined that the total extent of European aspen forests in Türkiye is 278,013.7 hectares. Of the European aspen stands in Türkiye, 40.4% are in Elazig, 17.3% in Erzurum, 15.7% in Trabzon, 11.4% in Kayseri, and 7.5% in Giresun Regional Directorates of Forestry. Furthermore, 92.3% of European aspen stands are located within these five regional directorates. Moreover, in Türkiye, 34,916.6 hectares of pure aspen stands and 13,745.6 hectares of stands dominated by aspen exhibit degraded qualities. Depending on the developmental stages, the largest spatial distribution in both pure stands (8,886.3 ha) and stands dominated by aspen (6,071.3 ha) has been identified in the ab developmental stages. When examining the developmental stages of European aspen in Türkiye, it's generally observed that young European aspen stands prevail. The management objective of same-aged pure and mixed aspen forests should be redefined according to both the succession stages and habitat conditions. In stands with ecological functions, protection and moderate interventions must be made, and in stands with production functions, necessary tending interventions must be made on time and sustainability must be ensured. [ABSTRACT FROM AUTHOR]

The work proposed and tested a new approach to optimizing biotechnological processes, including the process of microclonal propagation. The proposed method is based on constructing a map of the similarity of the structures of molecules of secondary metabolites of plant extracts and molecules that regulate the processes of plant morphogenesis (primarily phytohormones) with subsequent prediction of the action of the extract. Lichen extract of Cetraria islandica (L.) Ach. (Parmeliaceae)was used as an example, for which the range of secondary metabolites contained is well known. The structural similarity of aliphatic secondary compounds of lichen (protolichesteric and lichesteric acids) with strigolactones (to a greater extent), as well as with gibberellins and brassinosteroids, was revealed. Based on the analysis of the results obtained, a prediction was made about the dose-dependent effect of the lichen extract of C. islandica on growth processes and rhizogenesis of microshootsin vitro. This hypothesis was experimentally tested in experiments with microclonal propagation of higher plants Lonicera caerulea L. and Populus tremula L. As a result of the work carried out, it was established that the addition of extract from C. islandicaat a concentration of 10–50 mg/L in the nutrient medium increased the multiplication rate of L. caerulea (by 31%) and P. tremula (by 8%). The rhizogenic activity of the lichen extract at the same concentrations (10–50 mg/L of medium), similar to the activity of strigolactones and gibberellins, has been experimentally proven. The extract has also been shown to have a positive effect of C. islandica (50 mg/L) on elongation of microshoots of both cultures and hemogenesisof P. tremula.The proposed approach allows for optimizing studies aimed at identifying the effect of various extracts on plant morphogenesis in vitroby preliminary constructing a map of the similarity of secondary metabolites contained in extracts (including according to literature data) and known growth regulators (including phytohormones) with subsequent prediction of the effect of the extract. [ABSTRACT FROM AUTHOR]

In this study, leaf nutrient contents, resorption efficiency (RE) and resorption proficiency (RP) values were examined in three sympatric woody species—P. tremula, Q. maranthera subsp. syspirensis and L. caucasica subsp. orientalis during two years in Northern Black Sea Region (Turkiye). According to the data obtained the highest N, P, K, Mg, Ca, Fe and Cu concentrations in green leaves were found in L. caucasica in both two years. However, the highest Zn concentrations in green leaves were found in P. tremula whereas the highest Mn concentrations were found in Q. macranthera. PRE was found to be higher than NRE and for all other elements in the study area. On the other hand, all studied species demonstrated similar RE values for macronutrients in general. Negative RE values were found with respect to Cu, Fe, Ca and MnRE in P. tremula, and with respect to CaRE in L. caucasica. However, all elements were resorbed in Q. macranthera. Our data indicate that species specificity plays an important role in resorption of microelements in the studied species. P. tremula and Q. macranthera were N and P-proficient only in first year whereas L. caucasica was not N and P-proficient in the present study. Nitrogen and phosphorus limitations varied due to plant species and leaf growth stages with respect to N/P ratios in the study area. [ABSTRACT FROM AUTHOR]

The content and mass concentration of eight chemical elements Al, Ca, Cu, K, Mg, Mn, P, and Zn were analysed in dead wood of eight tree species at five stages of decomposition. Wood samples were taken at the site of the massive windfall of 2006 in a multispecies broadleaved forest in the Kaluzhskie Zaseki nature reserve. Deadwood of seven deciduous tree species was studied: Norway maple (Acer platanoides), birch (Betula pendula), common ash (Fraxinus excelsior), common aspen (Populus tremula), English oak (Quercus robur), linden (Tilia cordata), Scotch elm (Ulmus glabra), as well as one coniferous tree species – Norway spruce (Picea abies). A series of one-way analyses of variance was carried out to assess the influence of the species and the stage of deadwood decomposition (including the zero stage for control samples) on the density, content of elements, and their mass concentration. Tree species most clearly differed in the content and mass concentration of Mn, Zn, Mg, Ca, and K: R2 varied from 50 to 23% for the content and from 53 to 19% for the mass concentration of elements of the indicated series. The leaders in the content of these elements were the following species: Mn—maple, birch, spruce, linden; Zn—birch and aspen; Mg—maple, elm; Ca— elm; K—linden, elm. The stages of wood decomposition turned out to be a significant factor of variation for the content of Mn, P, Cu, Zn and Ca: R2 varied from 22 to 16%. During the destruction of wood trunks, a significant increase in the content of these elements occurred. Maintenance of cycles of biophilic elements is more successfully implemented in the presence of deadwood of different types at different stages of decomposition. [ABSTRACT FROM AUTHOR]

In this study, assortment yields were studied for Scots pine, Norway spruce, birch spp. (silver and downy birch), European aspen, black alder, and grey alder stand elements. Theoretical assortment yields were calculated using the Ozolinš' stem taper curve, incorporating tree diameters and heights. The modelled results were compared with actual yields provided by the State Forest Management Centre. During the study, differences in timber assortments and firewood yields were modelled compared to actual data. Changes in wood assortment yields, compared with undamaged and straight trees, depended on the tree species, stand site index, and stand element age. For Scots pine, depending on the stand site index and age, the reduction in log volume ranged from 7 to 28% of the total volume of all assortments. For Norway spruce, it was 5–30%, for birch spp. 30–70%, for aspen 50–90%, for black alder 20–50% and grey alder 5–30%. The increase in firewood volume according to the volume of all assortments was 3–4% for Scots pine, 5–14% for Norway spruce and birch spp., and 5–16% for European aspen. The difference between log and firewood changes represents the change in pulpwood. Over time, the need for new studies arises to adapt to evolving industry practices, including changes in log diameters and quality criteria. The appendix outlines steps that programmers can take to utilize the developed model. [ABSTRACT FROM AUTHOR]

Poplar species such as aspen (Populus tremula L.) play a very important role in the forest formation process not only in Eastern European regions. Unfortunately, such aspen stands are often severely affected by fungal diseases, causing mainly core rot. In this study, the indirect effects of thinning on the phytosanitary condition of aspen by promotion of tree growth were investigated. Two thinning methods, manual (thinning from below) and mechanical thinning (schematic), were applied to young stands dominated by Eurasian aspen to study their effects on tree growth and health. All trees were measured at breast height and diameter frequency distribution was determined twice, i.e. three and 24 years after the beginning of the experiment. In addition, during the second measurement, tree-ring samples were obtained from individual trees to evaluate growth and wood decay damage. Neither manual nor mechanical thinning of aspen significantly increased its growth at the stand level, but positive effects on individual trees were observed in plots where mechanical thinning was applied. The thicker the trees, the less decayed they were. The analysis suggests that thinning in general should not be used to increase stand production, but the positive effects of mechanical thinning on individual aspens can be recommended to promote the growth of individual vigorous trees. [ABSTRACT FROM AUTHOR]

The use of CRISPR/Cas9 is currently the method of choice for precise genome engineering in plants, including in the biomass crop poplar. The most commonly used method for delivering CRISPR/Cas9 and its components in poplar is via Agrobacterium-mediated transformation, that besides the desired gene-editing event also results in stable T-DNA integration. Here we explore the delivery of the gene-editing reagents via DNA-coated microparticle bombardment into the model tree Populus tremula x P. alba to evaluate its potential for developing transgene-free, gene-edited trees, as well as its potential for integrating donor DNA at specific target sites. Using an optimized transformation method, which favors the regeneration of plants that transiently express the genes on the delivered donor DNA, we regenerated gene-edited plants that are free of the Cas9 and the antibiotic resistance-encoding transgenes. In addition, we report the frequent integration of donor DNA fragments at the Cas9-induced doublestrand break, opening opportunities toward targeted gene insertions. [ABSTRACT FROM AUTHOR]

SUMMARY: Populus species play a foundational role in diverse ecosystems and are important renewable feedstocks for bioenergy and bioproducts. Hybrid aspen Populus tremula × P. alba INRA 717‐1B4 is a widely used transformation model in tree functional genomics and biotechnology research. As an outcrossing interspecific hybrid, its genome is riddled with sequence polymorphisms which present a challenge for sequence‐sensitive analyses. Here we report a telomere‐to‐telomere genome for this hybrid aspen with two chromosome‐scale, haplotype‐resolved assemblies. We performed a comprehensive analysis of the repetitive landscape and identified both tandem repeat array‐based and array‐less centromeres. Unexpectedly, the most abundant satellite repeats in both haplotypes lie outside of the centromeres, consist of a 147 bp monomer PtaM147, frequently span >1 megabases, and form heterochromatic knobs. PtaM147 repeats are detected exclusively in aspens (section Populus) but PtaM147‐like sequences occur in LTR‐retrotransposons of closely related species, suggesting their origin from the retrotransposons. The genomic resource generated for this transformation model genotype has greatly improved the design and analysis of genome editing experiments that are highly sensitive to sequence polymorphisms. The work should motivate future hypothesis‐driven research to probe into the function of the abundant and aspen‐specific PtaM147 satellite DNA. Significance Statement: High‐quality, chromosome‐scale haplotype assemblies are needed for exploring not only gene‐rich but also gene‐poor genome regions of any outcrossing species for functional, population, ecological, and evolutionary research. We generated telomere‐to‐telomere, haplotype‐resolved assemblies for hybrid aspen 717 used in transgenic research. We exemplified the value of the genome with the discovery of an abundant class of tandem repeat arrays that differentiates aspen from closely related Populus species. [ABSTRACT FROM AUTHOR]

Detailed spatial data are an essential part of land use planning and decision-making. Their spatial resolution sets limitations to their use, as coarse datasets are not suitable for detecting small-scale phenomena. In this study, we explored the effects of spatial resolution on the ecological outcome of a conservation prioritization process in Zonation software. Our study area was in Evo, southern Finland, covering a mosaic of managed and conserved forests. We produced the feature layers describing the forest characteristics using high-resolution remote sensing datasets, object-based mapping methods, and forest site type data. We found that increasing the resolution above the 16 m baseline resolution resulted in substantial errors. The conservation errors were the highest for rare features related to European Aspen, whereas the common features related to dominant tree species could benefit from the growth of cell size. We conclude that adequate spatial resolution is a prerequisite for efficient conservation prioritization, and that the size and spatial distribution of the features affect the resolution requirements. [ABSTRACT FROM AUTHOR]

The UK proposes additional bioenergy plantations and afforestation as part of measures to meet net-zero greenhouse gas emissions, but species and locations are not yet decided. Different tree species emit varying amounts of isoprene and monoterpene volatile organic compounds that are precursors to ozone and secondary organic aerosol (SOA) formation, the latter of which is a component of PM 2.5. The forest canopy also acts as a depositional sink for air pollutants. All these processes are meteorologically influenced. We present here a first step in coupling information on tree species planting suitability and other planting constraints with data on UK-specific BVOC emission rates and tree canopy data to simulate, via the WRF-EMEP4UK high spatial-resolution atmospheric chemistry transport model, the impact on UK air quality of four potential scenarios. Our "maximum planting" scenarios are based on planting areas where yields are predicted to be ≥ 50 % of the maximum from the Ecological Site Classification decision support system (ESC DSS) for Eucalyptus gunnii, hybrid aspen (Populus tremula), Italian alder (Alnus cordata) and Sitka spruce (Picea sitchensis). The additional areas of forest in our scenarios are 2.0 to 2.7 times the current suggestions for new bioenergy and afforestation land cover in the UK. Our planting scenarios increase UK annual mean surface ozone concentrations by 1.0 ppb or 3 % relative to the baseline land cover for the highest BVOC-emitting species (e.g. E. gunnii). Increases in ozone reach 2 ppb in summer when BVOC emissions are greatest. In contrast, all the additional planting scenarios lead to reductions in UK annual mean PM 2.5 – ranging from - 0.2 µg m -3 (- 3 %) for Sitka spruce to - 0.5 µg m -3 (- 7 %) for aspen – revealing that PM 2.5 deposition to the additional forest canopy area more than offsets additional SOA formation. Relative decreases in annual mean PM 2.5 are greater than the relative increases in annual mean ozone. Reductions in PM 2.5 are least in summer, coinciding with the period of maximum monoterpene emissions. Although only a first step in evaluating the impact of increased forest plantation on UK air quality, our study demonstrates the need for locally relevant data on land cover suitability, emissions and meteorology in model simulations. [ABSTRACT FROM AUTHOR]