Search

Background: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the "MECP2" gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. Methods: We report here the molecular study of two isoforms, "MECP2_e1" and "MECP2_e2", in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. Results: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. Conclusion: Genotype/phenotype correlation is discussed and the importance of a molecular study of "MECP2" gene in patients with very mild features or a regression after the age of 2 is raised.

Reports on the assignment of a new congenital fibrosis of extraocular muscles type 3 (CFEOM3) locus. Characterization of congenital cranial dysinnervation disorders by ophthalmoplegia and ptosis; Exploration of three generation family in which members are affected with autosomal dominant CFEOM3; Propositions that a gene was interrupted by one of the breakpoints and caused the phenotype.

Abstract Background Familial mediterranean fever (FMF) is a recessively inherited disease characterized by recurrent crises of fever, abdominal, articular and/or thoracic pain. The most severe complication is the development of renal amyloidosis. Over 35 mutations have been discovered so far in the gene responsible for the disease, MEFV. This article aims at determining a correlation between the MEFV genotype and the occurence of amyloidosis in FMF patients, in addition to the study of the modifying effects of the SAA1 (type 1 serum amyloid A protein) and MICA (Major Histocompatibility Complex (MHC) class-I-chain-related gene A) genes on this severe complication. Methods Fourteen MEFV mutations were screened and the SAA1 and MICA polymorphisms tested in 30 FMF patients with amyloidosis and 40 FMF patients without amyloidosis. Results The M694V and V726A allelic frequencies were, respectively, significantly higher and lower in the group with amyloidosis, compared to the control FMF group. The beta and gamma SAA1 alleles were more frequently encountered in the group without amyloidosis, whereas the alpha allele was significantly more observed in FMF patients with amyloidosis (p < 0.025). All the MICA alleles were encountered in both patients' groups, but none of them was significantly associated with amyloidosis. Conclusions The results suggest a protective effect of the SAA1 beta and gamma alleles on the development of amyloidosis and show the absence of a MICA modifying effect on amyloidosis development. Testing these polymorphisms on a larger sample will lead to more definite conclusions.

Endophilin A2, the sole endophilin A family member expressed in hematopoietic cells, regulates various aspects of membrane dynamics, including autophagy and endocytosis. Recent studies in rodents highlight the essential role of endophilin A2 in modulating immune responses. Here we report a homozygous frameshift variant in the SH3GL1 gene (NM&#95;003025.3:c.427delC; p.Leu143Serfs*9), detected by whole exome sequencing in a 14-year-old boy with predominantly antibody deficiency. The patient who is issued from a consanguineous Lebanese family, presents since the age of 18 months with recurrent respiratory tract infections, low peripheral B cell counts and pan-hypogammaglobulinemia, with no history of opportunistic infections. This defect is associated with decrease in switched memory B cells development, impaired in-vitro B cell proliferation and diminished in-vitro IgG production. The detected variant in SH3GL1 segregates with the disease in the family. It significantly decreases the expression of the protein in the patient's peripheral blood compared to healthy controls, thus confirming its pathogenicity. Interestingly, endophilin A2-deficient Sh3gl1 -/- mice have been reported to present defects in germinal center B cell responses and in the production of high-affinity IgG. Our data suggests that endophilin A2 deficiency impairs antibody production in humans. Reporting further cases with mutations in SH3GL1 is needed to better characterize the inborn error of immunity linked to this gene., (© 2024. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.)

Store-operated calcium entry (SOCE) plays a crucial role in maintaining cellular calcium homeostasis. This mechanism involves proteins, such as stromal interaction molecule 1 (STIM1) and ORAI1. Mutations in the genes encoding these proteins, especially STIM1, can lead to various diseases, including CRAC channelopathies associated with severe combined immunodeficiency. Herein, we describe a novel homozygous mutation, NM&#95;003156 c.792-3C > G, in STIM1 in a patient with a clinical profile of CRAC channelopathy, including immune system deficiencies and muscle weakness. Functional analyses revealed three distinct spliced forms in the patient cells: wild-type, exon 7 skipping, and intronic retention. Calcium influx analysis revealed impaired SOCE in the patient cells, indicating a loss of STIM1 function. We developed an antisense oligonucleotide treatment that improves STIM1 splicing and highlighted its potential as a therapeutic approach. Our findings provide insights into the complex effects of STIM1 mutations and shed light on the multifaceted clinical presentation of the patient., Competing Interests: Declaration of competing interest None., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

BRAT1 biallelic variants are associated with rigidity and multifocal seizure syndrome, lethal neonatal (RMFSL), and neurodevelopmental disorder associating cerebellar atrophy with or without seizures syndrome (NEDCAS). To date, forty individuals have been reported in the literature. We collected clinical and molecular data from 57 additional cases allowing us to study a large cohort of 97 individuals and draw phenotype-genotype correlations. Fifty-nine individuals presented with BRAT1-related RMFSL phenotype. Most of them had no psychomotor acquisition (100%), epilepsy (100%), microcephaly (91%), limb rigidity (93%), and died prematurely (93%). Thirty-eight individuals presented a non-lethal phenotype of BRAT1-related NEDCAS phenotype. Seventy-six percent of the patients in this group were able to walk and 68% were able to say at least a few words. Most of them had cerebellar ataxia (82%), axial hypotonia (79%) and cerebellar atrophy (100%). Genotype-phenotype correlations in our cohort revealed that biallelic nonsense, frameshift or inframe deletion/insertion variants result in the severe BRAT1-related RMFSL phenotype (46/46; 100%). In contrast, genotypes with at least one missense were more likely associated with NEDCAS (28/34; 82%). The phenotype of patients carrying splice variants was variable: 41% presented with RMFSL (7/17) and 59% with NEDCAS (10/17)., (© 2023. The Author(s), under exclusive licence to European Society of Human Genetics.)

Combined immunodeficiency diseases (CID) represent the most severe forms of inborn errors of immunity. Defective T cell development and/or function, leading to an impairment in adaptive immunity are responsible for these diseases. The DNA polymerase δ complex is important for genome duplication and maintenance and consists of the catalytic subunit POLD1, and the accessory subunits POLD2 and POLD3 which stabilizes the complex. Mutations in POLD1 and POLD2 have been recently shown to be associated with a syndromic CID characterized by T cell lymphopenia with or without intellectual deficiency and sensorineural hearing loss. Here we report a homozygous POLD3 variant (NM&#95;006591.3; p.Ile10Thr) in a Lebanese patient, the product of a consanguineous family, presenting with a syndromic severe combined immunodeficiency (SCID) with neurodevelopmental delay and hearing loss. The homozygous POLD3 Ile10Thr variant abolishes POLD3 as well as POLD1 and POLD2 expression. Our findings implicate POLD3 deficiency as a novel cause of syndromic SCID., Competing Interests: Declaration of Competing Interest None., (Copyright © 2023 Elsevier Inc. All rights reserved.)

Charcot-Marie-Tooth (CMT) disease is one of the most common inherited neurological disorders, affecting either axons from the motor and/or sensory neurons or Schwann cells of the peripheral nervous system (PNS) and caused by more than 100 genes. We previously identified mutations in FGD4 as responsible for CMT4H, an autosomal recessive demyelinating form of CMT disease. FGD4 encodes FRABIN, a GDP/GTP nucleotide exchange factor, particularly for the small GTPase Cdc42. Remarkably, nerves from patients with CMT4H display excessive redundant myelin figures called outfoldings that arise from focal hypermyelination, suggesting that FRABIN could play a role in the control of PNS myelination. To gain insights into the role of FGD4/FRABIN in Schwann cell myelination, we generated a knockout mouse model (Fgd4SC-/-), with conditional ablation of Fgd4 in Schwann cells. We show that the specific deletion of FRABIN in Schwann cells leads to aberrant myelination in vitro, in dorsal root ganglia neuron/Schwann cell co-cultures, as well as in vivo, in distal sciatic nerves from Fgd4SC-/- mice. We observed that those myelination defects are related to an upregulation of some interactors of the NRG1 type III/ERBB2/3 signalling pathway, which is known to ensure a proper level of myelination in the PNS. Based on a yeast two-hybrid screen, we identified SNX3 as a new partner of FRABIN, which is involved in the regulation of endocytic trafficking. Interestingly, we showed that the loss of FRABIN impairs endocytic trafficking, which may contribute to the defective NRG1 type III/ERBB2/3 signalling and myelination. Using RNA-Seq, in vitro, we identified new potential effectors of the deregulated pathways, such as ERBIN, RAB11FIP2 and MAF, thereby providing cues to understand how FRABIN contributes to proper ERBB2 trafficking or even myelin membrane addition through cholesterol synthesis. Finally, we showed that the re-establishment of proper levels of the NRG1 type III/ERBB2/3 pathway using niacin treatment reduces myelin outfoldings in nerves of CMT4H mice. Overall, our work reveals a new role of FRABIN in the regulation of NRG1 type III/ERBB2/3 NRG1signalling and myelination and opens future therapeutic strategies based on the modulation of the NRG1 type III/ERBB2/3 pathway to reduce CMT4H pathology and more generally other demyelinating types of CMT disease., (© The Author(s) 2022. Published by Oxford University Press on behalf of the Guarantors of Brain.)

Inherited peripheral neuropathy (IPN) is a heterogeneous group of disorders due to pathogenic variation in more than 100 genes. In 2012, the first cases of IPN associated with HINT1 pathogenic variations were described in 33 families sharing the same phenotype characterized by an axonal neuropathy with neuromyotonia and autosomal recessive inheritance (NMAN: OMIM #137200). Histidine Triad Nucleotide Binding Protein 1 regulates transcription, cell-cycle control, and is possibly involved in neuropsychiatric pathophysiology. Herein, we report seven French patients with NMAN identified by Next Generation Sequencing. We conducted a literature review and compared phenotypic and genotypic features with our cohort. We identified a new HINT1 pathogenic variation involved in NMAN: c.310G>C p.(Gly104Arg). This cohort is comparable with literature data regarding age of onset (7,4yo), neuronal involvement (sensorimotor 3/7 and motor pure 4/7), and skeletal abnormalities (scoliosis 3/7, feet anomalies 6/7). We expand the phenotypic spectrum of HINT1-related neuropathy by describing neurodevelopmental or psychiatric features in six out of seven individuals such as generalized anxiety disorder (GAD), obsessive-compulsive disorder (OCD), mood disorder and attention deficit hyperactivity disorder (ADHD). However, only 3/128 previously described patients had neuropsychiatric symptomatology or neurodevelopmental disorder. These features could be part of HINT1-related disease, and we should further study the clinical phenotype of the patients., (© 2022 The Authors. Clinical Genetics published by John Wiley & Sons Ltd.)

We recently described new pathogenic variants in VRK1, in patients affected with distal Hereditary Motor Neuropathy associated with upper motor neurons signs. Specifically, we provided evidences that hiPSC-derived Motor Neurons (hiPSC-MN) from these patients display Cajal Bodies (CBs) disassembly and defects in neurite outgrowth and branching. We here focused on the Axonal Initial Segment (AIS) and the related firing properties of hiPSC-MNs from these patients. We found that the patient's Action Potential (AP) was smaller in amplitude, larger in duration, and displayed a more depolarized threshold while the firing patterns were not altered. These alterations were accompanied by a decrease in the AIS length measured in patients' hiPSC-MNs. These data indicate that mutations in VRK1 impact the AP waveform and the AIS organization in MNs and may ultimately lead to the related motor neuron disease., (Copyright © 2022 The Authors. Published by Elsevier Inc. All rights reserved.)

Background and Aims: The identification of underlying genes of genetic conditions has expanded greatly in the past decades, which has broadened the field of genes responsible for inherited neuromuscular diseases. We aimed to investigate mutations associated with neuromuscular disorders phenotypes in 2 Moroccan families., Material and Methods: Next-generation sequencing combined with Sanger sequencing could assist with understanding the hereditary variety and underlying disease mechanisms in these disorders., Results: Two novel homozygous mutations were described in this study. The SIL1 mutation is the first identified in the Moroccan population, the mutation was identified as the main cause of Marinesco-Sjogren syndrome in one patient. While the second mutation identified in the fatty acid 2-hydroxylase gene (FA2H) was associated with the Spastic paraplegia 35 in another patient, both transmitted in an autosomal recessive pattern., Discussion and Conclusions: These conditions are extremely rare in the North African population and may be underdiagnosed due to overlapping clinical characteristics and heterogeneity of these diseases. We have reported in this study mutations associated with the diseases found in the patients. In addition, we have narrowed the phenotypic spectrum, as well as the diagnostic orientation of patients with neuromuscular disorders, who might have very similar symptoms to other disease groups., (Copyright © 2021. Published by Elsevier B.V.)

Background: Clinical and molecular data on the occurrence and frequency of inherited neuromuscular disorders (NMD) in the Lebanese population is scarce., Objective: This study aims to provide a retrospective overview of hereditary NMDs based on our clinical consultations in Lebanon., Methods: Clinical and molecular data of patients referred to a multi-disciplinary consultation for neuromuscular disorders over a 20-year period (1999-2019) was reviewed., Results: A total of 506 patients were diagnosed with 62 different disorders encompassing 10 classes of NMDs. 103 variants in 49 genes were identified. In this cohort, 81.4% of patients were diagnosed with motor neuron diseases and muscular dystrophies, with almost half of these described with spinal muscular atrophy (SMA) (40.3% of patients). We estimate a high SMA incidence of 1 in 7,500 births in Lebanon. Duchenne and Becker muscular dystrophy were the second most frequently diagnosed NMDs (17% of patients). These disorders were associated with the highest number of variants (39) identified in this study. A highly heterogeneous presentation of Limb Girdle Muscular Dystrophy and Charcot-Marie-Tooth disease was notably identified. The least common disorders (5.5% of patients) involved congenital, metabolic, and mitochondrial myopathies, congenital myasthenic syndromes, and myotonic dystrophies. A review of the literature for selected NMDs in Lebanon is provided., Conclusions: Our study indicates a high prevalence and underreporting of heterogeneous forms of NMDs in Lebanon- a major challenge with many novel NMD treatments in the pipeline. This report calls for a regional NMD patient registry.

We report on 2 cousins, a girl and a boy, born to first-cousin Lebanese parents with Hamamy syndrome, exhibiting developmental delay, intellectual disability, severe telecanthus, abnormal ears, dentinogenesis imperfecta, and bone fragility. Whole-exome sequencing studies performed on the 2 affected individuals and one obligate carrier revealed the presence of a homozygous c.503G>A (p.Arg168His) missense mutation in IRX5 in both sibs, not reported in any other family. Review of the literature and differential diagnoses are discussed., Competing Interests: The authors have no conflicts of interest to report., (Copyright © 2021 by S. Karger AG, Basel.)

Background: Congenital myasthenic syndromes (CMS) are associated with defects in the structure and the function of neuromuscular junctions. These rare disorders can result from mutations in the collagenic tail of endplate acetylcholinesterase (COLQ) essentially associated with autosomal recessive inheritance. With the lowered cost of genetic testing and increased access to next-generation sequencing, many mutations have been reported to date., Methods and Results: In this study we identified the first COLQ homozygous mutation c.1193T>A in the North African population. This study outlines the genetic and phenotypic features of a CMS patient in a Moroccan family. It also describes a novel COLQ missense mutation associated with CMS-5., Conclusion: COLQ mutations are probably underdiagnosed in these North African populations, this is an issue as CMS-5 may be treated with ephedrine, and albuterol. Indeed, patients can seriously benefit and even recover after the treatment that should be planned according to genetic tests and clinical findings., (© 2021. The Author(s), under exclusive licence to Springer Nature B.V.)