Search

Background In acute myeloid leukemia (AML), internal tandem duplication mutations in the FLT3 tyrosine kinase receptor (FLT3-ITD) are associated with a dismal outcome. Although uncoordinated 51-like kinase 1 (ULK1), which plays a central role in the autophagy pathway, has emerged as a novel therapeutic target for various cancers, its role in FLT3-ITD AML remains elusive. In this study, we evaluated the effects of ULK1 inhibition on leukemia cell death in FLT3-ITD AML. Method We evaluated ULK1 expression and the levels of apoptosis and autophagy following ULK1 inhibition in FLT3-ITD AML cell lines and investigated the mechanism underlying apoptosis induced by ULK1 inhibition. Statistical analysis was performed using GraphPad Prism 4.0 (GraphPad Software Inc). Results FLT3-ITD AML cells showed significantly higher ULK1 expression than FLT3-wild-type (WT) AML cells. Two ULK1 inhibitors, MRT 68921 and SBI-0206965, induced apoptosis in FLT3-ITD AML cells, with relatively minimal effects on FLT3-WT AML cells and normal CD34-positive cells. Apoptosis induction by ULK1 inhibition was associated with caspase pathway activation. Interestingly, ULK1 inhibition paradoxically also induced autophagy, showing synergistic interaction with autophagy inhibitors. Hence, autophagy may act as a prosurvival mechanism in FLT3-ITD AML cells. FLT3-ITD protein degradation and inhibition of the ERK, AKT, and STAT5 pathways were also observed in FLT3-ITD AML cells following treatment with ULK1 inhibitors. Conclusion ULK1 is a viable drug target and ULK1 inhibition may represent a promising therapeutic strategy against FLT3-ITD AML.

Although TP53 mutations in acute myeloid leukemia (AML) are associated with poor response to venetoclax, the underlying resistance mechanism remains unclear. Herein, we investigated the functional role of dynamin-related protein 1 (DRP1) in venetoclax sensitivity in AML cells with respect to TP53 mutation status. Effects of DRP1 inhibition on venetoclax-induced cell death were compared in TP53-mutated (THP-1 and Kasumi-1) and TP53 wild-type leukemia cell lines (MOLM-13 and MV4-11), as well as in primary AML cells obtained from patients. Venetoclax induced apoptosis in TP53 wild-type AML cells but had limited effects in TP53-mutated AML cells. DRP1 expression was downregulated in MOLM-13 cells after venetoclax treatment but was unaffected in THP-1 cells. Cotreatment of THP-1 cells with venetoclax and a TP53 activator NSC59984 downregulated DRP1 expression and increased apoptosis. Combination treatment with the DRP1 inhibitor Mdivi-1 and venetoclax significantly increased mitochondria-mediated apoptosis in TP53-mutated AML cells. The combination of Mdivi-1 and venetoclax resulted in noticeable downregulation of MCL-1 and BCL-xL, accompanied by the upregulation of NOXA, PUMA, BAK, and BAX. These findings suggest that DRP1 is functionally associated with venetoclax sensitivity in TP53-mutated AML cells. Targeting DRP1 may represent an effective therapeutic strategy for overcoming venetoclax resistance in TP53-mutated AML.

Introduction Acquired haemophilia A (AHA) treatment involves the haemostatic treatment for acute haemorrhage and immunosuppressive therapy (IST) to eradicate FVIII inhibitory antibodies. Aim We assessed the clinical features of AHA and analysed treatment outcomes in Korea. We further identified prognostic factors affecting treatment outcomes. Methods Medical records of 55 patients with AHA from 18 institutions were reviewed retrospectively. Logistic and Cox regression analyses were performed to elucidate clinical factors affecting the achievement of complete remission (CR). The primary endpoint was time to CR after IST, and secondary endpoints were time to haemostasis, the achievement of CR, and overall survival (OS). Results Among the 55 patients, 50 (91%) had bleeding symptoms. Bleeding was severe in 74% of patients. Thirty-six (72%) patients received haemostatic therapy. Of the 42 patients who received IST, 23 (52%) received steroid alone, with a 52% response rate, and 10 (25%) received a combination of steroid and cyclophosphamide, with an 83% response rate. Five (16%) patients relapsed after a median duration of 220 days. There were eight deaths. In the Cox regression analysis, the FVIII inhibitor titre ≥ 20 BU/mL was the only significant prognostic factor affecting time to CR and haemostasis. No significant difference was observed in OS based on the inhibitor titre. Conclusion The present study demonstrated the demographic data of AHA in Korea and showed that FVIII inhibitory antibody titre was a predictor of time to achieve CR after IST.

Cytomegalovirus (CMV) infection is a major complication after allogeneic hematopoietic stem cell transplantation but is suggested to exert a strong antileukemia effect in part due to alterations in the composition of natural killer (NK) cells. We evaluated the impact of early CMV reactivation and changes in NK cell subset recovery on relapse rate and survival after haploidentical stem cell transplantation (haploSCT) for acute leukemia. Fifty patients with acute leukemia who received haploSCT were analyzed. Expression of T cells and specific receptors (NKG2A, NKG2D, DNAM1, and CD57) on circulating NK cells (CD56brightCD16dim/– or CD56dimCD16+ cells) was serially measured using multiparametric flow cytometry. CMV reactivation during the first 100 days was observed in 41 patients (82%) at a median of 23 days after haploSCT. The incidence of acute graft-versus-host disease (GVHD) and chronic GVHD tended to be higher in patients with CMV reactivation, although this difference was not statistically significant. Multivariate analysis showed that CMV reactivation (P = .011) and a dose of infused T cells > 3.2 × 108/kg (P = .027) were independent predictors of a reduced relapse risk and only CMV reactivation (P = .029) was an independent predictor of improved leukemia-free survival. CD56brightCD16dim/−DNAM1+NK cell counts increased from day 30 to 90 in patients with CMV reactivation but decreased after day 30 in patients without CMV reactivation. An increase in CD56brightCD16dim/−DNAM1+ NK cells was not associated with the occurrence of chronic GVHD but was associated with a reduced cumulative relapse rate (16.4% versus 58.0%, P = .019). Multivariate analysis indicates that an increase in the CD56brightCD16dim/−DNAM1+NK cell count was an independent predictor of reduced relapse risk. Our study demonstrates a significant correlation between low relapse rates and CMV reactivation as well as the recovery of CD56brightCD16dim/−DNAM1+ NK cells, providing valuable information for understanding the plausible immunologic mechanism of the graft-versus-leukemia effect.

Additional file 1: Figure S1. FLT3-ITD expression in FLT3-ITD-inducible U937 cell lines. Cell lysates were subjected to western blotting for FLT3-ITD expression of FLT3-ITD-inducible U937 cell lines (U937/FLT3-ITD #10, #11, #12, #13, #14, #15). GAPDH was used as a loading control. Figure S2. The effects of 3-MA on ULK1 inhibitor-induced FLT3 degradation in FLT3-ITD AML cells. (A) MV4;11 cells were treated with 2.5 μM of MRT 68921 for 24 h and fixed. Cells were stained for LC3B (green) and FLT3 (red) and observed by confocal microscopy. Nuclei were stained with DAPI. (B) MV4;11 cell lysates were subjected to western blotting for FLT3 expression after treatment of the cells with ULK1 inhibitor (MRT 68921; 2.5 μM), autophagy inhibitor (3-MA; 5 mM), or both for 48 h Figure S3. Unfolded protein response and ULK1 inhibition in FLT3-ITD AML cells. (A) MV4;11 and U937 cells were incubated with 2.5 μM of MRT 68921 for 24 h, and cell lysates were subjected to western blotting using antibodies against the indicated molecules (PERK, p-PERK, p-elF2a). α-Tubulin was used as a loading control. (B) MV4;11 cells were incubated with various concentrations of the PERK activator tunicamycin for 48 h. (C) The fraction of apoptotic cells in MV4;11 cells treated with MRT 68921 (0.5, 1, or 2.5 μM) in the presence or absence of tunicamycin (0.1 or 0.125 μg/ml) was analyzed by flow cytometry based on Annexin-V/PI exclusion. (D) The fraction of apoptotic cells in U937 cells treated with ULK1 inhibitors (MRT 68921; 2.5 μM, SBI-0206965; 5 μM) in the presence or absence of the PERK inhibitor GSK 2606414 (20 μM) was analyzed by flow cytometry based on Annexin-V/PI exclusion. Figure S4. Densitometry analyses on the entire western blot experiments. (A-C) Figure S5. Densitometry analyses on the entire western blot experiments. (D-H)

Additional file 2: Table S1. Effects of ULK1 inhibitors on phenotypes and apoptosis of primary acute myeloid leukemia FLT3 cells

Few studies have evaluated the risk factors for hepatic sinusoidal obstructive syndrome (SOS) in patients with malignant lymphoma receiving autologous stem cell transplantation (ASCT). We retrospectively analyzed 132 malignant lymphoma patients who underwent ASCT. Intravenous busulfan-based conditioning regimens were used in 108 (81.8%) patients. The combination of heparin and ursodeoxycholic acid was used for prophylaxis of SOS. Hepatic SOS was developed in 10 (7.6%) patients at a median of 30 days post-ASCT. In nine (90.0%) patients, SOS was diagnosed after 20 days post-ASCT. Two patients developed severe SOS and eventually died from multiple organ failure. In multivariate analysis, the use of the busulfan-thiotepa conditioning regimen (p = 0.003) and a high pre-transplant serum ferritin level (≥ 950 ng/mL) (p = 0.003) were risk factors for hepatic SOS. The evaluation of pre-transplant serum ferritin may be helpful in determining the most appropriate conditioning regimen with a lower risk of SOS.

Optimal treatment strategies for primary central nervous system lymphoma (PCNSL) have not been established. In this study, we investigated the treatment outcomes and prognostic factors of high-dose methotrexate, vincristine, and procarbazine (MVP) chemotherapy followed by an interim response-adapted intensification strategy in immunocompetent patients with PCNSL. We evaluated the evidence of infection with Epstein-Barr virus (EBV) in both brain tumor tissue and whole blood. Forty patients were retrospectively reviewed. Ten (25 %) patients who achieved complete response (CR) in the interim analysis did not receive any additional consolidation treatment after completion of planned high-dose MVP chemotherapy. Additional radiotherapy (n = 9) or autologous stem cell transplantation (ASCT) (n = 7) was performed in patients who did not achieve CR in the interim analysis. The median age was 55 years. The overall CR rate was 62.5 % (n = 25), and the objective response rate was 75.0 %. Two-year overall survival (OS) was 59.8 %, and 2-year progression-free survival was 47.1 %. Grade 3 or 4 neutropenia and thrombocytopenia occurred in 47.5 and 32.5 % of patients, respectively. Treatment-related mortality was 15.0 % (n = 6), and four patients developed delayed neurotoxicity. There was no evidence of EBV-encoded RNA expression in brain tumor tissue. Ten (29.4 %) of 34 patients showed detectable EBV-DNA in whole blood. Poor performance status and EBV-DNA positivity in whole blood were significantly associated with inferior OS (p = 0.032, p = 0.023, respectively). We suggest that high-dose MVP chemotherapy followed by an early response-adapted intensification strategy may be effective and minimize the number of patients who receive radiotherapy or ASCT in the early course of treatment.

Background The overexpression of Aurora A kinase (AurA) has been reported in various malignancies, including acute myeloid leukemia (AML). However, the expression of AurA and the effects of AurA inhibition in cancer stem cells are not yet fully understood. We investigated the expression and inhibition of AurA in AML stem cells (CD34+/CD38-). Methods Expression of AurA was investigated in cell lines (NB4 and KG1) that express high levels of CD34 and low levels of CD38. Primary AML cells were harvested from 8 patients. The expression of AurA and cell death induced by inhibition of AurA were analyzed in CD34+/CD38- cells. Results AurA was shown to be overexpressed in both primary AML cells and leukemia stem cells (LSCs) compared to normal hematopoietic stem cells. Inhibition of AurA plus cytarabine treatment in LSCs resulted in increased cytotoxicity compared to cytarabine treatment alone. Additional stimulation with granulocyte-colony stimulating factor (G-CSF) increased the cell death caused by AurA inhibition plus cytarabine treatment. Conclusion To our knowledge, this is the first report describing increased expression of AurA in LSCs. Our results suggest that selective AurA inhibition may be used to reduce LSCs, and this reduction may be enhanced by stimulation with G-CSF. Further exploration of relationship between nuclear factor kappa-B and AurA inhibition and the potential of AurA inhibition for use in leukemia treatment is needed.

Cytomegalovirus (CMV) disease is a major cause of infectious complications in allogeneic hematopoietic stem cell transplantation (allo-HSCT). Although patients undergoing allo-HSCT receive prophylactic and preemptive treatment for CMV, a subset of patients experience clinically significant CMV disease. This study investigated the risk factors for progression from CMV viremia to CMV disease during or after preemptive therapy in patients undergoing allo-HSCT. Between January 2006 and August 2010, 43 patients received preemptive therapy for CMV viremia after allo-HSCT. These patients experienced 74 episodes of CMV viremia. Nine of the patients (21%) and 12 of the episodes (16%) progressed to CMV disease. Univariate analysis identified several risk factors for progression to CMV disease, including high initial viral load (P = .020), leukopenia (P = .012), and neutropenia (P = .033) at the time of detection of CMV viremia. On multivariate analysis, leukopenia remained an independent predictor (hazard ratio, 4.347; P = .045). The rate of failure to clear CMV viremia after 1 cycle of preemptive therapy was higher in the leukopenia group than in the non-leukopenia group (60.0% versus 16.9%; P = .002). This indicates that leukopenia initially documented with CMV viremia is related to lower viral response to preemptive therapy and is a notable risk factor for progression from CMV viremia to CMV disease.

Background BAFF (B cell-activating factor) and APRIL (a proliferation-inducing ligand) are members of the tumor necrosis factor family and promote B cell survival and proliferation. We evaluated the correlation between serum concentration of BAFF or APRIL and severity of acute graft-versus-host disease (GVHD). Methods Fifteen patients who received allogeneic hematopoietic stem transplantation for leukemia and developed acute GVHD were enrolled. We determined serum concentrations of BAFF and APRIL at the onset of the first clinical manifestation of GVHD by enzyme-linked immunosorbent assay. Results Nine patients had grade 2 acute GVHD, and 6 had grade 3-4 acute GVHD. The BAFF serum concentration was higher in patients with grade 3-4 acute GVHD (1,093.42 in grade 2 vs. 2,171.99 pg/mL in grade 3-4), although the difference was not significant (P=0.077). However, the ratio of BAFF serum concentration to absolute lymphocyte count (ALC) (BAFF/ALC) was significantly higher in patients with grade 3-4 acute GVHD (P=0.045). The APRIL serum concentration and APRIL/ALC ratio showed similar results (P=0.077 and P=0.013, respectively). Conclusion Patients with grade 3-4 acute GVHD had higher BAFF/ALC and APRIL/ALC ratios than patients with grade 2 acute GVHD. These findings suggest that B cells might play an important role in the development of acute GVHD, and that the BAFF and APRIL concentrations in serum might be significant predictive factors for estimating the severity of acute GVHD. Their clinical significance should be further evaluated in a larger patient population.

Identification of biomarkers that predict responses to hypomethylating agents (HMAs) will allow optimal strategies for epigenetic therapy in myelodysplastic syndromes (MDS) to be established. Serum miR-21 was quantitatively measured in 58 MDS patients treated with HMAs and 14 healthy controls. Serum miR-192 was an internal control, and diagnostic performance was evaluated according to receiver operating characteristics (ROCs). ROC analysis indicated that serum miR-21 levels differentiated responders from non-responders with an area under the curve of 0.648 (95% confidence, 0.49 to 0.72). The baseline level of serum miR-21 was significantly lower in the responder group than in the non-responder group (P = 0.041). The overall response rate (ORR) of the high miR-21 group was significantly lower than that of the low miR-21 group (41.2 vs. 73.2%, P = 0.021). Progression-free survival (PFS) was significantly inferior in the high group versus the low group (14.0 vs. 44.5 months, P = 0.001). Multivariate analyses revealed that the initial serum miR-21 level (P = 0.001) and circulating blasts (P = 0.007) were prognostic factors for PFS. Serum miR-21 level was significantly associated with ORR and PFS in MDS patients treated with HMAs. Although validation with a large prospective study is required, serum miR-21 is a potential biomarker of epigenetic therapy in MDS patients.

Purpose The modified Glasgow Prognostic Score (mGPS) consisting of serum C-reactive protein and albumin levels, shows significant prognostic value in several types of tumors. We evaluated the prognostic significance of mGPS in 285 patients with diffuse large B cell lymphoma (DLBCL), retrospectively. Materials and methods According to mGPS classification, 204 patients (71.5%) had an mGPS of 0, 57 (20%) had an mGPS of 1, and 24 (8.5%) had an mGPS of 2. Results Our study found that high mGPS were associated with poor prognostic factors including older age, extranodal involvement, advanced disease stage, unfavorable International Prognostic Index scores, and the presence of B symptoms. The complete response (CR) rate after 3 cycles of R-CHOP chemotherapy was higher in patients with mGPS of 0 (53.8%) compared to those with mGPS of 1 (33.3%) or 2 (25.0%) (p=0.001). Patients with mGPS of 0 had significantly better overall survival (OS) than those with mGPS=1 and those with mGPS=2 (p=0.036). Multivariate analyses revealed that the GPS score was a prognostic factor for the CR rate of 3 cycle R-CHOP therapy (p=0.044) as well as OS (p=0.037). Conclusion mGPS can be considered a potential prognostic factor that may predict early responses to R-CHOP therapy in DLBCL patients.

Background The aim of this study is to identify risk factors associated with the development of severe bacterial infection (SBI) in patient with multiple myeloma (MM) during treatment with bortezomib-containing regimens. Methods A total of 98 patients with MM who were treated with bortezomib-based treatment between 2006 and 2012 were analyzed. Fifty three patients received bortezomib-dexamethasone, 25 patients received bortezomib-melphalan-prednisolone, 15 patients received bortezomib-doxorubicin-dexamethasone and 5 patients received other regimens. They received a total of 427 courses of treatment. The SBI was defined as at least grade 3 neutropenic/non-neutropenic infection by NCI Common Terminology Criteria for Adverse Events version 4.0. Using the logistic regression method, we analyzed risk factors for the development of SBI during each course of treatment. Results Median age of the patients was 62 years and 40.6% (30/98) of patients treated with bortezomib-containing regimens as first-line therapy. The SBI was developed in 57% (56/98) of patients and 19% (81/427) of bortezomib courses. Among 81 episodes of SBI, 42 (53%) episodes were clinically documented infection, 30 (37%) were microbiologically documented infections, and 9 (11%) were fever of unknown origin. The most common type of infection was pneumonia (60%). Poor performance status (ECOG ≥2) (Hazard Ratio [HR] 5.365, 95% Confidence Interval [CI] 2.004-14.364, P =.001) was the only risk factor for the development of SBI in 98 patients. When we analyzed the risk factors for the development of SBI which occurred during each treatment course, poor performance status (ECOG ≥2) (P Conclusions In conclusion, we identified that poor performance status, early courses of treatment, and lymphopenia at the beginning of each treatment course were the risk factors for the development of SBI in patients with MM during treatment with bortezomib-containing regimens. Close monitoring for the development of SBI and appropriate treatment should be considered in the patients with risk factors. Disclosures: No relevant conflicts of interest to declare.

Background Physical and functional status affect the survival after allogeneic stem cell transplantation. There are several indices to measure risk of complication and non-relapse mortality after stem cell transplantation. Karnofsky score and ECOG score are the mostly used indices for measuring functional status. However they are measured subjectively by observer and can be changed in brief time. Recently a few reports documented relationship between the mortality and sarcopenia in various malignant or non-malignant diseases. Therefore we tried to measure the patient’s functional status by measuring psoas area in abdominal CT scan which was taken before allogeneic stem cell transplantation. Patients and Methods The medical records of total 83 patients from August 2010 to April 2012 were retrospectively reviewed. Every patients took abdominal CT scan 2 weeks to 1 month before transplantation according to the protocol for pre-transplant workup of Severance Hospital (Seoul, Korea). The area of bilateral psoas muscle at the level of upper margin of L4 vertebral body was manually measured by one trained observer using polygon tool of CENTRICITY Radiology RA1000 program (GE Healthcare Integrated IT Solutions, IL, USA). Results Male patients were 49 and female patients were 34. Median age was 37.0 years (range 15-60). Underlying diagnosis was AML (n=31), ALL (n=24), SAA (n=7), MDS (n=5), lymphoma (n=7), CML (n=6) and others (n=3). Myeloablative conditioning was applied in 54 patients. Stem cell source was mostly peripheral blood (n=68). 8 patients received HLA-mismatched transplantation. The total non-relapse mortality was 20.4%. 32.5% of patients had higher BMI than 25 kg/m2. In whole patients, psoas muscle area didn’t affect non-relapse survival. However, when low psoas area/BMI ratio show significant correlation with non-relapse survival (median 733 days vs. 966 days, P=0.009). In univariate analysis for non-relapse survival, age, pre-transplant disease status, and psoas/BMI ratio showed statistical correlation. And in multivariate analysis psoas/BMI ratio was the sole prognostic index. Summary Low psoas/BMI ratio is related to increased treatment related mortality in obese patients. This index can be used in part to estimate risk of transplant in obese patients. Disclosures: No relevant conflicts of interest to declare.

Background Serum free light chain (FLC) assay has been used to evaluate the prognosis of several hematologic malignancies. We evaluated the prognostic role of monoclonal gammopathy (MG) and polyclonal gammopathy (PG) measured by serum FLC and immunofixation (IF) in DLBCL. Patients and methods We retrospectively reviewed 115 patients with DLBCL who treated with rituximab containing chemotherapy. MG was defined as elevated kappa (κ) or lambda (λ) FLC with abnormal κ to λ ratio or positive IF and PG was defined as elevated κ and/or λ FLC with normal κ to λ ratio and negative IF. Results Fifty-six (48.7%) patients had an elevated FLC. Twenty (17.4%) patients had MG and 39 (33.9%) patients accompanied by a PG. Two-year overall survival (OS) was 89.2%, and 2-year event-free survival (EFS) was 88.4%. Elevated FLC was associated with inferior OS and EFS (p=0.013, p=0.012). Patients with MG had an inferior OS and EFS compared to patients with normal FLC (p=0.006, p=0.011). In multivariate analysis, both elevated FLC and MG showed the significance for OS (HR 4.57, 95% CI 1.43-14.60, p=0.001 and HR 5.63, 95% CI 1.50-21.09, p=0.010). Elevated FLC did not show the significantly shorter OS or EFS in non-germinal center B-cell (GCB) type according to the Han’s criteria. However, MG was a significant prognostic factor for OS and EFS in non-GCB type (HR 6.28, 95% CI 1.21-32.62, p=0.029, HR 6.38, 95% CI 1.58-25.74, p=0.009). Conclusion It important to evaluate the associated MG and PG using serum FLC and IF for predicting the prognosis of DLBCL, especially in non-GCB subtype. Disclosures: No relevant conflicts of interest to declare.

Background Only a few patients who experience AML relapse derive lasting benefit from re-induction therapy. The utility of reassessing the disease karyotype at relapse is unclear. The main goals of this study were to identify prognostic factors for AML relapse and to determine the prognostic utility of karyotypic change between diagnosis and relapse as a variable for predicting response to salvage therapy for relapsed AML. Methods This retrospective study included 58 patients with relapsed AML treated at the Yonsei University College of Medicine between 2005 and 2010. Karyotypes at both diagnosis and relapse were available for 45 patients (77%). A change in karyotype at relapse was observed in 17 of 45 cases (37%), and no change was noted in 28 of 45 cases (62%). Results Karyotypic changes between diagnosis and relapse were associated with the response rate (RR) to salvage therapy (P=0.016). Overall survival (OS) and event-free survival (EFS) in the group with karyotypic changes between diagnosis and relapse were significantly different from those with no karyotypic changes (P=0.004 and P=0.010, respectively). We applied multiple multivariate Cox regression analyses to identify independent prognostic factors for overall response (OR), OS, and EFS. A change in karyotype between diagnosis and relapse was significantly associated with OS (P=0.023; RR=2.655) and EFS (P=0.033; RR=2.831). Conclusion Karyotypic changes between the diagnosis and relapse of AML could be used to predict outcomes and tailor clinical and biological therapeutic strategies for relapsed AML patients.

Abstract 4161 Introduction: Traditionally T cells were recognized as main effector of acute graft-versus-host disease. Many studies revealed that grafted T cell dose and activity or repertoire development of T cell is related to GVHD. Recently, the role of B-cells in pathogenesis of acute GVHD is actively investigated. BAFF and APRIL is known to be related to increased activity of many autoimmune diseases. APRIL (a proliferation-inducing ligand) is a cytokine of the tumor necrosis factor superfamily secreted by myeloid cells, dendritic cells and T cells. We studied on serum level of APRIL at early transplantation period for investigation of relationship between APRIL concentration and risk of acute GVHD. Materials and Methods: Forty-six patients who received HLA-matched sibling allogeneic stem cell transplantation in Severance Hospital From September 2003 to September 2009 with remaining stored blood samples were selected. Blood samples were collected at day 0 and day 14. After clot formation, sera were separated at 1,000 g for 3 minutes then stored at -80°C for analysis. Samples were measured by commercial ELISA kit for APRIL (Bender MedSystems, Vienna, Austria) according to the manufacturer's recommendations. Grading of acute GVHD followed IBMTR severity index. Result: Age at transplantation ranged from 16 to 52 years(median 35.5 yrs). Bone marrow was used in 7 patients (15.2%) and PB in 39(84.8%). Myeloablative conditioning regimen was used in 18 patients (39.1%) and total body irradiation in 6 patients (13.0%), 28 patients used reduced intensity conditioning regimens. Disease status at SCT was CR 29 patients (63%), non-CR 14(30.4%). Incidence of all grade of acute GVHD was 56.5% (26 patients) and incidence of aGVHD exceeding grade 1 was 34.8% (16 patients). Serum APRIL concentration ranged from 1.859 to 6.219 (median 3.101 ng/mL) for day0 sera and 1.822 to 15.507 (median 3.683 ng/mL) for day14 sera. Patients with higher level than median concentration showed correlation with increased tendency of acute GVHD by χ2 test in both day 0 (P=0.021) and day 14 (P=0.147). And then, patients were divided into two groups, one group included patients with steady higher level than median in both day 0 and day 14 (group1), while the others constituted group2. By χ2 test, group 1 showed correlation with acute GVHD (P=0.037). In multivariate analysis, conditioning intensity, donor-patient sex mismatch, stem cell dose, CD3+ cell dose, donor parity were included with steady higher APRIL level as variables. Higher APRIL was strongest variable for increased risk of acute GVHD (hazard ratio 64.67, P=0.005). Conclusion: Our data suggest that higher level of APRIL at early phase of allogeneic stem cell transplantation with HLA-matched sibling donor can be used as predictor of acute GVHD. Confirm of our hypothesis should be done also in larger patient data including alternative donors. Disclosures: No relevant conflicts of interest to declare.

Abstract 2719 The aim of this study was to evaluate treatment outcomes and prognostic factors of high-dose MVP (methotrexate, vincristine and procarbazine) chemotherapy and response adapted intensification therapy in primary central nervous system lymphoma (PCNSL). We evaluated the expression of Epstein-Barr virus (EBV)-encoded RNA in tissue and pretreatment EBV-DNA in whole blood. Forty patients with PCNSL who treated with high-dose MVP chemotherapy were retrospectively reviewed. Additional radiotherapy or autologous stem cell transplantation were performed for the patients who could not achieve complete response (CR) at interim response (Figure 1). The median age was 55 years. CR rate was 50.0% and objective response rate was 80.0%. Two-year overall survival (OS) was 59.8% and 2-year progression free survival (PFS) was 47.1%. Grade 3 or 4 neutropenia was seen in 19 of 40 (47.5%) patients and thrombocytopenia was developed in 13 (32.5%) patients. Treatment-related mortality was occurred in 4 patients. Delayed neurotoxicity was occurred in 4 patients. Poor performance status, elevated cerebrospinal fluid protein level and whole blood EBV-DNA positivity showed inferior OS (P=0.036, P=0.022, P=0.013, respectively, Figure 2). We detected whole blood EBV-DNA in 10 (29.4%) of 34 patients. It was related with poor OS and PFS in high risk patients according to International Extranodal Lymphoma Study Group scores (P=0.015, P=0.027, respectively). This study suggests that high-dose MVP chemotherapy without intrathecal chemotherapy and response adapted strategy may be an effective regimen for the newly diagnosed PCNSL. Whole blood EBV-DNA positivity could predict the inferior outcome in high-risk patients. Figure 1: Treatment scheme HD-MVP high dose methotrexate, vincristine and procarbazine, CR complete response, CRu unconfirmed complete response, PR partial response, SD stable disease, PD progressive disease, Tx treatment, NE not evaluated, ASCT autologous hematopoietic stem cell transplantation, RT radiotherapy Figure 1:. Treatment scheme HD-MVP high dose methotrexate, vincristine and procarbazine, CR complete response, CRu unconfirmed complete response, PR partial response, SD stable disease, PD progressive disease, Tx treatment, NE not evaluated, ASCT autologous hematopoietic stem cell transplantation, RT radiotherapy Figure 2: Overall survival and progression free survival according to EBV-DNA status in high risk patients. EBV Epstein-Barr virus Figure 2:. Overall survival and progression free survival according to EBV-DNA status in high risk patients. EBV Epstein-Barr virus Disclosures: No relevant conflicts of interest to declare.

Abstract 4495 Background Stem cell fate is influenced by specialized microenvironments called as stem cell niche. Osteoblasts are considerd to play very important role in stem cell niche. They are activated by parathyroid hormone (PTH) or PTH related protein through PTH/PTHrP receptor and produce hematopoietic growth factors. In few large animal studies PTH treatment after hematopoietic stem cell transplantation (HSCT) improved post-transplant platelet count and CD4 lymphocyte count. Effect of PTH on cord blood stem cell transplantation to improve engraftment is under clinical trial. Therefore, authors investigated on correlation between pre-transplant serum PTH level and platelet recovery after allogeneic HSCT. Methods From January 2008 to December 2009, we measured pre-transplant serum PTH, ferritin of 28 patients who underwent allogeneic HSCT. Post-transplant platelet was checked at the point of post-transplant 14 days, 30 days, 60 days, 90 days and 180days. Surveillance of cytomegalovirus was done by weekly or biweekly CMV-PCR assay. Acute graft-versus-host disease (GVHD) was graded by IBMTR classification and chronic GVHD by NIH scoring system. Results Five patients received graft from partially matched donors and the others from fully matched donors, 15 from unrelated and 13 from related donors. Nineteen patients were in high risk at diagnosis. Nonmyeloablative conditioning was applied to 7 patients. Only 1 patient used bone marrow as stem cell source. Median dose of infused stem cell was 5.7×10∧6/kg (range 1.68 – 12.74). All patients were successfully engrafted. Acute GVHD more than grade 2 occurred in 15, and chronic GVHD more than moderate degree in 7. Five patients relapsed and 15 patients died of relapse or treatment related mortality. Pre-transplant serum PTH had no correlation with platelet count recovery. There was no correlation with pre-HSCT PTH and acute or chronic GVHD. However patient with lower PTH level had tendency to more frequent CMV reactivation (P=0.098). Conclusion Our hypothesis was that higher pre-transplant PTH would be related to better platelet recovery but failed to find correlation between two of them. There are various factors which affect engraftment and graft function. Role of PTH for engraftment should be evaluated in larger number of cases. Disclosures: No relevant conflicts of interest to declare.

Abstract 3804 Prognostic factors for response and survival in patients with myelodysplastic syndromes (MDS) treated with azacitidine (AZA) remain largely unknown. Identification of molecular biomarkers in MDS is needed to predict clinical outcomes and help stratify MDS patients for epigenetic therapy. MicroRNA(miR)-21 has been recognized to be implicated in carcinogenesis, resistance to chemotherapy, and regulation of DNA methylation. A several prognostic studies found that a higher miR-21 expression was significantly associated with advanced diseases and worse outcomes in a variety of cancers. MicroRNA profiling of circulating tumor exosomes could potentially be used as surrogate diagnostic markers. Therefore, we evaluated the expression level of miR-21 in exosomes isolated from sera of patients with MDS and analyzed the association between exosomal miR-21 level and the response to AZA treatment and prognosis. Among 63 MDS cases enrolled in this study, WHO classification was RA/RARS in 19.1%, RCMD in 31.7%, RAEB-1 in 19.1%, RAEB-2 in 19.1%, and MDS-U in 11.0%. IPSS risk group was low in 7.5%, intermediate-1 in 60.3%, intermediate-2 in 28.6%, and high in 3.2%. AZA was administered subcutaneously with an initial dose of 75 mg/m2/day for 7 days every 28 days. Patients received AZA for a median of 6 cycles (range, 1–12). Response was evaluated after 4 cycles of AZA by blood count, marrow study, and cytogenetic analysis. CR, PR, marrow CR, stable disease (SD), hematologic improvement (HI), and progression were defined according to IWG 2006 criteria. Total RNA was isolated from exosomes, which were obtained from patients' serum using the Exoquick exosome precipitation solution. Serum was obtained at initial diagnosis, and after 4th, 8th cycles of AZA treatment. Quantitative RT-PCR was performed using SYBRRRT-PCR method. miR-21 primer was: forward GCCCGCTAGCTTATCAGACTGATG, reverse GTGCAGGGTCCGAGGT. RNU6B was taken as reference gene for exosomal miR normalization. Relative level of the circulating miR-21 was determined using the comparative CT (2−ΔΔCT) formula. With AZA treatment, the overall response rate was 58.7% (CR in 9.5%, PR in 3.2%, and HI in 46.0%). Baseline level of serum exosomal miR-21 was significantly higher in MDS patients compared with healthy volunteers (p Disclosures: No relevant conflicts of interest to declare.

Posttransplant lymphoproliferative disorder (PTLD) is a group of heterogeneous lymphoid diseases that cause serious complications after organ or stem cell transplantation. The onset of PTLD is mostly due to EBV infection-induced B-cell proliferation and a defect in cytotoxic T cell function that occurs with immunosuppression. The usual treatment strategy for PTLD is reduction or withdrawal of immuno- suppressive drugs with or without the administration of antiviral agents. Recently, various studies on the efficacy of rituximab or chemotherapy have been reported. We report two cases of rapidly progressing and complicated PTLDs after kidney transplantation that were successfully treated with a combination regimen consisting of rituximab, cyclophosphamide, adriamycin, vincristine and prednisolone (R-CHOP).

Introduction: The myelodysplastic syndrome (MDS) is frequently associated with various chromosomal abnormalities. ‘5q− syndrome’ is low-risk MDS known as good responder of lenalidomide recently. However, the patients with other abnormalities in chromosome 5 showed quite different clinical features from those with ‘5q− syndrome’. The aim of this study was a retrospective evaluation for Korean MDS patients with abnormalities in chromosome 5 other than ‘5q− syndrome’. Materials and Methods: Among 456 patients with MDS diagnosed at 16 hospitals in Korea between 1996 and 2006, 370 with available cytogenetic data entered the study. Univariate and multivariate analysis were performed. Results: Ninety three patients (25.1%) showed abnormalities in chromosome 5 and the ‘5q− syndorme’ was only 10 patients (2.7%). Among the rest, 39 patients (10.5%) had various abnormalities other than 5q deletion such as translocation or 5 monosomy, 38 (10.3%) had complex abnormalities with 5q−, and 2 had mosaic pattern with normal chromosome. Four patients had isolated 5q− but blasts in marrow were over 5%. The deletion of 5q was interstitial but with a predominance for 5q13-33 deletions (34.8%). MDS patients with chromosome 5 abnormalities other than ‘5q− syndrome’ didn’t share the clinical features with ‘5q− syndrome’. There was no leukemic transformation in ‘5q− syndrome’ group, but 18 (21.7%) with other abnormalities in chromosome 5 finally transformed to acute leukemia. Five year overall survival was significantly inferior in non-’5q− syndrome’ patients than ‘5q− syndrome’ (14.3% vs. 79.6%, P=0.0115). Conclusions: Patients with isolated 5q− and excess blast (>5%), other abnormalities than isolated 5q−, or mosaic chromosome with isolated 5q− and normal chromosome didn’t share the clinical features such as lower rate of leukemic transformation and long survival.