Search

Your search keyword '"E. Hébrard"' showing total 75 results
Start Over Author "E. Hébrard"
75 results on '"E. Hébrard"'

1. The impact of phase equilibrium cloud models on GCM simulations of GJ 1214b

Author

D A Christie, N J Mayne, R M Gillard, J Manners, E Hébrard, S Lines, and K Kohary

Subjects
Earth and Planetary Astrophysics (astro-ph.EP), Space and Planetary Science, FOS: Physical sciences, Astronomy and Astrophysics, Astrophysics - Earth and Planetary Astrophysics
Abstract

We investigate the impact of clouds on the atmosphere of GJ~1214b using the radiatively-coupled, phase-equilibrium cloud model {\sc EddySed} coupled to the {\sc Unified Model} general circulation model. We find that, consistent with previous investigations, high metallicity ($100\times$ solar) and clouds with large vertical extents (a sedimentation factor of $f_\mathrm{sed} = 0.1$) are required to best match the observations, although metallicities even higher than those investigated here may be required to improve agreement further. We additionally find that in our case which best matches the observations ($f_\mathrm{sed}=0.1$), the velocity structures change relative to the clear sky case with the formation of a superrotating jet being suppressed, although further investigation is required to understand the cause of the suppression. The increase in cloud extent with $f_\mathrm{sed}$ results in a cooler planet due to a higher albedo, causing the atmosphere to contract. This also results in a reduced day-night contrast seen in the phase curves, although the introduction of cloud still results in a reduction of the phase offset. We additionally investigate the impact the the {\sc Unified Model}'s pseudo-spherical irradiation scheme on the calculation of heating rates, finding that the introduction of nightside shortwave heating results in slower mid-latitude jets compared to the plane parallel irradiation scheme used in previous works. We also consider the impact of a gamma distribution, as opposed to a log-normal distribution, for the distribution of cloud particle radii and find the impact to be relatively minor., Accepted to MNRAS

Published
2022
Full Text
View/download PDF

2. Evolution of brightness and magnetic features of young solar-type stars – I. The young G star HIP 89829

Author

J. E. Hughes, Stephen C. Marsden, Matthew W. Mengel, D. Burton, Nikolai Piskunov, S. V. Jeffers, Ian A. Waite, N. Shaw, G. M. Perugini, and E. Hébrard

Subjects
Physics, Brightness, Stars, Space and Planetary Science, Starspot, Astrophysics::Solar and Stellar Astrophysics, Astronomy and Astrophysics, Astrophysics::Cosmology and Extragalactic Astrophysics, Astrophysics::Earth and Planetary Astrophysics, Astrophysics, Star (graph theory), Astrophysics::Galaxy Astrophysics
Abstract

The evolution in latitude of sunspots is a key feature of the cyclic solar dynamo. Here, we present the results of a spectroscopic and spectropolarimetric monitoring campaign on the young (∼20 Myr old) early G star HIP 89829, in order to investigate potential evolution in the distribution of the star’s spots and magnetic features. Our analysis of this G5V star spans eight epochs, from June 2010 to August 2015. The techniques of Doppler imaging and Zeeman–Doppler imaging were used to create brightness maps for each epoch and magnetic maps for two epochs. The brightness images show the star to have stable spot features with two main spot latitudes – a polar spot, often seen on young rapidly rotating stars such as this, and another highly unusual group of large spot features around the 20° and 30° latitudes. These lower spot latitudes appear to be rather stable over the 5 yr of observations. We included a solar-type differential rotation law into the imaging process and measured near-solid-body rotation for epochs where sufficient data exist for this analysis. The magnetic features show a dominant poloidal and a weaker toroidal magnetic field for both Stokes V epochs, which is unusual for a star with a rapid rotation period of 0.57 d. We conclude that HIP 89829 is an active young solar-type star with long-lived spots and near-solid-body rotation.

Published
2021
Full Text
View/download PDF

4. 3D modelling of the impact of stellar activity on tidally locked terrestrial exoplanets: atmospheric composition and habitability

Author

R J Ridgway, M Zamyatina, N J Mayne, J Manners, F H Lambert, M Braam, B Drummond, E Hébrard, P I Palmer, and K Kohary

Subjects
Earth and Planetary Astrophysics (astro-ph.EP), Physics - Atmospheric and Oceanic Physics, Space and Planetary Science, Atmospheric and Oceanic Physics (physics.ao-ph), FOS: Physical sciences, Astronomy and Astrophysics, Astrophysics - Earth and Planetary Astrophysics
Abstract

Stellar flares present challenges to the potential habitability of terrestrial planets orbiting M dwarf stars through inducing changes in the atmospheric composition and irradiating the planet's surface in large amounts of ultraviolet light. To examine their impact, we have coupled a general circulation model with a photochemical kinetics scheme to examine the response and changes of an Earth-like atmosphere to stellar flares and coronal mass ejections. We find that stellar flares increase the amount of ozone in the atmosphere by a factor of 20 compared to a quiescent star. We find that coronal mass ejections abiotically generate significant levels of potential bio-signatures such as N$_2$O. The changes in atmospheric composition cause a moderate decrease in the amount of ultraviolet light that reaches the planets surface, suggesting that while flares are potentially harmful to life, the changes in the atmosphere due to a stellar flare act to reduce the impact of the next stellar flare., Comment: 27 pages, 21 figures, accepted to MNRAS

Published
2022
Full Text
View/download PDF

5. The large-scale magnetic field of Proxima Centauri near activity maximum

Author

B. Zaire, Colin P. Folsom, X. Delfosse, E. Hébrard, Baptiste Klein, Jean-François Donati, Xavier Bonfils, Julien Morin, Institut de recherche en astrophysique et planétologie (IRAP), Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), Laboratoire Univers et Particules de Montpellier (LUPM), Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), Institut de Planétologie et d'Astrophysique de Grenoble (IPAG), Centre National d'Études Spatiales [Toulouse] (CNES)-Observatoire des Sciences de l'Univers de Grenoble (OSUG ), Institut national des sciences de l'Univers (INSU - CNRS)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Grenoble Alpes (UGA)-Institut national des sciences de l'Univers (INSU - CNRS)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Grenoble Alpes (UGA), Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire Midi-Pyrénées (OMP), Institut de Recherche pour le Développement (IRD)-Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Centre National de la Recherche Scientifique (CNRS), Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), and Institut national des sciences de l'Univers (INSU - CNRS)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Grenoble Alpes (UGA)-Météo-France -Institut national des sciences de l'Univers (INSU - CNRS)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Grenoble Alpes (UGA)-Météo-France

Subjects
[PHYS.ASTR.EP]Physics [physics]/Astrophysics [astro-ph]/Earth and Planetary Astrophysics [astro-ph.EP], FOS: Physical sciences, Flux, Astrophysics, 01 natural sciences, symbols.namesake, Proxima Centauri, 0103 physical sciences, Astrophysics::Solar and Stellar Astrophysics, Stars: low-mass, 010303 astronomy & astrophysics, Solar and Stellar Astrophysics (astro-ph.SR), ComputingMilieux_MISCELLANEOUS, Circular polarization, Earth and Planetary Astrophysics (astro-ph.EP), Physics, Stars: magnetic field, Zeeman effect, [SDU.ASTR]Sciences of the Universe [physics]/Astrophysics [astro-ph], [SDU.ASTR.SR]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Solar and Stellar Astrophysics [astro-ph.SR], 010308 nuclear & particles physics, Stellar rotation, Stars: rotation, Stars: individual, Techniques: polarimetric, Astronomy and Astrophysics, [PHYS.ASTR.SR]Physics [physics]/Astrophysics [astro-ph]/Solar and Stellar Astrophysics [astro-ph.SR], Magnetic flux, Magnetic field, Dipole, Astrophysics - Solar and Stellar Astrophysics, [SDU]Sciences of the Universe [physics], Space and Planetary Science, symbols, Astrophysics::Earth and Planetary Astrophysics, [PHYS.ASTR]Physics [physics]/Astrophysics [astro-ph], Astrophysics - Earth and Planetary Astrophysics, Dynamo
Abstract

We report the detection of a large-scale magnetic field at the surface of the slowly-rotating fully-convective M dwarf Proxima Centauri. Ten circular polarization spectra, collected from April to July 2017 with the HARPS-Pol spectropolarimeter, exhibit rotationally-modulated Zeeman signatures suggesting a stellar rotation period of $89.8 \pm 4.0$ d. Using Zeeman-Doppler Imaging, we invert the circular polarization spectra into a surface distribution of the large-scale magnetic field. We find that Proxima Cen hosts a large-scale magnetic field of typical strength 200 G, whose topology is mainly poloidal, and moderately axisymmetric, featuring, in particular, a dipole component of 135 G tilted at 51$^{\circ}$ to the rotation axis. The large-scale magnetic flux is roughly 3 times smaller than the flux measured from the Zeeman broadening of unpolarized lines, which suggests that the underlying dynamo is efficient at generating a magnetic field at the largest spatial scales. Our observations occur $\sim$1 yr after the maximum of the reported 7 yr-activity cycle of Proxima Cen, which opens the door for the first long-term study of how the large-scale field evolves with the magnetic cycle in a fully-convective very-low-mass star. Finally, we find that Proxima Cen's habitable zone planet, Proxima-b, is likely orbiting outside the Alfv\`en surface, where no direct magnetic star-planet interactions occur., Comment: 7 pages, 5 figures, accepted to MNRAS

Published
2021
Full Text
View/download PDF

6. Studying stellar spin-down with Zeeman–Doppler magnetograms

Author

Rim Fares, Colin P. Folsom, Pascal Petit, Victor See, Aline A. Vidotto, Moira Jardine, Stephen C. Marsden, Sandra V. Jeffers, Jean-François Donati, E. Hébrard, S. Boro Saikia, Ian A. Waite, Julien Morin, University of St Andrews [Scotland], Trinity College Dublin, Institut de recherche en astrophysique et planétologie (IRAP), Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), Institut für Astrophysik [Göttingen], Georg-August-University [Göttingen], INAF - Osservatorio Astrofisico di Catania (OACT), Istituto Nazionale di Astrofisica (INAF), York University, University of Southern Queensland (USQ), Laboratoire Univers et Particules de Montpellier (LUPM), Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université Montpellier 2 - Sciences et Techniques (UM2), Bcool, and Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)

Subjects
Field (physics), FOS: Physical sciences, Flux, Astrophysics, 01 natural sciences, symbols.namesake, stars: rotation, stars: activity, 0103 physical sciences, Astrophysics::Solar and Stellar Astrophysics, stars: evolution, 010303 astronomy & astrophysics, Solar and Stellar Astrophysics (astro-ph.SR), Astrophysics::Galaxy Astrophysics, Spin-½, Physics, Zeeman effect, [SDU.ASTR.SR]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Solar and Stellar Astrophysics [astro-ph.SR], 010308 nuclear & particles physics, Stellar rotation, Stellar magnetic field, stars: magnetic field, Astronomy, Astronomy and Astrophysics, techniques: polarimetric, Stars, Astrophysics - Solar and Stellar Astrophysics, Space and Planetary Science, Stellar mass loss, symbols, Astrophysics::Earth and Planetary Astrophysics
Abstract

Magnetic activity and rotation are known to be intimately linked for low-mass stars. Understanding rotation evolution over the stellar lifetime is therefore an important goal within stellar astrophysics. In recent years, there has been increased focus on how the complexity of the stellar magnetic field affects the rate of angular momentum-loss from a star. This is a topic that Zeeman-Doppler imaging (ZDI), a technique that is capable of reconstructing the large-scale magnetic field topology of a star, can uniquely address. Using a potential field source surface model, we estimate the open flux, mass loss-rate and angular momentum-loss rates for a sample of 66 stars that have been mapped with ZDI. We show that the open flux of a star is predominantly determined by the dipolar component of its magnetic field for our choice of source surface radius. We also show that, on the main sequence, the open flux, mass- and angular momentum-loss rates increase with decreasing Rossby number. The exception to this rule is stars less massive than $0.3M_{\odot}$. Previous work suggests that low mass M dwarfs may possess either strong, ordered and dipolar fields or weak and complex fields. This range of field strengths results in a large spread of angular momentum-loss rates for these stars and has important consequences for their spin down behaviour. Additionally, our models do not predict a transition in the mass-loss rates at the so called wind dividing line noted from Ly$\alpha$ studies., Comment: 14 pages, 8 figures, 2 tables, accepted to MNRAS

Published
2016
Full Text
View/download PDF

7. Spot distribution and fast surface evolution on Vega

Author

Pascal Petit, E. Hébrard, Torsten Böhm, Colin P. Folsom, François Lignières, Laboratoire Astrophysique de Toulouse-Tarbes (LATT), Centre National de la Recherche Scientifique (CNRS)-Observatoire Midi-Pyrénées (OMP), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), and Université Fédérale Toulouse Midi-Pyrénées

Subjects
Surface (mathematics), Brightness, FOS: Physical sciences, Astrophysics, 01 natural sciences, Latitude, 0103 physical sciences, Astrophysics::Solar and Stellar Astrophysics, Surface brightness, 010306 general physics, 010303 astronomy & astrophysics, Solar and Stellar Astrophysics (astro-ph.SR), ComputingMilieux_MISCELLANEOUS, Physics, Spectral signature, [SDU.ASTR]Sciences of the Universe [physics]/Astrophysics [astro-ph], Spots, [SDU.ASTR.SR]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Solar and Stellar Astrophysics [astro-ph.SR], Vega, Astronomy and Astrophysics, Magnetic field, Astrophysics - Solar and Stellar Astrophysics, [SDU]Sciences of the Universe [physics], 13. Climate action, Space and Planetary Science, Astrophysics::Earth and Planetary Astrophysics
Abstract

Spectral signatures of surface spots were recently discovered from high cadence observations of the A star Vega. We aim at constraining the surface distribution of these photospheric inhomogeneities, and investigating a possible short term evolution of the spot pattern. Using data collected over five consecutive nights, we employ the Doppler Imaging method to reconstruct three different maps of the stellar surface, from three consecutive subsets of the whole time-series. The surface maps display a complex distribution of dark and bright spots, covering most of the visible fraction of the stellar surface. A number of surface features are consistently recovered in all three maps, but other features seem to evolve over the time span of observations, suggesting that fast changes can affect the surface of Vega within a few days at most. The short-term evolution is observed as emergence or disappearance of individual spots, and may also show up as zonal flows, with low-latitude and high latitude belts rotating faster than intermediate latitudes. It is tempting to relate the surface brightness activity to the complex magnetic field topology previously reconstructed for Vega, although strictly simultaneous brightness and magnetic maps will be necessary to assess this potential link., MNRAS Letters, in press

Published
2017
Full Text
View/download PDF

8. The hot Jupiter of the magnetically-active weak-line T Tauri star V830 Tau

Author

Jean-François Donati, Gregory J. Herczeg, Scott G. Gregory, Raphaëlle D. Haywood, J. Bouvier, L. Yu, Lison Malo, Julien Morin, C. Moutou, Michihiro Takami, Aline A. Vidotto, Andrew Collier Cameron, K. N. Grankin, Gaitee A. J. Hussain, Silvia H. P. Alencar, Pascal Petit, E. Hébrard, Moira Jardine, Institut de recherche en astrophysique et planétologie (IRAP), Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire Midi-Pyrénées (OMP), Institut de Recherche pour le Développement (IRD)-Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Centre National de la Recherche Scientifique (CNRS), Canada-France-Hawaii Telescope Corporation (CFHT), National Research Council of Canada (NRC)-Centre National de la Recherche Scientifique (CNRS)-University of Hawai'i [Honolulu] (UH), SUPA School of Physics and Astronomy [University of St Andrews], University of St Andrews [Scotland]-Scottish Universities Physics Alliance (SUPA), Université de Montréal (UdeM), Crimean Astrophysical Observatory (CrAO), York University [Toronto], European Southern Observatory (ESO), Trinity College Dublin, Departamento de Fisica - ICEx, Universidade Federal de Minas Gerais, Institut de Planétologie et d'Astrophysique de Grenoble (IPAG), Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG ), Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes [2016-2019] (UGA [2016-2019])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes [2016-2019] (UGA [2016-2019]), Academia Sinica, Kavli Institute for Astronomy and Astrophysics [Beijing] (KIAA-PKU), Peking University [Beijing], Laboratoire Univers et Particules de Montpellier (LUPM), Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), MaTYSSE, Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS), SUPA School of Physics and Astronomy [St Andrews], University of St Andrews [Scotland], Centre National d'Études Spatiales [Toulouse] (CNES)-Université Grenoble Alpes (UGA)-Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes (UGA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Centre National de la Recherche Scientifique (CNRS), Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Centre National de la Recherche Scientifique (CNRS), Science & Technology Facilities Council, PPARC - Now STFC, University of St Andrews. School of Physics and Astronomy, University of St Andrews. St Andrews Centre for Exoplanet Science, Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), and Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)

Subjects
magnetic fields [Stars], NDAS, [SDU.ASTR.EP]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Earth and Planetary Astrophysics [astro-ph.EP], FOS: Physical sciences, individual: V830 Tau [Stars], Astrophysics, polarimetric [Techniques], 01 natural sciences, planetary systems [Stars], Planet, 0103 physical sciences, Hot Jupiter, QB Astronomy, Differential rotation, Astrophysics::Solar and Stellar Astrophysics, Surface brightness, 010303 astronomy & astrophysics, planetary systems, Solar and Stellar Astrophysics (astro-ph.SR), Astrophysics::Galaxy Astrophysics, formation [Stars], QC, QB, Earth and Planetary Astrophysics (astro-ph.EP), Physics, stars: formation, 010308 nuclear & particles physics, [SDU.ASTR.SR]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Solar and Stellar Astrophysics [astro-ph.SR], Giant planet, stars: magnetic field, Astronomy, Astronomy and Astrophysics, Planetary system, stars: individual: V830 Tau, stars: imaging, Radial velocity, T Tauri star, techniques: polarimetric, QC Physics, Astrophysics - Solar and Stellar Astrophysics, Space and Planetary Science, imaging [Stars], Astrophysics::Earth and Planetary Astrophysics, Astrophysics - Earth and Planetary Astrophysics
Abstract

We report results of an extended spectropolarimetric and photometric monitoring of the weak-line T Tauri star V830 Tau and its recently-detected newborn close-in giant planet. Our observations, carried out within the MaTYSSE programme, were spread over 91d, and involved the ESPaDOnS and Narval spectropolarimeters linked to the 3.6m Canada-France-Hawaii, the 2m Bernard Lyot and the 8-m Gemini-North Telescopes. Using Zeeman-Doppler Imaging, we characterize the surface brightness distributions, magnetic topologies and surface differential rotation of V830 Tau at the time of our observations, and demonstrate that both distributions evolve with time beyond what is expected from differential rotation. We also report that near the end of our observations, V830 Tau triggered one major flare and two weaker precursors, showing up as enhanced red-shifted emission in multiple spectral activity proxies. With 3 different filtering techniques, we model the radial velocity (RV) activity jitter (of semi-amplitude 1.2km/s) that V830 Tau generates, successfully retrieve the 68m/s RV planet signal hiding behind the jitter, further confirm the existence of V830 Tau b and better characterize its orbital parameters. We find that the method based on Gaussian-process regression performs best thanks to its higher ability at modelling not only the activity jitter, but also its temporal evolution over the course of our observations, and succeeds at reproducing our RV data down to a rms precision of 35m/s. Our result provides new observational constraints on scenarios of star / planet formation and demonstrates the scientific potential of large-scale searches for close-in giant planets around T Tauri stars., MNRAS, in press (17 pages, 15 figures, 5 tables)

Published
2017
Full Text
View/download PDF

9. Understanding stellar activity-induced radial velocity jitter using simultaneous K2 photometry and HARPS RV measurements

Author

Isabelle Boisse, Mahmoudreza Oshagh, Christopher A. Watson, João P. Faria, Jean-François Donati, Stéphane Udry, S. C. C. Barros, E. Hébrard, X. Bonfils, Heather M. Cegla, Nuno C. Santos, Francesco Pepe, Stefan Dreizler, Xavier Dumusque, Magali Deleuil, V. Adibekyan, Olivier Demangeon, Pedro Figueira, Laboratoire d'Astrophysique de Marseille (LAM), Aix Marseille Université (AMU)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), and Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Aix Marseille Université (AMU)-Centre National d'Études Spatiales [Toulouse] (CNES)

Subjects
astro-ph.SR, FOS: Physical sciences, Astrophysics, 01 natural sciences, Photometry (optics), 0103 physical sciences, 010303 astronomy & astrophysics, Spectrograph, Solar and Stellar Astrophysics (astro-ph.SR), Jitter, Earth and Planetary Astrophysics (astro-ph.EP), Physics, [SDU.ASTR]Sciences of the Universe [physics]/Astrophysics [astro-ph], 010308 nuclear & particles physics, Astronomy and Astrophysics, Observable, methods, data analysis, stars, activity, techniques, radial velocities, photometric, numerical, Exoplanet, Radial velocity, Stars, Amplitude, Astrophysics - Solar and Stellar Astrophysics, Space and Planetary Science, astro-ph.EP, Astrophysics - Earth and Planetary Astrophysics
Abstract

One of the best ways to improve our understanding of the stellar activity-induced signal in radial velocity (RV) measurements is through simultaneous high-precision photometric and RV observations. This is of prime importance to mitigate the RV signal induced by stellar activity and therefore unveil the presence of low-mass exoplanets. The K2 Campaign 7 and 8 field-of-views were located in the southern hemisphere, and provided a unique opportunity to gather unprecedented simultaneous high precision photometric observation with K2 and high-precision RV measurements with the HARPS spectrograph to study the relationship between photometric variability and RV jitter. We observed nine stars with different levels of activity; from quiet to very active. We probe the presence of any meaningful relation between measured RV jitter and the simultaneous photometric variation, and also other activity indicators (e.g. BIS, FWHM, $logR'_{HK}$, and F8), by evaluating the strength and significance of the correlation between RVs and each indicator. We found that for the case of very active stars, strong and significant correlations exist between almost all the observables and measured RVs; however, for lower activity levels the correlations become random. Except for the F8 which its strong correlation with RV jitter persists over a wide range of stellar activity level, and thus our result suggests that F8 might be a powerful proxy for activity induced RV jitter. Moreover, we examine the capability of two state-of-the-art modeling techniques, namely the FF' method and SOAP2.0, in accurately predicting the RV jitter amplitude using the simultaneous photometric observation. We found that for the very active stars both techniques can reasonably well predict the amplitude of the RV jitter, however, at lower activity levels the FF' method underpredicts the RV jitter amplitude., 13 pages, 7 figures, 2 tables, accepted for publication in A&A

Published
2017
Full Text
View/download PDF

10. Predictions of planet detections with near infrared radial velocities in the up-coming SPIRou Legacy Survey-Planet Search

Author

Étienne Artigau, C. Moutou, E. Hébrard, René Doyon, Jean-François Donati, Andrew Cumming, Xavier Dumusque, Kristen Menou, Lison Malo, Ryan Cloutier, X. Delfosse, Gemini Observatory [Southern Operations Center], Association of Universities for Research in Astronomy (AURA), Institut de Planétologie et d'Astrophysique de Grenoble (IPAG), Centre National d'Études Spatiales [Toulouse] (CNES)-Université Grenoble Alpes (UGA)-Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes (UGA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Centre National de la Recherche Scientifique (CNRS), Canada-France-Hawaii Telescope Corporation (CFHT), National Research Council of Canada (NRC)-Centre National de la Recherche Scientifique (CNRS)-University of Hawai'i [Honolulu] (UH), Laboratoire d'Astrophysique de Marseille (LAM), Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Aix Marseille Université (AMU)-Centre National d'Études Spatiales [Toulouse] (CNES), Departement de physique and Observatoire du Mont Megantic, Université de Montréal [Montréal], Institut de recherche en astrophysique et planétologie (IRAP), Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS), Laboratoire d'Optique Quantique, Centre National de la Recherche Scientifique (CNRS), Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG ), Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes [2016-2019] (UGA [2016-2019])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes [2016-2019] (UGA [2016-2019]), Aix Marseille Université (AMU)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), Université de Montréal (UdeM), Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire Midi-Pyrénées (OMP), Institut de Recherche pour le Développement (IRD)-Université Toulouse III - Paul Sabatier (UT3), and Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Centre National de la Recherche Scientifique (CNRS)

Subjects
Physics, Earth and Planetary Astrophysics (astro-ph.EP), [SDU.ASTR]Sciences of the Universe [physics]/Astrophysics [astro-ph], Near-infrared spectroscopy, Astronomy, FOS: Physical sciences, Astronomy and Astrophysics, 01 natural sciences, 010309 optics, Methods statistical, 13. Climate action, Space and Planetary Science, Planet, [SDU]Sciences of the Universe [physics], 0103 physical sciences, 010303 astronomy & astrophysics, ComputingMilieux_MISCELLANEOUS, Astrophysics - Earth and Planetary Astrophysics
Abstract

The SPIRou near infrared spectro-polarimeter is destined to begin science operations at the Canada-France-Hawaii Telescope in mid-2018. One of the instrument's primary science goals is to discover the closest exoplanets to the Solar System by conducting a 3-5 year long radial velocity survey of nearby M dwarfs at an expected precision of $\sim 1$ m s$^{-1}$; the SPIRou Legacy Survey-Planet Search (SLS-PS). In this study we conduct a detailed Monte-Carlo simulation of the SLS-PS using our current understanding of the occurrence rate of M dwarf planetary systems and physical models of stellar activity. From simultaneous modelling of planetary signals and activity, we predict the population of planets detected in the SLS-PS. With our fiducial survey strategy and expected instrument performance over a nominal survey length of $\sim 3$ years, we expect SPIRou to detect $85.3^{+29.3}_{-12.4}$ planets including $20.0^{+16.8}_{-7.2}$ habitable zone planets and $8.1^{+7.6}_{-3.2}$ Earth-like planets from a sample of 100 M1-M8.5 dwarfs out to 11 pc. By studying mid-to-late M dwarfs previously inaccessible to existing optical velocimeters, SPIRou will put meaningful constraints on the occurrence rate of planets around those stars including the value of $\eta_{\oplus}$ at an expected level of precision of $\lesssim 45$%. We also predict a subset of $46.7^{+16.0}_{-6.0}$ planets may be accessible with dedicated high-contrast imagers on the next generation of ELTs including $4.9^{+4.7}_{-2.0}$ potentially imagable Earth-like planets. Lastly, we compare the results of our fiducial survey strategy to other foreseeable survey versions to quantify which strategy is optimized to reach the SLS-PS science goals. The results of our simulations are made available to the community on github., Comment: Accepted for publication in AJ. 19 figures including 15 interactive figures when viewed in Adobe Acrobat. Simulation results provided at https://github.com/r-cloutier/SLSPS_Simulations

Published
2017
Full Text
View/download PDF

11. Modeling the RV jitter of early M dwarfs using tomographic imaging

Author

Julien Morin, Isabelle Boisse, E. Hébrard, C. Moutou, Xavier Delfosse, J.-F. Donati, Department of Physics and Astronomy [Toronto], York University [Toronto], Institut de recherche en astrophysique et planétologie (IRAP), Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire Midi-Pyrénées (OMP), Institut de Recherche pour le Développement (IRD)-Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Centre National de la Recherche Scientifique (CNRS), Institut de Planétologie et d'Astrophysique de Grenoble (IPAG), Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG ), Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes [2016-2019] (UGA [2016-2019])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes [2016-2019] (UGA [2016-2019]), Laboratoire Univers et Particules de Montpellier (LUPM), Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), Laboratoire d'Astrophysique de Marseille (LAM), Aix Marseille Université (AMU)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), Canada-France-Hawaii Telescope Corporation (CFHT), National Research Council of Canada (NRC)-Centre National de la Recherche Scientifique (CNRS)-University of Hawai'i [Honolulu] (UH), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS), Centre National d'Études Spatiales [Toulouse] (CNES)-Université Grenoble Alpes (UGA)-Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes (UGA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Centre National de la Recherche Scientifique (CNRS), Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Centre National de la Recherche Scientifique (CNRS), Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Aix Marseille Université (AMU)-Centre National d'Études Spatiales [Toulouse] (CNES), Canada-France-Hawaii Telescope Corporation, Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), and Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université Montpellier 2 - Sciences et Techniques (UM2)

Subjects
FOS: Physical sciences, Astrophysics, magnetic fields, 01 natural sciences, Spectral line, 0103 physical sciences, techniques: radial velocities, 010303 astronomy & astrophysics, Solar and Stellar Astrophysics (astro-ph.SR), Jitter, Physics, Tomographic reconstruction, 010308 nuclear & particles physics, [SDU.ASTR.SR]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Solar and Stellar Astrophysics [astro-ph.SR], Starspot, Astronomy, Astronomy and Astrophysics, line: profiles, Zeeman–Doppler imaging, Radial velocity, Stars, techniques: polarimetric, starspots, Amplitude, Astrophysics - Solar and Stellar Astrophysics, Space and Planetary Science
Abstract

In this paper we show how tomographic imaging (Zeeman Doppler Imaging, ZDI) can be used to characterize stellar activity and magnetic field topologies, ultimately allowing to filter out the radial velocity (RV) activity jitter of M-dwarf moderate rotators. This work is based on spectropolarimetric observations of a sample of five weakly-active early M-dwarfs (GJ 205, GJ 358, GJ 410, GJ479, GJ 846) with HARPS-Pol and NARVAL. These stars have v sin i and RV jitters in the range 1-2 km/s and 2.7-10.0 m/s rms respectively. Using a modified version of ZDI applied to sets of phase-resolved Least-Squares- Decon- volved (LSD) profiles of unpolarized spectral lines, we are able to characterize the distribution of active regions at the stellar surfaces. We find that darks spots cover less than 2% of the total surface of the stars of our sample. Our technique is e cient at modeling the rotationally mod- ulated component of the activity jitter, and succeeds at decreasing the amplitude of this com- ponent by typical factors of 2-3 and up to 6 in optimal cases. From the rotationally modulated time-series of circularly polarized spectra and with ZDI, we also reconstruct the large-scale magnetic field topology. These fields suggest that bi-stability of dynamo processes observed in active M dwarfs may also be at work for moderately active M dwarfs. Comparing spot distributions with field topologies suggest that dark spots causing activity jitter concentrate at the magnetic pole and/or equator, to be confirmed with future data on a larger sample., Comment: 34 pages, accepted for publication in MNRAS

Published
2016
Full Text
View/download PDF

12. A hot Jupiter orbiting a 2-million-year-old solar-mass T Tauri star

Author

Francois Menard, Michihiro Takami, E. Hébrard, Jerome Bouvier, G. A. J. Hussain, René Doyon, Pascal Petit, Lison Malo, C. Moutou, A. Collier Cameron, J.-F. Donati, Linwen Yu, Clément Baruteau, Silvia H. P. Alencar, Institut de recherche en astrophysique et planétologie (IRAP), Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), Laboratoire d'Astrophysique de Marseille (LAM), Aix Marseille Université (AMU)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), CFHT, European Southern Observatory (ESO), Departamento de Fisica - ICEx, Universidade Federal de Minas Gerais, Institut de Planétologie et d'Astrophysique de Grenoble (IPAG), Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG ), Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes [2016-2019] (UGA [2016-2019])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes [2016-2019] (UGA [2016-2019]), Academia Sinica, Université de Montréal (UdeM), University of St Andrews [Scotland], Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS), Centre National d'Études Spatiales [Toulouse] (CNES)-Université Grenoble Alpes (UGA)-Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes (UGA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Centre National de la Recherche Scientifique (CNRS), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire Midi-Pyrénées (OMP), Institut de Recherche pour le Développement (IRD)-Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Centre National de la Recherche Scientifique (CNRS), Canada-France-Hawaii Telescope Corporation (CFHT), National Research Council of Canada (NRC)-Centre National de la Recherche Scientifique (CNRS)-University of Hawai'i [Honolulu] (UH), Academia Sinica Institute of Astronomy and Astrophysics (ASIAA), Science & Technology Facilities Council, and University of St Andrews. School of Physics and Astronomy

Subjects
010504 meteorology & atmospheric sciences, [PHYS.ASTR.EP]Physics [physics]/Astrophysics [astro-ph]/Earth and Planetary Astrophysics [astro-ph.EP], NDAS, [SDU.ASTR.EP]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Earth and Planetary Astrophysics [astro-ph.EP], Astrophysics, 01 natural sciences, Jupiter, Eccentric Jupiter, Planet, 0103 physical sciences, Hot Jupiter, QB Astronomy, Astrophysics::Solar and Stellar Astrophysics, 010303 astronomy & astrophysics, QC, Astrophysics::Galaxy Astrophysics, ComputingMilieux_MISCELLANEOUS, QB, 0105 earth and related environmental sciences, Planetary migration, Physics, Multidisciplinary, Giant planet, Astronomy, [PHYS.ASTR.SR]Physics [physics]/Astrophysics [astro-ph]/Solar and Stellar Astrophysics [astro-ph.SR], Exoplanet, QC Physics, Astrophysics::Earth and Planetary Astrophysics, BDC, [PHYS.ASTR]Physics [physics]/Astrophysics [astro-ph], Jupiter mass
Abstract

The radial velocities of a young star are measured, revealing the presence of a planet of mass about three-quarters that of Jupiter, orbiting its host star very closely, and thus demonstrating that ‘hot Jupiters’ can migrate inwards in less than two million years. Jean-Francois Donati et al. present evidence for a close-in giant planet (hot Jupiter) orbiting the 2-million-year-old Sun-like star V830 Tau. It is thought that hot Jupiters form in the outer part of the primordial disk from which both the central star and surrounding planets are born, and then migrate inwards. This new finding supports that theory by demonstrating the formation and rapid inward migration of a hot Jupiter around a young star. Hot Jupiters are giant Jupiter-like exoplanets that orbit their host stars 100 times more closely than Jupiter orbits the Sun. These planets presumably form in the outer part of the primordial disk from which both the central star and surrounding planets are born, then migrate inwards and yet avoid falling into their host star1. It is, however, unclear whether this occurs early in the lives of hot Jupiters, when they are still embedded within protoplanetary disks2, or later, once multiple planets are formed and interact3. Although numerous hot Jupiters have been detected around mature Sun-like stars, their existence has not yet been firmly demonstrated for young stars4,5,6, whose magnetic activity is so intense that it overshadows the radial velocity signal that close-in giant planets can induce. Here we report that the radial velocities of the young star V830 Tau exhibit a sine wave of period 4.93 days and semi-amplitude 75 metres per second, detected with a false-alarm probability of less than 0.03 per cent, after filtering out the magnetic activity plaguing the spectra. We find that this signal is unrelated to the 2.741-day rotation period of V830 Tau and we attribute it to the presence of a planet of mass 0.77 times that of Jupiter, orbiting at a distance of 0.057 astronomical units from the host star. Our result demonstrates that hot Jupiters can migrate inwards in less than two million years, probably as a result of planet–disk interactions2.

Published
2016
Full Text
View/download PDF

13. Could a change in magnetic field geometry cause the break in the wind-activity relation?

Author

Pascal Petit, Isabelle Boisse, Moira Jardine, Stephen C. Marsden, Jean-François Donati, S. Boro Saikia, E. Hébrard, Julien Morin, Aline A. Vidotto, Victor See, Sandra V. Jeffers, Science & Technology Facilities Council, University of St Andrews. School of Physics and Astronomy, Observatoire Astronomique de l'Université de Genève (ObsGE), Université de Genève = University of Geneva (UNIGE), Trinity College Dublin, Institut de recherche en astrophysique et planétologie (IRAP), Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire Midi-Pyrénées (OMP), Institut de Recherche pour le Développement (IRD)-Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Centre National de la Recherche Scientifique (CNRS), SUPA School of Physics and Astronomy [University of St Andrews], University of St Andrews [Scotland]-Scottish Universities Physics Alliance (SUPA), Laboratoire d'Astrophysique de Marseille (LAM), Aix Marseille Université (AMU)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), Institut für Astrophysik [Göttingen], Georg-August-University = Georg-August-Universität Göttingen, Computational Engineering and Science Research Centre, University of Southern Queensland (USQ), Laboratoire Univers et Particules de Montpellier (LUPM), Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), Université de Genève (UNIGE), Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Aix Marseille Université (AMU)-Centre National d'Études Spatiales [Toulouse] (CNES), Georg-August-University [Göttingen], Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université Montpellier 2 - Sciences et Techniques (UM2), and Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)

Subjects
Surface (mathematics), Astrophysics::High Energy Astrophysical Phenomena, Flux, FOS: Physical sciences, Outflows, Astrophysics, coronae [Stars], 01 natural sciences, low-mass [Stars], 0103 physical sciences, Astrophysics::Solar and Stellar Astrophysics, QB Astronomy, winds [Stars], 010303 astronomy & astrophysics, Solar and Stellar Astrophysics (astro-ph.SR), QC, QB, Physics, Toroid, Magnetic energy, 010308 nuclear & particles physics, Astronomy and Astrophysics, Function (mathematics), 3rd-DAS, Magnetic field, Stars, QC Physics, Astrophysics - Solar and Stellar Astrophysics, Space and Planetary Science, Magnetic fields, Jump, [PHYS.ASTR]Physics [physics]/Astrophysics [astro-ph], activity [Stars]
Abstract

Wood et al suggested that mass-loss rate is a function of X-ray flux ($\dot{M} \propto F_x^{1.34}$) for dwarf stars with $F_x \lesssim F_{x,6} \equiv 10^6$ erg cm$^{-2}$ s$^{-1}$. However, more active stars do not obey this relation. These authors suggested that the break at $F_{x,6}$ could be caused by significant changes in magnetic field topology that would inhibit stellar wind generation. Here, we investigate this hypothesis by analysing the stars in Wood et al's sample that had their surface magnetic fields reconstructed through Zeeman-Doppler Imaging (ZDI). Although the solar-like outliers in the $\dot{M}$ -- $F_x$ relation have higher fractional toroidal magnetic energy, we do not find evidence of a sharp transition in magnetic topology at $F_{x,6}$. To confirm this, further wind measurements and ZDI observations at both sides of the break are required. As active stars can jump between states with highly toroidal to highly poloidal fields, we expect significant scatter in magnetic field topology to exist for stars with $F_x \gtrsim F_{x,6}$. This strengthens the importance of multi-epoch ZDI observations. Finally, we show that there is a correlation between $F_x$ and magnetic energy, which implies that $\dot{M}$ -- magnetic energy relation has the same qualitative behaviour as the original $\dot{M}$ -- $F_x$ relation. No break is seen in any of the $F_x$ -- magnetic energy, Comment: 7 pages, 3 figures, 4 tables, accepted to MNRAS Letters

Published
2016
Full Text
View/download PDF

14. The EChO science case

Author

Giovanna Tinetti, Pierre Drossart, Paul Eccleston, Paul Hartogh, Kate Isaak, Martin Linder, Christophe Lovis, Giusi Micela, Marc Ollivier, Ludovic Puig, Ignasi Ribas, Ignas Snellen, Bruce Swinyard, France Allard, Joanna Barstow, James Cho, Athena Coustenis, Charles Cockell, Alexandre Correia, Leen Decin, Remco de Kok, Pieter Deroo, Therese Encrenaz, Francois Forget, Alistair Glasse, Caitlin Griffith, Tristan Guillot, Tommi Koskinen, Helmut Lammer, Jeremy Leconte, Pierre Maxted, Ingo Mueller-Wodarg, Richard Nelson, Chris North, Enric Pallé, Isabella Pagano, Guseppe Piccioni, David Pinfield, Franck Selsis, Alessandro Sozzetti, Lars Stixrude, Jonathan Tennyson, Diego Turrini, Mariarosa Zapatero-Osorio, Jean-Philippe Beaulieu, Denis Grodent, Manuel Guedel, David Luz, Hans Ulrik Nørgaard-Nielsen, Tom Ray, Hans Rickman, Avri Selig, Mark Swain, Marek Banaszkiewicz, Mike Barlow, Neil Bowles, Graziella Branduardi-Raymont, Vincent Coudé du Foresto, Jean-Claude Gerard, Laurent Gizon, Allan Hornstrup, Christopher Jarchow, Franz Kerschbaum, Géza Kovacs, Pierre-Olivier Lagage, Tanya Lim, Mercedes Lopez-Morales, Giuseppe Malaguti, Emanuele Pace, Enzo Pascale, Bart Vandenbussche, Gillian Wright, Gonzalo Ramos Zapata, Alberto Adriani, Ruymán Azzollini, Ana Balado, Ian Bryson, Raymond Burston, Josep Colomé, Martin Crook, Anna Di Giorgio, Matt Griffin, Ruud Hoogeveen, Roland Ottensamer, Ranah Irshad, Kevin Middleton, Gianluca Morgante, Frederic Pinsard, Mirek Rataj, Jean-Michel Reess, Giorgio Savini, Jan-Rutger Schrader, Richard Stamper, Berend Winter, L. Abe, M. Abreu, N. Achilleos, P. Ade, V. Adybekian, L. Affer, C. Agnor, M. Agundez, C. Alard, J. Alcala, C. Allende Prieto, F. J. Alonso Floriano, F. Altieri, C. A. Alvarez Iglesias, P. Amado, A. Andersen, A. Aylward, C. Baffa, G. Bakos, P. Ballerini, M. Banaszkiewicz, R. J. Barber, D. Barrado, E. J. Barton, V. Batista, G. Bellucci, J. A. Belmonte Avilés, D. Berry, B. Bézard, D. Biondi, M. Błęcka, I. Boisse, B. Bonfond, P. Bordé, P. Börner, H. Bouy, L. Brown, L. Buchhave, J. Budaj, A. Bulgarelli, M. Burleigh, A. Cabral, M. T. Capria, A. Cassan, C. Cavarroc, C. Cecchi-Pestellini, R. Cerulli, J. Chadney, S. Chamberlain, N. Christian Jessen, A. Ciaravella, A. Claret, R. Claudi, A. Coates, R. Cole, A. Collur, D. Cordier, E. Covino, C. Danielski, M. Damasso, H. J. Deeg, E. Delgado-Mena, C. Del Vecchio, O. Demangeon, A. De Sio, J. De Wit, M. Dobrijévi, P. Doel, C. Dominic, E. Dorfi, S. Eales, C. Eiroa, M. Espinoza Contreras, M. Esposito, V. Eymet, N. Fabrizio, M. Fernández, B. Femenía Castella, P. Figueira, G. Filacchione, L. Fletcher, M. Focardi, S. Fossey, P. Fouqué, J. Frith, M. Galand, L. Gambicorti, P. Gaulme, R. J. García López, A. Garcia-Piquer, W. Gear, J. -C. Gerard, L. Gesa, E. Giani, F. Gianotti, M. Gillon, E. Giro, M. Giuranna, H. Gomez, I. Gomez-Leal, J. Gonzalez Hernandez, B. GonzÁlez Merino, R. Graczyk, D. Grassi, J. Guardia, P. Guio, J. Gustin, P. Hargrave, J. Haigh, E. Hébrard, U. Heiter, R. L. Heredero, E. Herrero, F. Hersant, D. Heyrovsky, M. Hollis, B. Hubert, R. Hueso, G. Israelian, N. Iro, P. Irwin, S. Jacquemoud, G. Jones, H. Jones, K. Justtanont, T. Kehoe, F. Kerschbaum, E. Kerins, P. Kervell, D. Kipping, T. Koskinen, N. Krupp, O. Lahav, B. Laken, N. Lanza, E. Lellouch, G. Leto, J. Licandro Goldaracena, C. Lithgow Bertelloni, S. J. Liu, U. Lo Cicero, N. Lodieu, P. Lognonné, M. Lopez Puertas, M. A. Lopez Valverde, I. Lundgaard Rasmussen, A. Luntzer, P. Machado, C. Mac Tavish, A. Maggio, J. P. Maillard, W. Magnes, J. Maldonado, U. Mall, J. B. Marquette, P. Mauskopf, F. Massi, A. S. Maurin, A. Medvedev, C. Michaut, P. Miles Paez, M. Montalto, P. Montañés Rodríguez, M. Monteiro, D. Montes, H. Morais, J. C. Morale, M. Morales-Calderón, G. Morello, A. Moro Martín, J. Moses, A. Moya Bedon, F. Murgas Alcaino, E. Oliva, G. Orton, F. Palla, M. Pancrazzi, E. Pantin, V. Parmentier, H. Parviainen, Y. Pena Ramirez, J. Peralta, S. Perez-Hoyos, R. Petrov, S. Pezzuto, R. Pietrzak, E. Pilat-Lohinger, N. Piskunov, R. Prinja, L. Prisinzano, I. Polichtchouk, E. Poretti, A. Radioti, A. Ramos, T. Rank-Luftinger, P. Read, K. Readorn, R. Rebolo Lopez, J. Rebordao, M. Rengel, L. Rezac, M. Rocchetto, F. Rodler, J. Sanchez Bejar, A. Sanchez Lavega, E. Sanroma, N. Santos, J. Sanz Forcada, G. Scandariato, F.- X. Schmider, A. Scholz, S. Scuderi, J. Sethenadh, S. Shore, A. Showman, B. Sicardy, P. Sitek, A. Smith, L. Soret, S. Sousa, A. Stiepen, M. Stolarski, G. Strazzulla, H. M. Tabernero, P. Tanga, M. Tecsa, J. Temple, L. Terenzi, M. Tessenyi, L. Testi, S. Thompson, H. Thrastarson, B. W. Tingley, M. Trifoglio, J. Martin Torres, A. Tozzi, D. Turrini, R. Varley, F. Vakili, M. de Val-Borro, M. L. Valdivieso, O. Venot, E. Villaver, S. Vinatier, S. Viti, I. Waldmann, D. Waltham, D. Ward-Thompson, R. Waters, C. Watkins, D. Watson, P. Wawer, A. Wawrzaszk, G. White, T. Widemann, W. Winek, T. Wi.niowski, R. Yelle, Y. Yung, and S. N. Yurchenko

Subjects
13. Climate action, 7. Clean energy
Published
2015
Full Text
View/download PDF

15. A maximum entropy approach to detect close-in giant planets around active stars

Author

Isabelle Boisse, Pascal Petit, Colin P. Folsom, G. A. J. Hussain, John R. Barnes, Stephen C. Marsden, E. Hébrard, S. V. Jeffers, X. Delfosse, Jerome Bouvier, Torsten Böhm, Jean-François Donati, Julien Morin, Simon Borgniet, Institut de recherche en astrophysique et planétologie (IRAP), Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS), Laboratoire Univers et Particules de Montpellier (LUPM), Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Centre National de la Recherche Scientifique (CNRS), Institut de Planétologie et d'Astrophysique de Grenoble (IPAG), Centre National d'Études Spatiales [Toulouse] (CNES)-Université Grenoble Alpes (UGA)-Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes (UGA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Centre National de la Recherche Scientifique (CNRS), Laboratoire d'Astrophysique de Marseille (LAM), Aix Marseille Université (AMU)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), European Southern Observatory (ESO), Institut für Astrophysik [Göttingen], Georg-August-University [Göttingen], University of Southern Queensland (USQ), University of Hertfordshire [Hatfield] (UH), Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), Institut de Planétologie et d'Astrophysique de Grenoble (IPAG ), Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Joseph Fourier - Grenoble 1 (UJF)-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire Midi-Pyrénées (OMP), Institut de Recherche pour le Développement (IRD)-Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Centre National de la Recherche Scientifique (CNRS), Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), Georg-August-University = Georg-August-Universität Göttingen, Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Joseph Fourier - Grenoble 1 (UJF)-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS), and Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Aix Marseille Université (AMU)-Centre National d'Études Spatiales [Toulouse] (CNES)

Subjects
planets and satellites: detection, [SDU.ASTR.EP]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Earth and Planetary Astrophysics [astro-ph.EP], FOS: Physical sciences, symbols.namesake, Planet, stars: rotation, stars: activity, Circular orbit, planetary systems, Solar and Stellar Astrophysics (astro-ph.SR), Earth and Planetary Astrophysics (astro-ph.EP), Physics, Orbital elements, [SDU.ASTR.SR]Sciences of the Universe [physics]/Astrophysics [astro-ph]/Solar and Stellar Astrophysics [astro-ph.SR], Astronomy and Astrophysics, Orbital period, Exoplanet, stars: imaging, Computational physics, Radial velocity, Amplitude, Astrophysics - Solar and Stellar Astrophysics, Space and Planetary Science, symbols, Astrophysics::Earth and Planetary Astrophysics, planets and satellites, detection, stars, imaging, rotation, activity, Doppler effect, Astrophysics - Earth and Planetary Astrophysics
Abstract

(shortened for arXiv) We aim to progress towards more efficient exoplanet detection around active stars by optimizing the use of Doppler Imaging in radial velocity measurements. We propose a simple method to simultaneously extract a brightness map and a set of orbital parameters through a tomographic inversion technique derived from classical Doppler mapping. Based on the maximum entropy principle, the underlying idea is to determine the set of orbital parameters that minimizes the information content of the resulting Doppler map. We carry out a set of numerical simulations to perform a preliminary assessment of the robustness of our method, using an actual Doppler map of the very active star HR 1099 to produce a realistic synthetic data set for various sets of orbital parameters of a single planet in a circular orbit. Using a simulated time-series of 50 line profiles affected by a peak-to-peak activity jitter of 2.5 km/s, we are able in most cases to recover the radial velocity amplitude, orbital phase and orbital period of an artificial planet down to a radial velocity semi-amplitude of the order of the radial velocity scatter due to the photon noise alone (about 50 m/s in our case). One noticeable exception occurs when the planetary orbit is close to co-rotation, in which case significant biases are observed in the reconstructed radial velocity amplitude, while the orbital period and phase remain robustly recovered. The present method constitutes a very simple way to extract orbital parameters from heavily distorted line profiles of active stars, when more classical radial velocity detection methods generally fail. It is easily adaptable to most existing Doppler Imaging codes, paving the way towards a systematic search for close-in planets orbiting young, rapidly-rotating stars., Accepted by A&A

Published
2015
Full Text
View/download PDF

16. Detecting planets around active stars: impact of magnetic fields on radial velocities and line bisectors

Author

Jean-François Donati, Guillaume Hebrard, C. Moutou, Xavier Delfosse, Julien Morin, E. Hébrard, Isabelle Boisse, Institut de recherche en astrophysique et planétologie (IRAP), Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Observatoire Midi-Pyrénées (OMP), Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS), Institut de Planétologie et d'Astrophysique de Grenoble (IPAG), Centre National d'Études Spatiales [Toulouse] (CNES)-Université Grenoble Alpes (UGA)-Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes (UGA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Joseph Fourier - Grenoble 1 (UJF)-Centre National de la Recherche Scientifique (CNRS), Laboratoire Univers et Particules de Montpellier (LUPM), Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Centre National de la Recherche Scientifique (CNRS), Institut für Astrophysik [Göttingen], Georg-August-University [Göttingen], Laboratoire d'Astrophysique de Marseille (LAM), Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Aix Marseille Université (AMU)-Centre National d'Études Spatiales [Toulouse] (CNES), Canada-France-Hawaii Telescope Corporation (CFHT), National Research Council of Canada (NRC)-Centre National de la Recherche Scientifique (CNRS)-University of Hawai'i [Honolulu] (UH), Institut d'Astrophysique de Paris (IAP), Université Pierre et Marie Curie - Paris 6 (UPMC)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National de la Recherche Scientifique (CNRS), Observatoire de Haute-Provence (OHP), Institut Pythéas (OSU PYTHEAS), Aix Marseille Université (AMU)-Centre National de la Recherche Scientifique (CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Institut de Recherche pour le Développement (IRD)-Aix Marseille Université (AMU)-Centre National de la Recherche Scientifique (CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Institut de Recherche pour le Développement (IRD), Institut national des sciences de l'Univers (INSU - CNRS)-Université Toulouse III - Paul Sabatier (UT3), Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Météo France-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Centre National de la Recherche Scientifique (CNRS), Institut de Planétologie et d'Astrophysique de Grenoble (IPAG ), Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Joseph Fourier - Grenoble 1 (UJF)-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS), Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Université Montpellier 2 - Sciences et Techniques (UM2), Centre National de la Recherche Scientifique (CNRS)-Institut national des sciences de l'Univers (INSU - CNRS)-Université Pierre et Marie Curie - Paris 6 (UPMC), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Observatoire Midi-Pyrénées (OMP), Institut de Recherche pour le Développement (IRD)-Université Toulouse III - Paul Sabatier (UT3), Université de Toulouse (UT)-Université de Toulouse (UT)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS)-Météo-France -Centre National de la Recherche Scientifique (CNRS), Observatoire des Sciences de l'Univers de Grenoble (OSUG), Université Joseph Fourier - Grenoble 1 (UJF)-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Joseph Fourier - Grenoble 1 (UJF)-Institut polytechnique de Grenoble - Grenoble Institute of Technology (Grenoble INP )-Institut national des sciences de l'Univers (INSU - CNRS)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de Physique Nucléaire et de Physique des Particules du CNRS (IN2P3)-Centre National de la Recherche Scientifique (CNRS), Georg-August-University = Georg-August-Universität Göttingen, Aix Marseille Université (AMU)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), and Institut de Recherche pour le Développement (IRD)-Aix Marseille Université (AMU)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD)-Aix Marseille Université (AMU)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Centre National de la Recherche Scientifique (CNRS)

Subjects
Physics, Zeeman effect, [SDU.ASTR]Sciences of the Universe [physics]/Astrophysics [astro-ph], Starspot, stars: magnetic field, Astronomy, Astronomy and Astrophysics, line: profiles, Astrophysics, Magnetic field, symbols.namesake, Stars, techniques: polarimetric, starspots, 13. Climate action, Space and Planetary Science, Planet, techniques: radial velocities, symbols, Astrophysics::Solar and Stellar Astrophysics, Astrophysics::Earth and Planetary Astrophysics, Low Mass, Magnetic dipole, Line (formation)
Abstract

International audience; Although technically challenging, detecting Earth-like planets around very low mass stars is in principle accessible to the existing velocimeters of highest radial-velocity (RV) precision. However, low-mass stars being active, they often feature dark spots and magnetic regions at their surfaces generating a noise level in RV curves (called activity jitter) that can severely limit our practical ability at detecting Earth-like planets. Whereas the impact of dark spots on RV data has been extensively studied in the literature, that of magnetic features only received little attention up to now. In this paper, we aim at quantifying the impact of magnetic fields (and the Zeeman broadening they induce) on line profiles, line bisectors and RV data. With a simple model, we quantitatively study the RV signals and bisector distortions that small magnetic regions or global magnetic dipoles can generate, especially at infrared wavelengths where the Zeeman broadening is much larger than that in the visible. We report in particular that the impact of magnetic features on line bisectors can be different from that of cool spots when the rotational broadening is comparable to or larger than the Zeeman broadening; more specifically, we find in this case that the top and bottom sections of the bisectors are anticorrelated, i.e. the opposite behaviour of what is observed for cool spots. We finally suggest new options to show and ultimately filter the impact of the magnetic activity on RV curves.

Published
2014
Full Text
View/download PDF

17. A window on exoplanet dynamical histories: Rossiter-McLaughlin observations of WASP-13b and WASP-32b

Author

Guillaume Hébrard, Francesca Faedi, Damien Ségransan, François Bouchy, Richard G. West, I. Skillen, C. Liebig, Emmanuel Jehin, E. Hébrard, Peter J. Wheatley, Monika Lendl, Laetitia Delrez, J. McCormac, Coel Hellier, Andrew Norton, J. Bochinski, Carole A. Haswell, Vadim Burwitz, Heather M. Cegla, Amaury H. M. J. Triaud, Ulrich Kolb, R. Busuttil, A. Fumel, Don Pollacco, David J. Armstrong, A. Collier Cameron, Keivan G. Stassun, E. K. Simpson, Stéphane Udry, Michaël Gillon, Pierre F. L. Maxted, S. C. C. Barros, D. J. A. Brown, Christopher A. Watson, David R. Anderson, Y. Gómez Maqueo Chew, Alexandre Santerne, J. L. Rodriguez, G. R. M. Miller, Joao Bento, Barry Smalley, Amanda P. Doyle, Didier Queloz, R.D. Brothwell, Francesco Pepe, Laboratoire d'Astrophysique de Marseille (LAM), Aix Marseille Université (AMU)-Institut national des sciences de l'Univers (INSU - CNRS)-Centre National d'Études Spatiales [Toulouse] (CNES)-Centre National de la Recherche Scientifique (CNRS), Science & Technology Facilities Council, and University of St Andrews. School of Physics and Astronomy

Subjects
Rotation period, individual: WASP-13 [Stars], FOS: Physical sciences, Astrophysics, Astrophysics::Cosmology and Extragalactic Astrophysics, 01 natural sciences, Rotation periods, Transiting exoplanets, Spaced data, Planet, 0103 physical sciences, Hot Jupiter, QB Astronomy, Astrophysics::Solar and Stellar Astrophysics, 010306 general physics, 010303 astronomy & astrophysics, Astrophysics::Galaxy Astrophysics, QB, Physics, Earth and Planetary Astrophysics (astro-ph.EP), radial velocities [Techniques], [SDU.ASTR]Sciences of the Universe [physics]/Astrophysics [astro-ph], Stellar rotation, photometric [Techniques], Systems, Astronomy, Astronomy and Astrophysics, Radius, Planetary system, Exoplanet, Spin-orbit Misalignment, Stars, individual: WASP-32 [Stars], Planetary systems, Computer Science::Graphics, Hot-Jupiter, 13. Climate action, Space and Planetary Science, Polar orbit, Time-series, Astrophysics::Earth and Planetary Astrophysics, Host stars, Astrophysics - Earth and Planetary Astrophysics
Abstract

We present Rossiter-McLaughlin observations of WASP-13b and WASP-32b and determine the sky-projected angle between the normal of the planetary orbit and the stellar rotation axis ($\lambda$). WASP-13b and WASP-32b both have prograde orbits and are consistent with alignment with measured sky-projected angles of $\lambda={8^{\circ}}^{+13}_{-12}$ and $\lambda={-2^{\circ}}^{+17}_{-19}$, respectively. Both WASP-13 and WASP-32 have $T_{\mathrm{eff}}, Comment: 12 pages, 4 Figures, Accepted for publication in MNRAS

Published
2014
Full Text
View/download PDF

19. Durability of natural and transgenic resistances in rice to Rice yellow mottle virus.

Author

F. Sorho, A. Pinel, O. Traoré, A. Bersoult, A. Ghesquière, E. Hébrard, G. Konaté, Y. Séré, and D. Fargette

Abstract

Abstract A monogenic recessive resistance to Rice yellow mottle virus (RYMV) found in the Oryza sativa indica cultivar Gigante and in a few Oryza glaberrima cultivars provided a higher level of resistance than either a polygenic partial resistance found in some japonica cultivars which delayed symptom expression or transgenic resistances which were partial and temporary. This high resistance was overcome by several isolates, but the percentage of such virulent isolates in the fields was low. There was no relationship between the virulence of an isolate towards the high resistance and its aggressiveness in other cultivars. Isolates with either of the two components of pathogenicity – virulence and aggressiveness – were found in each strain and in all regions of Africa, in both wild and cultivated grass species. There was no loss of fitness of resistance-breaking (RB) isolates as they were not counter-selected, impaired or outperformed after serial passages in susceptible cultivars, even in mixture with avirulent quasi-isogenic wild type isolates. Resistance breaking was highly dependent on the amount of virus inoculated and on the mode of transmission. Implications of these results for the durability of the resistances to RYMV and for the development of integrated disease management strategies are discussed. [ABSTRACT FROM AUTHOR]

Published
2005

21. Inhomogeneous terminators on the exoplanet WASP-39 b.

Author

Espinoza N, Steinrueck ME, Kirk J, MacDonald RJ, Savel AB, Arnold K, Kempton EM, Murphy MM, Carone L, Zamyatina M, Lewis DA, Samra D, Kiefer S, Rauscher E, Christie D, Mayne N, Helling C, Rustamkulov Z, Parmentier V, May EM, Carter AL, Zhang X, López-Morales M, Allen N, Blecic J, Decin L, Mancini L, Molaverdikhani K, Rackham BV, Palle E, Tsai SM, Ahrer EM, Bean JL, Crossfield IJM, Haegele D, Hébrard E, Kreidberg L, Powell D, Schneider AD, Welbanks L, Wheatley P, Brahm R, and Crouzet N

Abstract

Transmission spectroscopy has been a workhorse technique used over the past two decades to constrain the physical and chemical properties of exoplanet atmospheres 1-5 . One of its classical key assumptions is that the portion of the atmosphere it probes-the terminator region-is homogeneous. Several works from the past decade, however, have put this into question for highly irradiated, hot (T eq  ≳ 1,000 K) gas giant exoplanets, both empirically 6-10 and through three-dimensional modelling 11-17 . While models have predicted clear differences between the evening (day-to-night) and morning (night-to-day) terminators, direct morning and evening transmission spectra in a wide wavelength range have not been reported for an exoplanet so far. Under the assumption of precise and accurate orbital parameters for the exoplanet WASP-39 b, here we report the detection of inhomogeneous terminators on WASP-39 b, which has allowed us to retrieve its morning and evening transmission spectra in the near-infrared (2-5 μm) using the James Webb Space Telescope. We have observed larger transit depths in the evening, which are, on average, 405 ± 88 ppm larger than the morning ones, and also have qualitatively larger features than the morning spectrum. The spectra are best explained by models in which the evening terminator is hotter than the morning terminator by 17 7 - 57 + 65  K, with both terminators having C/O ratios consistent with solar. General circulation models predict temperature differences broadly consistent with the above value and point towards a cloudy morning terminator and a clearer evening terminator., (© 2024. The Author(s).)

Published
2024
Full Text
View/download PDF

22. Revisiting the origins of the Sobemovirus genus: A case for ancient origins of plant viruses.

Author

Ghafari M, Sõmera M, Sarmiento C, Niehl A, Hébrard E, Tsoleridis T, Ball J, Moury B, Lemey P, Katzourakis A, and Fargette D

Subjects
Animals, Humans, Phylogeny, Biological Evolution, Plants, Evolution, Molecular, RNA Viruses genetics, Plant Viruses genetics
Abstract

The discrepancy between short- and long-term rate estimates, known as the time-dependent rate phenomenon (TDRP), poses a challenge to extrapolating evolutionary rates over time and reconstructing evolutionary history of viruses. The TDRP reveals a decline in evolutionary rate estimates with the measurement timescale, explained empirically by a power-law rate decay, notably observed in animal and human viruses. A mechanistic evolutionary model, the Prisoner of War (PoW) model, has been proposed to address TDRP in viruses. Although TDRP has been studied in animal viruses, its impact on plant virus evolutionary history remains largely unexplored. Here, we investigated the consequences of TDRP in plant viruses by applying the PoW model to reconstruct the evolutionary history of sobemoviruses, plant pathogens with significant importance due to their impact on agriculture and plant health. Our analysis showed that the Sobemovirus genus dates back over four million years, indicating an ancient origin. We found evidence that supports deep host jumps to Poaceae, Fabaceae, and Solanaceae occurring between tens to hundreds of thousand years ago, followed by specialization. Remarkably, the TDRP-corrected evolutionary history of sobemoviruses was extended far beyond previous estimates that had suggested their emergence nearly 9,000 years ago, a time coinciding with the Neolithic period in the Near East. By incorporating sequences collected through metagenomic analyses, the resulting phylogenetic tree showcases increased genetic diversity, reflecting a deep history of sobemovirus species. We identified major radiation events beginning between 4,600 to 2,000 years ago, which aligns with the Neolithic period in various regions, suggesting a period of rapid diversification from then to the present. Our findings make a case for the possibility of deep evolutionary origins of plant viruses., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2024 Ghafari et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Published
2024
Full Text
View/download PDF

23. Dynamics of the rice yellow mottle disease in western Burkina Faso: Epidemic monitoring, spatio-temporal variation of viral diversity, and pathogenicity in a disease hotspot.

Author

Billard E, Barro M, Sérémé D, Bangratz M, Wonni I, Koala M, Kassankogno AI, Hébrard E, Thébaud G, Brugidou C, Poulicard N, and Tollenaere C

Abstract

The rice yellow mottle virus (RYMV) is a model in plant virus molecular epidemiology, with the reconstruction of historical introduction routes at the scale of the African continent. However, information on patterns of viral prevalence and viral diversity over multiple years at a local scale remains scarce, in spite of potential implications for crop protection. Here, we describe a 5-year (2015-9) monitoring of RYMV prevalence in six sites from western Burkina Faso (geographic areas of Bama, Banzon, and Karfiguela). It confirmed one irrigated site as a disease hotspot and also found one rainfed lowland (RL) site with occasional high prevalence levels. Within the studied fields, a pattern of disease aggregation was evidenced at a 5-m distance, as expected for a mechanically transmitted virus. Next, we monitored RYMV genetic diversity in the irrigated disease hotspot site, revealing a high viral diversity, with the current coexistence of various distinct genetic groups at the site scale (ca. 520 ha) and also within various specific fields (25 m side). One genetic lineage, named S1bzn, is the most recently emerged group and increased in frequency over the studied period (from 20 per cent or less in 2015-6 to more than 65 per cent in 2019). Its genome results from a recombination between two other lineages (S1wa and S1ca). Finally, experimental work revealed that three rice varieties commonly cultivated in Burkina Faso were not different in terms of resistance level, and we also found no significant effect of RYMV genetic groups on symptom expression and viral load. We found, however, that infection outcome depended on the specific RYMV isolate, with two isolates from the lineage S1bzn accumulating at the highest level at early infections. Overall, this study documents a case of high viral prevalence, high viral diversity, and co-occurrence of divergent genetic lineages at a small geographic scale. A recently emerged lineage, which comprises viral isolates inducing severe symptoms and high accumulation under controlled conditions, could be recently rising through natural selection. Following up the monitoring of RYMV diversity is required to confirm this trend and further understand the factors driving the local maintenance of viral diversity., Competing Interests: None declared., (© The Author(s) 2023. Published by Oxford University Press.)

Published
2023
Full Text
View/download PDF

24. Genetic diversity and epidemic histories of rice yellow mottle virus in Ghana.

Author

Omiat EG, Asante MD, Traoré VSE, Oppong A, Ifie BE, Ofosu KA, Aribi J, Pinel-Galzi A, Comte A, Fargette D, Hébrard E, Traoré O, Offei SK, Danquah EY, and Poulicard N

Subjects
Ghana epidemiology, Plant Breeding, Genetic Variation, Plant Viruses genetics, Oryza
Abstract

Rice yellow mottle virus (RYMV) has persisted as a major biotic constraint to rice production in Africa. However, no data on RYMV epidemics were available in Ghana, although it is an intensive rice-producing country. Surveys were performed from 2010 to 2020 in eleven rice-growing regions of Ghana. Symptom observations and serological detections confirmed that RYMV is circulating in most of these regions. Coat protein gene and complete genome sequencings revealed that RYMV in Ghana almost exclusively belongs to the strain S2, one of the strains covering the largest area in West Africa. We also detected the presence of the S1ca strain which is being reported for the first time outside its area of origin. These results suggested a complex epidemiological history of RYMV in Ghana and a recent expansion of S1ca to West Africa. Phylogeographic analyses reconstructed at least five independent RYMV introductions in Ghana for the last 40 years, probably due to rice cultivation intensification in West Africa leading to a better circulation of RYMV. In addition to identifying some routes of RYMV dispersion in Ghana, this study contributes to the epidemiological surveillance of RYMV and helps to design disease management strategies, especially through breeding for rice disease resistance., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023. Published by Elsevier B.V.)

Published
2023
Full Text
View/download PDF

25. Photochemically produced SO 2 in the atmosphere of WASP-39b.

Author

Tsai SM, Lee EKH, Powell D, Gao P, Zhang X, Moses J, Hébrard E, Venot O, Parmentier V, Jordan S, Hu R, Alam MK, Alderson L, Batalha NM, Bean JL, Benneke B, Bierson CJ, Brady RP, Carone L, Carter AL, Chubb KL, Inglis J, Leconte J, Line M, López-Morales M, Miguel Y, Molaverdikhani K, Rustamkulov Z, Sing DK, Stevenson KB, Wakeford HR, Yang J, Aggarwal K, Baeyens R, Barat S, de Val-Borro M, Daylan T, Fortney JJ, France K, Goyal JM, Grant D, Kirk J, Kreidberg L, Louca A, Moran SE, Mukherjee S, Nasedkin E, Ohno K, Rackham BV, Redfield S, Taylor J, Tremblin P, Visscher C, Wallack NL, Welbanks L, Youngblood A, Ahrer EM, Batalha NE, Behr P, Berta-Thompson ZK, Blecic J, Casewell SL, Crossfield IJM, Crouzet N, Cubillos PE, Decin L, Désert JM, Feinstein AD, Gibson NP, Harrington J, Heng K, Henning T, Kempton EM, Krick J, Lagage PO, Lendl M, Lothringer JD, Mansfield M, Mayne NJ, Mikal-Evans T, Palle E, Schlawin E, Shorttle O, Wheatley PJ, and Yurchenko SN

Abstract

Photochemistry is a fundamental process of planetary atmospheres that regulates the atmospheric composition and stability 1 . However, no unambiguous photochemical products have been detected in exoplanet atmospheres so far. Recent observations from the JWST Transiting Exoplanet Community Early Release Science Program 2,3 found a spectral absorption feature at 4.05 μm arising from sulfur dioxide (SO 2 ) in the atmosphere of WASP-39b. WASP-39b is a 1.27-Jupiter-radii, Saturn-mass (0.28 M J ) gas giant exoplanet orbiting a Sun-like star with an equilibrium temperature of around 1,100 K (ref.  4 ). The most plausible way of generating SO 2 in such an atmosphere is through photochemical processes 5,6 . Here we show that the SO 2 distribution computed by a suite of photochemical models robustly explains the 4.05-μm spectral feature identified by JWST transmission observations 7 with NIRSpec PRISM (2.7σ) 8 and G395H (4.5σ) 9 . SO 2 is produced by successive oxidation of sulfur radicals freed when hydrogen sulfide (H 2 S) is destroyed. The sensitivity of the SO 2 feature to the enrichment of the atmosphere by heavy elements (metallicity) suggests that it can be used as a tracer of atmospheric properties, with WASP-39b exhibiting an inferred metallicity of about 10× solar. We further point out that SO 2 also shows observable features at ultraviolet and thermal infrared wavelengths not available from the existing observations., (© 2023. The Author(s).)

Published
2023
Full Text
View/download PDF

26. Molecular Tools to Infer Resistance-Breaking Abilities of Rice Yellow Mottle Virus Isolates.

Author

Dossou L, Pinel-Galzi A, Aribi J, Poulicard N, Albar L, Fatogoma S, Ndjiondjop MN, Koné D, and Hébrard E

Subjects
Genome, Viral, Genotype, Africa, Plant Viruses genetics, Oryza
Abstract

Rice yellow mottle virus (RYMV) is a major biotic constraint to rice cultivation in Africa. RYMV shows a high genetic diversity. Viral lineages were defined according to the coat protein (CP) phylogeny. Varietal selection is considered as the most efficient way to manage RYMV. Sources of high resistance were identified mostly in accessions of the African rice species, Oryza glaberrima . Emergence of resistance-breaking (RB) genotypes was observed in controlled conditions. The RB ability was highly contrasted, depending on the resistance sources and on the RYMV lineages. A molecular marker linked to the adaptation to susceptible and resistant O. glaberrima was identified in the viral protein genome-linked (VPg). By contrast, as no molecular method was available to identify the hypervirulent lineage able to overcome all known resistance sources, plant inoculation assays were still required. Here, we designed specific RT-PCR primers to infer the RB abilities of RYMV isolates without greenhouse experiments or sequencing steps. These primers were tested and validated on 52 isolates, representative of RYMV genetic diversity. The molecular tools described in this study will contribute to optimizing the deployment strategy of resistant lines, considering the RYMV lineages identified in fields and their potential adaptability.

Published
2023
Full Text
View/download PDF

27. Rapid evolution of an RNA virus to escape recognition by a rice nucleotide-binding and leucine-rich repeat domain immune receptor.

Author

Bonnamy M, Pinel-Galzi A, Gorgues L, Chalvon V, Hébrard E, Chéron S, Nguyen TH, Poulicard N, Sabot F, Pidon H, Champion A, Césari S, Kroj T, and Albar L

Subjects
Leucine, Nucleotides, Plant Diseases genetics, Plant Proteins genetics, NLR Proteins metabolism, Oryza, RNA Viruses metabolism, Virus Diseases
Abstract

Viral diseases are a major limitation for crop production, and their control is crucial for sustainable food supply. We investigated by a combination of functional genetics and experimental evolution the resistance of rice to the rice yellow mottle virus (RYMV), which is among the most devastating rice pathogens in Africa, and the mechanisms underlying the extremely fast adaptation of the virus to its host. We found that the RYMV3 gene that protects rice against the virus codes for a nucleotide-binding and leucine-rich repeat domain immune receptor (NLRs) from the Mla-like clade of NLRs. RYMV3 detects the virus by forming a recognition complex with the viral coat protein (CP). The virus escapes efficiently from detection by mutations in its CP, some of which interfere with the formation of the recognition complex. This study establishes that NLRs also confer in monocotyledonous plants immunity to viruses, and reveals an unexpected functional diversity for NLRs of the Mla clade that were previously only known as fungal disease resistance proteins. In addition, it provides precise insight into the mechanisms by which viruses adapt to plant immunity and gives important knowledge for the development of sustainable resistance against viral diseases of cereals., (© 2022 The Authors. New Phytologist © 2022 New Phytologist Foundation.)

Published
2023
Full Text
View/download PDF

28. Complete genome sequence of a novel marafivirus infecting pearl millet in Burkina Faso.

Author

Palanga E, Tibiri EB, Bangratz M, Filloux D, Julian C, Pinel-Galzi A, Koala M, Néya JB, Brugidou C, Tiendrébéogo F, Roumagnac P, and Hébrard E

Subjects
Burkina Faso, Genome, Viral, High-Throughput Nucleotide Sequencing, Phylogeny, RNA, Viral genetics, Pennisetum, Tymoviridae genetics
Abstract

Pearl millet (Pennisetum glaucum (L.) R. Br.) is a staple food that is widely cultivated in sub-Saharan Africa. In August 2018, a survey was conducted in the main producing regions of Burkina Faso, and leaf samples were analyzed using virion-associated nucleic acid (VANA)-based metagenomic approach and Illumina sequencing. A new virus, tentatively named "Pennisetum glaucum marafivirus" (PGMV), was detected, and its complete nucleotide sequence of 6364 nucleotides was determined. The sequence contains a large open reading frame (ORF) encoding a polyprotein of 224.2 kDa with five domains (methyltransferase, papain-like protease, helicase, RNA-dependent RNA polymerase, and coat proteins), typical of marafiviruses. Additionally, a characteristic conserved marafibox domain was detected in the genome. The nucleotide sequence of the complete PGMV genome shares 68.5% identity with that of sorghum bicolor marafivirus, and its coat protein shares 58.5% identity with that of oat blue dwarf virus. Phylogenetic analysis confirmed that the pearl millet virus is unambiguously grouped with members of the genus Marafivirus in the family Tymoviridae. This is the first report on the occurrence of a marafivirus in pearl millet., (© 2021. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Published
2022
Full Text
View/download PDF

29. ICTV Virus Taxonomy Profile: Solemoviridae 2021.

Author

Sõmera M, Fargette D, Hébrard E, Sarmiento C, and Ictv Report Consortium

Subjects
Genome, Viral, Host Specificity, Open Reading Frames, Plant Viruses classification, RNA Viruses classification, RNA, Viral genetics, Virion ultrastructure, Virus Replication, Plant Viruses genetics, RNA Viruses genetics
Abstract

The family Solemoviridae includes viruses with icosahedral particles (26-34 nm in diameter) assembled on T =3 symmetry with a 4-6 kb positive-sense, monopartite, polycistronic RNA genome. Transmission of members of the genera Sobemovirus and Polemovirus occurs via mechanical wounding, vegetative propagation, insect vectors or abiotically through soil; members of the genera Polerovirus and Enamovirus are transmitted by specific aphids. Most solemoviruses have a narrow host range. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Solemoviridae , which is available at ictv.global/report/solemoviridae.

Published
2021
Full Text
View/download PDF

30. Rivers and landscape ecology of a plant virus, Rice yellow mottle virus along the Niger Valley.

Author

Issaka S, Traoré O, Longué RDS, Pinel-Galzi A, Gill MS, Dellicour S, Bastide P, Guindon S, Hébrard E, Dugué MJ, Séré Y, Semballa S, Aké S, Lemey P, and Fargette D

Abstract

To investigate the spread of Rice yellow mottle virus (RYMV) along the Niger River, regular sampling of virus isolates was conducted along 500 km of the Niger Valley in the Republic of Niger and was complemented by additional sampling in neighbouring countries in West Africa and Central Africa. The spread of RYMV into and within the Republic of Niger was inferred as a continuous process using a Bayesian statistical framework applied previously to reconstruct its dispersal history in West Africa, East Africa, and Madagascar. The spatial resolution along this section of the Niger River was the highest implemented for RYMV and possibly for any plant virus. We benefited from the results of early field surveys of the disease for the validation of the phylogeographic reconstruction and from the well-documented history of rice cultivation changes along the Niger River for their interpretation. As a prerequisite, the temporal signal of the RYMV data sets was revisited in the light of recent methodological advances. The role of the hydrographic network of the Niger Basin in RYMV spread was examined, and the link between virus population dynamics and the extent of irrigated rice was assessed. RYMV was introduced along the Niger River in the Republic of Niger in the early 1980s from areas to the southwest of the country where rice was increasingly grown. Viral spread was triggered by a major irrigation scheme made of a set of rice perimeters along the river valley. The subsequent spatial and temporal host continuity and the inoculum build-up allowed for a rapid spread of RYMV along the Niger River, upstream and downstream, over hundreds of kilometres, and led to the development of severe epidemics. There was no evidence of long-distance dissemination of the virus through natural water. Floating rice in the main meanders of the Middle Niger did not contribute to virus dispersal from West Africa to Central Africa. RYMV along the Niger River is an insightful example of how agricultural intensification favours pathogen emergence and spread., (© The Author(s) 2021. Published by Oxford University Press.)

Published
2021
Full Text
View/download PDF

31. Genetic Diversity of Rice stripe necrosis virus and New Insights into Evolution of the Genus Benyvirus .

Author

Bagayoko I, Celli MG, Romay G, Poulicard N, Pinel-Galzi A, Julian C, Filloux D, Roumagnac P, Sérémé D, Bragard C, and Hébrard E

Subjects
Phylogeny, Polymorphism, Genetic, Tenuivirus classification, Evolution, Molecular, Genetic Variation, Genome, Viral, RNA, Viral genetics, Tenuivirus genetics
Abstract

The rice stripe necrosis virus (RSNV) has been reported to infect rice in several countries in Africa and South America, but limited genomic data are currently publicly available. Here, eleven RSNV genomes were entirely sequenced, including the first corpus of RSNV genomes of African isolates. The genetic variability was differently distributed along the two genomic segments. The segment RNA1, within which clusters of polymorphisms were identified, showed a higher nucleotidic variability than did the beet necrotic yellow vein virus (BNYVV) RNA1 segment. The diversity patterns of both viruses were similar in the RNA2 segment, except for an in-frame insertion of 243 nucleotides located in the RSNV tgbp1 gene. Recombination events were detected into RNA1 and RNA2 segments, in particular in the two most divergent RSNV isolates from Colombia and Sierra Leone. In contrast to BNYVV, the RSNV molecular diversity had a geographical structure with two main RSNV lineages distributed in America and in Africa. Our data on the genetic diversity of RSNV revealed unexpected differences with BNYVV suggesting a complex evolutionary history of the genus Benyvirus .

Published
2021
Full Text
View/download PDF

32. Flexible spandrels of the global plant virome: Proteomic-wide evolutionary patterns of structural intrinsic protein disorder elucidate modulation at the functional virus-host interplay.

Author

Tahzima R, Haegeman A, Massart S, and Hébrard E

Subjects
Humans, Proteome, Proteomics, Virome, Intrinsically Disordered Proteins, Viruses
Abstract

Intrinsically disordered proteins and regions (IDPs/IDRs) make up a large part of viral proteomes, but their real prevalence across the global plant virome is still murky, partly because of their massive diversity. Here, we propose an evolutionary quantitative proteomic approach to foray into genomic signatures that are preserved in the amino acid sequences of orthologous IDRs. Markedly, we found that relatively abundant IDP varies substantially in viral species among and within plant virus families, including according to genome size, partition or replication strategies. We also demonstrate that most encoded proteomic modules of the plant virome contain multiple disordered features that are phylogenomically preserved, and can be correlated to genomic, bio-physical and evolutionary strategies. Furthermore, our focused interactome-wide analysis highlights lines of evidence indicating that various IDPs with similar evolutionary signatures modulate viral multifunctionality. Moreover, estimated fractions of IDR in the vicinity of pivotal evolutionary structural domains embedded in interaction modules are strongly enriched with affinity binding functional annotations and relate to vector-borne virus transmission modes. Importantly, molecular recognition features (MoRFs) are abundantly widespread in IDRs of viral hallmark modules and their binding partners. Finally, we propose a coarse-grained conceptual framework in which evolutionary proteome-wide IDP/IDRs patterns can be, rather, reliably exploited to elucidate their foundational fine-tuning role in plant virus transmission mechanisms. While opening unexplored avenues for consistently predicting virus-host functions for many new or uncharacterized viruses based on their proteomic repertoire, other considerations advocating further structural IDP research in Plant Virology are thoroughly discussed in light of viral modular evolution., (Copyright © 2021 Elsevier Inc. All rights reserved.)

Published
2021
Full Text
View/download PDF

33. Near-Complete Genome Sequences of Rice Yellow Mottle Virus Isolates from Senegal.

Author

Tall H, Aribi J, Camara S, Pinel-Galzi A, Poulicard N, Fargette D, and Hébrard E

Abstract

Rice yellow mottle virus in Senegal is reported here for the first time. The near-complete genomic sequences of two isolates (Se1 and Se5) were obtained. A comparison with 18 sequences from West Africa revealed a new cluster with an isolate from Gambia, located at a basal position in the phylogenetic tree., (Copyright © 2020 Tall et al.)

Published
2020
Full Text
View/download PDF

34. Comparing patterns and scales of plant virus phylogeography: Rice yellow mottle virus in Madagascar and in continental Africa.

Author

Rakotomalala M, Vrancken B, Pinel-Galzi A, Ramavovololona P, Hébrard E, Randrianangaly JS, Dellicour S, Lemey P, and Fargette D

Abstract

Rice yellow mottle virus (RYMV) in Madagascar Island provides an opportunity to study the spread of a plant virus disease after a relatively recent introduction in a large and isolated country with a heterogeneous host landscape ecology. Here, we take advantage of field survey data on the occurrence of RYMV disease throughout Madagascar dating back to the 1970s, and of virus genetic data from ninety-four isolates collected since 1989 in most regions of the country to reconstruct the epidemic history. We find that the Malagasy isolates belong to a unique recombinant strain that most likely entered Madagascar through a long-distance introduction from the most eastern part of mainland Africa. We infer the spread of RYMV as a continuous process using a Bayesian statistical framework. In order to calibrate the time scale in calendar time units in this analysis, we pool the information about the RYMV evolutionary rate from several geographical partitions. Whereas the field surveys and the phylogeographic reconstructions both point to a rapid southward invasion across hundreds of kilometers throughout Madagascar within three to four decades, they differ on the inferred origin location and time of the epidemic. The phylogeographic reconstructions suggest a lineage displacement and unveil a re-invasion of the northern regions that may have remained unnoticed otherwise. Despite ecological differences that could affect the transmission potential of RYMV in Madagascar and in mainland Africa, we estimate similar invasion and dispersal rates. We could not identify environmental factors that have a relevant impact on the lineage dispersal velocity of RYMV in Madagascar. This study highlights the value and complementarity of (historical) nongenetic and (more contemporaneous) genetic surveillance data for reconstructing the history of spread of plant viruses.

Published
2019
Full Text
View/download PDF

35. Complete Genome Sequences of Rice Yellow Mottle Virus Isolates from the Federal Democratic Republic of Ethiopia.

Author

Rakotomalala M, Abera BB, Rakotoarisoa J, Alemu D, Hébrard E, Pinel-Galzi A, and Fargette D

Abstract

The full-length genomes of two isolates of Rice yellow mottle virus from Ethiopia were sequenced. A comparison with 28 sequences from East Africa showed that they clustered within a new strain named S4et, related to the S4mg and S4ug strains found in the Lake Victoria Basin and Madagascar, respectively., (Copyright © 2019 Rakotomalala et al.)

Published
2019
Full Text
View/download PDF

36. Protocol for RYMV Inoculation and Resistance Evaluation in Rice Seedlings.

Author

Pinel-Galzi A, Hébrard E, Traoré O, Silué D, and Albar L

Abstract

Rice yellow mottle virus (RYMV), a mechanically transmitted virus that causes serious damage to cultivated rice plants, is endemic to Africa. Varietal selection for resistance is considered to be the most effective and sustainable management strategy. Standardized resistance evaluation procedures are required for the identification and characterization of resistance sources. This paper describes a protocol for mechanical inoculation of rice seedlings with RYMV and two methods of resistance evaluation - one based on a symptom severity index and the other on virus detection through double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA)., (Copyright © 2018 The Authors; exclusive licensee Bio-protocol LLC.)

Published
2018
Full Text
View/download PDF

37. Full-Length Genome Sequences of Recombinant and Nonrecombinant Sympatric Strains of Rice yellow mottle virus from Western Kenya.

Author

Adego AK, Poulicard N, Pinel-Galzi A, Mukoye B, Fargette D, Wéré HK, and Hébrard E

Abstract

Five isolates of Rice yellow mottle virus from western Kenya were fully sequenced. One isolate of strain S4lv had been collected in 1966. Two isolates belonged to the emerging strain S4ug recently described in Uganda. Two isolates collected in 2012 are putative recombinants between the S4lv and S4ug strains., (Copyright © 2018 Adego et al.)

Published
2018
Full Text
View/download PDF

38. A COMPARISON OF SIMULATED JWST OBSERVATIONS DERIVED FROM EQUILIBRIUM AND NON-EQUILIBRIUM CHEMISTRY MODELS OF GIANT EXOPLANETS.

Author

Blumenthal SD, Mandell AM, Hébrard E, Batalha NE, Cubillos PE, Rugheimer S, and Wakeford HR

Abstract

We aim to see if the difference between equilibrium and disequilibrium chemistry is observable in the atmospheres of transiting planets by the James Webb Space Telescope (JWST). We perform a case study comparing the dayside emission spectra of three planets like HD 189733b, WASP-80b, and GJ436b, in and out of chemical equilibrium at two metallicities each. These three planets were chosen because they span a large range of planetary masses and equilibrium temperatures, from hot and Jupiter-sized to warm and Neptune-sized. We link the one-dimensional disequilibrium chemistry model from Venot et al. (2012) in which thermochemical kinetics, vertical transport, and photochemistry are taken into account, to the one-dimensional, pseudo line-by-line radiative transfer model, Pyrat Bay, developed especially for hot Jupiters, and then simulate JWST spectra using PandExo for comparing the effects of temperature, metallicity, and radius. We find the most significant differences from 4 to 5 μm due to disequilibrium from CO and CO 2 abundances, and also H 2 O for select cases. Our case study shows a certain "sweet spot" of planetary mass, temperature, and metallicity where the difference between equilibrium and disequilibrium is observable. For a planet similar to WASP-80b, JWST's NIRSpec G395M can detect differences due to disequilibrium chemistry with one eclipse event. For a planet similar to GJ 436b, the observability of differences due to disequilibrium chemistry is possible at low metallicity given five eclipse events, but not possible at the higher metallicity.

Published
2018
Full Text
View/download PDF

39. Identification of a Hypervirulent Pathotype of Rice yellow mottle virus: A Threat to Genetic Resistance Deployment in West-Central Africa.

Author

Hébrard E, Pinel-Galzi A, Oludare A, Poulicard N, Aribi J, Fabre S, Issaka S, Mariac C, Dereeper A, Albar L, Silué D, and Fargette D

Subjects
Africa, Central, Alleles, Disease Resistance, High-Throughput Nucleotide Sequencing, Oryza genetics, Oryza immunology, Plant Diseases immunology, Plant Viruses pathogenicity, Sequence Analysis, DNA, Virulence, Genetic Variation, Genome, Viral genetics, Oryza virology, Plant Diseases virology, Plant Viruses genetics, Viral Proteins genetics
Abstract

Rice yellow mottle virus (RYMV) causes high losses to rice production in Africa. Several sources of varietal high resistance are available but the emergence of virulent pathotypes that are able to overcome one or two resistance alleles can sometimes occur. Both resistance spectra and viral adaptability have to be taken into account to develop sustainable rice breeding strategies against RYMV. In this study, we extended previous resistance spectrum analyses by testing the rymv1-4 and rymv1-5 alleles that are carried by the rice accessions Tog5438 and Tog5674, respectively, against isolates that are representative of RYMV genetic and pathogenic diversity. Our study revealed a hypervirulent pathotype, named thereafter pathotype T', that is able to overcome all known sources of high resistance. This pathotype, which is spatially localized in West-Central Africa, appears to be more abundant than previously suspected. To better understand the adaptive processes of pathotype T', molecular determinants of resistance breakdown were identified via Sanger sequencing and validated through directed mutagenesis of an infectious clone. These analyses confirmed the key role of convergent nonsynonymous substitutions in the central part of the viral genome-linked protein to overcome RYMV1-mediated resistance. In addition, deep-sequencing analyses revealed that resistance breakdown does not always coincide with fixed mutations. Actually, virulence mutations that are present in a small proportion of the virus population can be sufficient for resistance breakdown. Considering the spatial distribution of RYMV strains in Africa and their ability to overcome the RYMV resistance genes and alleles, we established a resistance-breaking risk map to optimize strategies for the deployment of sustainable and resistant rice lines in Africa.

Published
2018
Full Text
View/download PDF

40. First Experimental Assessment of Protein Intrinsic Disorder Involvement in an RNA Virus Natural Adaptive Process.

Author

Charon J, Barra A, Walter J, Millot P, Hébrard E, Moury B, and Michon T

Subjects
Acclimatization genetics, Biological Evolution, Capsicum virology, Evolution, Molecular, Genome, Viral, Mutation genetics, Pilot Projects, Protein Stability, Proteome, RNA genetics, Ribonucleoproteins physiology, Viral Nonstructural Proteins physiology, Adaptation, Physiological genetics, Potyvirus genetics, Ribonucleoproteins genetics, Viral Nonstructural Proteins genetics
Abstract

Intrinsic disorder (ID) in proteins is defined as a lack of stable structure in physiological conditions. Intrinsically disordered regions (IDRs) are highly abundant in some RNA virus proteomes. Low topological constraints exerted on IDRs are expected to buffer the effect of numerous deleterious mutations and could be related to the remarkable adaptive potential of RNA viruses to overcome resistance of their host. To experimentally test this hypothesis in a natural pathosystem, a set of four variants of Potato virus Y (PVY; Potyvirus genus) containing various ID degrees in the Viral genome-linked (VPg) protein, a key determinant of potyvirus adaptation, was designed. To estimate the ID contribution to the VPg-based PVY adaptation, the adaptive ability of the four PVY variants was monitored in the pepper host (Capsicum annuum) carrying a recessive resistance gene. Intriguingly, the two mutants with the highest ID content displayed a significantly higher ability to restore infection in the resistant host, whereas the less intrinsically disordered mutant was unable to restore infection. The role of ID on virus adaptation may be due either to a larger exploration of evolutionary pathways or the minimization of fitness penalty caused by resistance-breaking mutations. This pioneering study strongly suggests the positive impact of ID in an RNA virus adaptive capacity., (© The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.)

Published
2018
Full Text
View/download PDF

41. Complete Genome Sequence of a New Strain of Rice yellow mottle virus from Malawi, Characterized by a Recombinant VPg Protein.

Author

Ndikumana I, Pinel-Galzi A, Fargette D, and Hébrard E

Abstract

The complete sequence of the isolate Mw10 of Rice yellow mottle virus was determined. Sequence comparisons revealed 8.4% to 10.7% nucleotide divergence from the published sequences, resulting in the definition of the strain S7. Importantly, a putative recombination event was identified encompassing the viral genome-linked protein involved in host adaptation., (Copyright © 2017 Ndikumana et al.)

Published
2017
Full Text
View/download PDF

42. Determinants of host species range in plant viruses.

Author

Moury B, Fabre F, Hébrard E, and Froissart R

Subjects
Genome, Viral, Phenotype, Plant Viruses genetics, Plants classification, Host Specificity, Plant Diseases virology, Plant Viruses physiology, Plants virology
Abstract

Prediction of pathogen emergence is an important field of research, both in human health and in agronomy. Most studies of pathogen emergence have focused on the ecological or anthropic factors involved rather than on the role of intrinsic pathogen properties. The capacity of pathogens to infect a large set of host species, i.e. to possess a large host range breadth (HRB), is tightly linked to their emergence propensity. Using an extensive plant virus database, we found that four traits related to virus genome or transmission properties were strongly and robustly linked to virus HRB. Broader host ranges were observed for viruses with single-stranded genomes, those with three genome segments and nematode-transmitted viruses. Also, two contrasted groups of seed-transmitted viruses were evidenced. Those with a single-stranded genome had larger HRB than non-seed-transmitted viruses, whereas those with a double-stranded genome (almost exclusively RNA) had an extremely small HRB. From the plant side, the family taxonomic rank appeared as a critical threshold for virus host range, with a highly significant increase in barriers to infection between plant families. Accordingly, the plant-virus infectivity matrix shows a dual structure pattern: a modular pattern mainly due to viruses specialized to infect plants of a given family and a nested pattern due to generalist viruses. These results contribute to a better prediction of virus host jumps and emergence risks.

Published
2017
Full Text
View/download PDF

43. Fine mapping of RYMV3: a new resistance gene to Rice yellow mottle virus from Oryza glaberrima.

Author

Pidon H, Ghesquière A, Chéron S, Issaka S, Hébrard E, Sabot F, Kolade O, Silué D, and Albar L

Subjects
Chromosome Mapping, Genetic Markers, Phenotype, Plant Diseases virology, RNA Viruses, Disease Resistance genetics, Genes, Plant, Oryza genetics, Plant Diseases genetics, Plant Viruses
Abstract

Key Message: A new resistance gene against Rice yellow mottle virus was identified and mapped in a 15-kb interval. The best candidate is a CC-NBS-LRR gene. Rice yellow mottle virus (RYMV) disease is a serious constraint to the cultivation of rice in Africa and selection for resistance is considered to be the most effective management strategy. The aim of this study was to characterize the resistance of Tog5307, a highly resistant accession belonging to the African cultivated rice species (Oryza glaberrima), that has none of the previously identified resistance genes to RYMV. The specificity of Tog5307 resistance was analyzed using 18 RYMV isolates. While three of them were able to infect Tog5307 very rapidly, resistance against the others was effective despite infection events attributed to resistance-breakdown or incomplete penetrance of the resistance. Segregation of resistance in an interspecific backcross population derived from a cross between Tog5307 and the susceptible Oryza sativa variety IR64 showed that resistance is dominant and is controlled by a single gene, named RYMV3. RYMV3 was mapped in an approximately 15-kb interval in which two candidate genes, coding for a putative transmembrane protein and a CC-NBS-LRR domain-containing protein, were annotated. Sequencing revealed non-synonymous polymorphisms between Tog5307 and the O. glaberrima susceptible accession CG14 in both candidate genes. An additional resistant O. glaberrima accession, Tog5672, was found to have the Tog5307 genotype for the CC-NBS-LRR gene but not for the putative transmembrane protein gene. Analysis of the cosegregation of Tog5672 resistance with the RYMV3 locus suggests that RYMV3 is also involved in Tog5672 resistance, thereby supporting the CC-NBS-LRR gene as the best candidate for RYMV3.

Published
2017
Full Text
View/download PDF

44. Mutations in Rice yellow mottle virus Polyprotein P2a Involved in RYMV2 Gene Resistance Breakdown.

Author

Pinel-Galzi A, Dubreuil-Tranchant C, Hébrard E, Mariac C, Ghesquière A, and Albar L

Abstract

Rice yellow mottle virus (RYMV) is one of the major diseases of rice in Africa. The high resistance of the Oryza glaberrima Tog7291 accession involves a null allele of the RYMV2 gene, whose ortholog in Arabidopsis , CPR5 , is a transmembrane nucleoporin involved in effector-triggered immunity. To optimize field deployment of the RYMV2 gene and improve its durability, which is often a weak point in varietal resistance, we analyzed its efficiency toward RYMV isolates representing the genetic diversity of the virus and the molecular basis of resistance breakdown. Tog7291 resistance efficiency was highly variable depending on the isolate used, with infection rates ranging from 0 to 98% of plants. Back-inoculation experiments indicated that infection cases were not due to an incomplete resistance phenotype but to the emergence of resistance-breaking (RB) variants. Interestingly, the capacity of the virus to overcome Tog7291 resistance is associated with a polymorphism at amino-acid 49 of the VPg protein which also affects capacity to overcome the previously studied RYMV1 resistance gene. This polymorphism appeared to be a main determinant of the emergence of RB variants. It acts independently of the resistance gene and rather reflects inter-species adaptation with potential consequences for the durability of resistance. RB mutations were identified by full-length or partial sequencing of the RYMV genome in infected Tog7291 plants and were validated by directed mutagenesis of an infectious viral clone. We found that Tog7291 resistance breakdown involved mutations in the putative membrane anchor domain of the polyprotein P2a. Although the precise effect of these mutations on rice/RYMV interaction is still unknown, our results offer a new perspective for the understanding of RYMV2 mediated resistance mechanisms. Interestingly, in the susceptible IR64 variety, RB variants showed low infectivity and frequent reversion to the wild-type genotype, suggesting that Tog7291 resistance breakdown is associated with a major loss of viral fitness in normally susceptible O. sativa varieties. Despite the high frequency of resistance breakdown in controlled conditions, this loss of fitness is an encouraging element with regards to RYMV2 resistance durability.

Published
2016
Full Text
View/download PDF

45. The Pale Orange Dot: The Spectrum and Habitability of Hazy Archean Earth.

Author

Arney G, Domagal-Goldman SD, Meadows VS, Wolf ET, Schwieterman E, Charnay B, Claire M, Hébrard E, and Trainer MG

Subjects
Atmosphere, Climate, Gases analysis, Models, Theoretical, Particle Size, Spectrophotometry, Ultraviolet, Temperature, Ultraviolet Rays, Water, Earth, Planet, Exobiology, Extraterrestrial Environment
Abstract

Recognizing whether a planet can support life is a primary goal of future exoplanet spectral characterization missions, but past research on habitability assessment has largely ignored the vastly different conditions that have existed in our planet's long habitable history. This study presents simulations of a habitable yet dramatically different phase of Earth's history, when the atmosphere contained a Titan-like, organic-rich haze. Prior work has claimed a haze-rich Archean Earth (3.8-2.5 billion years ago) would be frozen due to the haze's cooling effects. However, no previous studies have self-consistently taken into account climate, photochemistry, and fractal hazes. Here, we demonstrate using coupled climate-photochemical-microphysical simulations that hazes can cool the planet's surface by about 20 K, but habitable conditions with liquid surface water could be maintained with a relatively thick haze layer (τ ∼ 5 at 200 nm) even with the fainter young Sun. We find that optically thicker hazes are self-limiting due to their self-shielding properties, preventing catastrophic cooling of the planet. Hazes may even enhance planetary habitability through UV shielding, reducing surface UV flux by about 97% compared to a haze-free planet and potentially allowing survival of land-based organisms 2.7-2.6 billion years ago. The broad UV absorption signature produced by this haze may be visible across interstellar distances, allowing characterization of similar hazy exoplanets. The haze in Archean Earth's atmosphere was strongly dependent on biologically produced methane, and we propose that hydrocarbon haze may be a novel type of spectral biosignature on planets with substantial levels of CO 2 . Hazy Archean Earth is the most alien world for which we have geochemical constraints on environmental conditions, providing a useful analogue for similar habitable, anoxic exoplanets. Key Words: Haze-Archean Earth-Exoplanets-Spectra-Biosignatures-Planetary habitability. Astrobiology 16, 873-899., Competing Interests: Author Disclosure Statement No competing financial interests exist.

Published
2016
Full Text
View/download PDF

46. A hot Jupiter orbiting a 2-million-year-old solar-mass T Tauri star.

Author

Donati JF, Moutou C, Malo L, Baruteau C, Yu L, Hébrard E, Hussain G, Alencar S, Ménard F, Bouvier J, Petit P, Takami M, Doyon R, and Collier Cameron A

Abstract

Hot Jupiters are giant Jupiter-like exoplanets that orbit their host stars 100 times more closely than Jupiter orbits the Sun. These planets presumably form in the outer part of the primordial disk from which both the central star and surrounding planets are born, then migrate inwards and yet avoid falling into their host star. It is, however, unclear whether this occurs early in the lives of hot Jupiters, when they are still embedded within protoplanetary disks, or later, once multiple planets are formed and interact. Although numerous hot Jupiters have been detected around mature Sun-like stars, their existence has not yet been firmly demonstrated for young stars, whose magnetic activity is so intense that it overshadows the radial velocity signal that close-in giant planets can induce. Here we report that the radial velocities of the young star V830 Tau exhibit a sine wave of period 4.93 days and semi-amplitude 75 metres per second, detected with a false-alarm probability of less than 0.03 per cent, after filtering out the magnetic activity plaguing the spectra. We find that this signal is unrelated to the 2.741-day rotation period of V830 Tau and we attribute it to the presence of a planet of mass 0.77 times that of Jupiter, orbiting at a distance of 0.057 astronomical units from the host star. Our result demonstrates that hot Jupiters can migrate inwards in less than two million years, probably as a result of planet–disk interactions.

Published
2016
Full Text
View/download PDF

47. The biogeography of viral emergence: rice yellow mottle virus as a case study.

Author

Pinel-Galzi A, Traoré O, Séré Y, Hébrard E, and Fargette D

Subjects
Africa, Africa, Eastern, Africa, Western, Biological Evolution, Crops, Agricultural history, History, 19th Century, History, 20th Century, History, Ancient, Phylogeography, Plant Diseases history, Plant Viruses genetics, RNA Viruses genetics, RNA Viruses pathogenicity, Crops, Agricultural virology, Oryza virology, Plant Diseases virology, Plant Viruses physiology, RNA Viruses physiology
Abstract

Rice yellow mottle virus (RYMV) exemplifies the key role in plant virus emergence of the early steps of crop extension and intensification in traditional agriculture. In East Africa, RYMV emerged in the 19(th) century after rice intensification along the Indian Ocean coast, and later spread inland concomitantly with rice introduction. In West Africa, the contrasted history of rice cultivation among regions differently shaped RYMV populations. A biogeographical approach - which jointly considers the spatial distribution of the virus and its hosts over time - was applied to reach these conclusions. We linked the evolution of RYMV over the past two centuries to a geographical map of the history of rice cultivation in Africa., (Copyright © 2015 Elsevier B.V. All rights reserved.)

Published
2015
Full Text
View/download PDF

48. Emergence of rice yellow mottle virus in eastern Uganda: Recent and singular interplay between strains in East Africa and in Madagascar.

Author

Ochola D, Issaka S, Rakotomalala M, Pinel-Galzi A, Ndikumana I, Hubert J, Hébrard E, Séré Y, Tusiime G, and Fargette D

Subjects
Cluster Analysis, Evolution, Molecular, Lakes, Phylogeny, Plant Viruses classification, Plant Viruses genetics, RNA Viruses classification, RNA Viruses genetics, RNA, Viral genetics, Recombination, Genetic, Sequence Analysis, DNA, Sequence Homology, Uganda, Oryza virology, Plant Diseases virology, Plant Viruses isolation & purification, RNA Viruses isolation & purification
Abstract

Epidemics of rice yellow mottle virus (RYMV) have developed recently in eastern Uganda, close to Lake Victoria in East Africa. Unexpectedly, all isolates from the affected area belonged to a single strain (named S4ug), a strain that is different from the S4lv strain that has been prevalent in the Lake Victoria basin for the past five decades. Interestingly, the S4ug strain is most closely related at the genomic level (except ORF1) to the strain present in Madagascar (S4mg), 2000km away. The minor parent of the S4mg recombinant strain could not be detected. Molecular clock dating analysis indicated that the singular sequence of events - that associated the emergence of a new strain (S4ug), a modular recombination between closely related strains (S4mg and S4ug) and a long distance transmission (S4mg) - occurred recently, within the past few decades. This finding is at variance with the process of gradual strain dispersal and diversification over two centuries throughout Africa that was previously established., (Copyright © 2014 Elsevier B.V. All rights reserved.)

Published
2015
Full Text
View/download PDF

49. Alternative mutational pathways, outside the VPg, of rice yellow mottle virus to overcome eIF(iso)4G-mediated rice resistance under strong genetic constraints.

Author

Poulicard N, Pinel-Galzi A, Fargette D, and Hébrard E

Subjects
Eukaryotic Initiation Factor-4G genetics, Eukaryotic Initiation Factor-4G immunology, Genome, Viral, Oryza genetics, Oryza immunology, Plant Diseases genetics, Plant Diseases immunology, Plant Proteins genetics, Plant Proteins immunology, RNA Viruses immunology, Viral Proteins immunology, Mutation, Oryza virology, Plant Diseases virology, RNA Viruses genetics, Viral Proteins genetics
Abstract

The adaptation of rice yellow mottle virus (RYMV) to rymv1-mediated resistance has been reported to involve mutations in the viral genome-linked protein (VPg). In this study, we analysed several cases of rymv1-2 resistance breakdown by an isolate with low adaptability. Surprisingly, in these rarely occurring resistance-breaking (RB) genotypes, mutations were detected outside the VPg, in the ORF2a/ORF2b overlapping region. The causal role of three mutations associated with rymv1-2 resistance breakdown was validated via directed mutagenesis of an infectious clone. In resistant plants, these mutations increased viral accumulation as efficiently as suboptimal RB mutations in the VPg. Interestingly, these mutations are located in a highly conserved, but unfolded, domain. Altogether, our results indicate that under strong genetic constraints, a priori unfit genotypes can follow alternative mutational pathways, i.e. outside the VPg, to overcome rymv1-2 resistance.

Published
2014
Full Text
View/download PDF

50. First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo.

Author

Hubert JG, Pinel-Galzi A, Dibwe D, Cinyabuguma E, Kaboré A, Fargette D, Silué D, Hébrard E, and Séré Y

Abstract

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

Published
2013
Full Text
View/download PDF

Catalog

Books, media, physical & digital resources
See catalog results