Search

BackgroundDespite the large impact that dietary habits have in the management of diabetes, few tools for supporting healthy eating habits are available for persons with diabetes. ObjectiveThe aim of this randomized clinical trial is to evaluate the effect of a 12-week, mobile health (mHealth), app-based intervention promoting healthy eating habits among patients with type 2 diabetes. MethodsThe HAPPY (Healthy eating using APP technologY) trial is a randomized clinical trial with two arms aiming to include 200 patients, 18 years of age or older, with type 2 diabetes. Both women and men are eligible for inclusion. Study participants are randomized 1:1 to an intervention group, where they are instructed to use a smartphone app promoting healthy eating, or to a control group, where they receive standard primary care only, for a period of 12 weeks. Each week a new topic (eg, vegetable intake) is introduced via the app. After an introduction text, the user is given a topic-related activity to perform (eg, eat one additional serving of vegetables per day during that week). The app records daily progress and sends automatic reminders or feedback to the user. Dietary intake, body composition, clinical variables, and biomarkers are measured at baseline and at 3- and 6-month follow-ups. An extensive web-based questionnaire comprising several validated questionnaires assessing a number of lifestyle factors is distributed via email at baseline and at 3-, 6-, and 12-month follow-ups; lifestyle factors include, for example, sleep, physical activity, eating behavior, and health-related quality of life. The effect of the intervention on dietary intake (primary outcome) and on glycated hemoglobin and blood lipid levels, body composition, blood pressure, other lifestyle factors, and overall health (secondary outcomes) will be assessed. ResultsData collection is ongoing. Recruitment of participants started in January 2019. Findings from the study are expected to be published by the end of 2021. ConclusionsTechnology development provides new ways to promote and support long-term adherence to healthier eating habits. mHealth-based approaches allow for real-time interaction and the delivery of an intervention at any time. Further, focusing on overall diet allows the user to apply new knowledge to current eating patterns, creating an individualized approach. In this study, we evaluate the effect of using a new smartphone app promoting healthy eating habits on dietary intake, clinical markers, and lifestyle factors among patients with type 2 diabetes. Trial RegistrationClinicalTrials.gov NCT03784612; https://clinicaltrials.gov/ct2/show/NCT03784612 International Registered Report Identifier (IRRID)DERR1-10.2196/24422

BACKGROUND: In 2020, a novel neurologic disease was observed in juvenile Quarter Horses (QHs) in North America. It was unknown if this was an aberrant manifestation of another previously described neurological disorder in foals, such as equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM). HYPOTHESIS/OBJECTIVES: To describe the clinical findings, outcomes, and postmortem changes with Equine Juvenile Spinocerebellar Ataxia (EJSCA), differentiate the disease from other similar neurological disorders, and determine a mode of inheritance. ANIMALS: Twelve neurologically affected QH foals and the dams. METHODS: Genomic DNA was isolated and pedigrees were manually constructed. RESULTS: All foals (n = 12/12) had a history of acute onset of neurological deficits with no history of trauma. Neurological deficits were characterized by asymmetrical spinal ataxia, with pelvic limbs more severely affected than thoracic limbs. Clinicopathological abnormalities included high serum activity of gamma-glutamyl transferase and hyperglycemia. All foals became recumbent (median, 3 days: [0-18 days]), which necessitated humane euthanasia (n = 11/12, 92%; the remaining case was found dead). Histological evaluation at postmortem revealed dilated myelin sheaths and digestion chambers within the spinal cord, most prominently in the dorsal spinocerebellar tracts. Pedigree analysis revealed a likely autosomal recessive mode of inheritance. CONCLUSIONS AND CLINICAL IMPORTANCE: EJSCA is a uniformly fatal, rapidly progressive, likely autosomal recessive neurological disease of QHs

The genomic sequence of the horse has been available since 2009, providing critical resources for discovering important genomic variants regarding both animal health and population structures. However, to fully understand the functional implications of these variants, detailed annotation of the horse genome is required. Due to the limited availability of functional data for the equine genome, as well as the technical limitations of short-read RNA-seq, existing annotation of the equine genome contains limited information about important aspects of gene regulation, such as alternate isoforms and regulatory elements, which are either not transcribed or transcribed at a very low level. To solve above problems, the Functional Annotation of the Animal Genomes (FAANG) project proposed a systemic approach to tissue collection, phenotyping, and data generation, adopting the blueprint laid out by the Encyclopedia of DNA Elements (ENCODE) project. Here we detail the first comprehensive overview of gene expression and regulation in the horse, presenting 39,625 novel transcripts, 84,613 candidate cis-regulatory elements (CRE) and their target genes, 332,115 open chromatin regions genome wide across a diverse set of tissues. We showed substantial concordance between chromatin accessibility, chromatin states in different genic features and gene expression. This comprehensive and expanded set of genomics resources will provide the equine research community ample opportunities for studies of complex traits in the horse.

Recombinant human erythropoietin (rHuEPO) is a well-known performance enhancing drug in human athletes, and there is anecdotal evidence of it being used in horse racing for the same purpose. rHuEPO, like endogenous EPO, increases arterial oxygen content and thus aerobic power. Micro-doping, or injecting smaller doses over a longer period of time, has become an important concern in both human and equine athletics since it is more difficult to detect. Horses offer an additional challenge of a contractile spleen, thus large changes in the red blood cell mass occur naturally. To address the challenge of detecting rHuEPO doping in horse racing, we determined the transcriptomic effects of rHuEPO micro-dosing over seven weeks in exercised Thoroughbreds. RNA-sequencing of peripheral blood mononuclear cells isolated at several time points throughout the study identified three transcripts (C13H16orf54, PUM2 and CHTOP) that were significantly (PFDR < 0.05) different between the treatment groups across two or three time point comparisons. PUM2 and CHTOP play a role in erythropoiesis while not much is known about C13H16orf54, but it is primarily expressed in whole blood. However, gene expression differences were not large enough to detect via RT-qPCR, thereby precluding their utility as biomarkers of micro-doping.

BackgroundEquine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder associated with a vitamin E deficiency within the first year of life. Vitamin E consists of 8 isoforms metabolized by the CYP4F2 enzyme. No antemortem diagnostic test currently exists for eNAD/EDM.Hypothesis/objectivesBased on the association of α-tocopherol deficiency with the development of eNAD/EDM, we hypothesized that the rate of α-tocopherol, but not γ-tocopherol or tocotrienol metabolism, would be increased in eNAD/EDM-affected horses.AnimalsVitamin E metabolism: Proof of concept (POC) study; eNAD/EDM-affected (n = 5) and control (n = 6) horses. Validation study: eNAD/EDM-affected Quarter Horses (QHs; n = 6), cervical vertebral compressive myelopathy affected (n = 6) horses and control (n = 29) horses. CYP4F2 expression and copy number: eNAD/EDM-affected (n = 12) and age- and sex-matched control (n = 11-12) horses.MethodsThe rates of α-tocopherol/tocotrienol and γ-tocopherol/tocotrienol metabolism were assessed in equine serum (POC and validation) and urine (POC only) using liquid chromatography tandem mass spectrometry (LC-MS/MS). Quantitative reverse-transcriptase PCR (qRT-PCR) and droplet digital (dd)-PCR were used to assay expression and genomic copy number of a CYP4F2 equine ortholog.ResultsMetabolic rate of α-tocopherol was increased in eNAD/EDM horses (POC,P

Genetic bleeding disorders can have a profound impact on a horse's health and athletic career. As such, it is important to understand the mechanisms of these diseases and how they are diagnosed. These diseases include haemophilia A, von Willebrand disease, prekallikrein deficiency, Glanzmann's Thrombasthenia and Atypical Equine Thrombasthenia. Exercise-induced pulmonary haemorrhage also has a proposed genetic component. Genetic mutations have been identified for haemophilia A and Glanzmann's Thrombasthenia in the horse. Mutations are known for von Willebrand disease and prekallikrein deficiency in other species. In the absence of genetic tests, bleeding disorders are typically diagnosed by measuring platelet function, von Willebrand factor, and other coagulation protein levels and activities. For autosomal recessive diseases, genetic testing can prevent the breeding of two carriers.

Following the successful creation of a biobank from two adult Thoroughbred mares, this study aimed to recapitulate sample collection in two adult Thoroughbred stallions as part of the Functional Annotation of the Animal Genome (FAANG) initiative. Both stallions underwent thorough physical, lameness, neurologic, and ophthalmic (including electroretinography) examinations prior to humane euthanasia. Epididymal sperm was recovered from both stallions immediately postmortem and cryopreserved. Aseptically collected full thickness skin biopsies were used to isolate, culture and cryopreserve dermal fibroblasts. Serum, plasma, cerebrospinal fluid, urine, and gastrointestinal content from various locations were collected and cryopreserved. Under guidance of a board-certified veterinary anatomic pathologist, 102 representative tissue samples were collected from both horses. Whole tissue samples were flash-frozen and prioritized tissues had nuclei isolated and cryopreserved. Spatially contemporaneous samples of each tissue were submitted for histologic examination. Antemortem and gross pathologic examination revealed mild abnormalities in both stallions. One stallion (ECA_UCD_AH3) had unilateral thoracic limb lameness and bilateral chorioretinal scars. The second stallion (ECA_UCD_AH4) had subtle symmetrical pelvic limb ataxia, symmetrical prostatomegally, and moderate gastrointestinal nematodiasis. DNA from each was whole-genome sequenced and genotyped using the GGP Equine 70K SNP array. The genomic resources and banked biological samples from these animals augments the existing resource available to the equine genomics community. Importantly we may now improve the resolution of tissue-specific gene regulation as affected by sex, as well as add sex-specific tissues and gametes.

Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prioritize potential genetic variants. Of the 2,808 variants that significantly associated with the phenotype using an AR mode of inheritance (PA,p.Ser875*) was significantly associated with the hypoparathyroid phenotype (Pallelic = 0.008). Affected foals were homozygous for the variant, with two additional affected foals subsequently confirmed in 2019. Necropsies of all affected foals failed to identify any histologically normal parathyroid glands. Because the nonsense mutation in RAPGEF5 was near the C-terminal end of the protein, the impact on protein function was unclear. Therefore, we tested the variant in our Xenopus overexpression model and demonstrated RAPGEF5 loss-of-function. This RAPGEF5 variant represents the first genetic variant for hypoparathyroidism identified in any domestic animal species.

Long non-coding RNAs (lncRNAs) are untranslated regulatory transcripts longer than 200 nucleotides that can play a role in transcriptional, post-translational, and epigenetic regulation. Traditionally, RNA-sequencing (RNA-seq) libraries have been created by isolating transcriptomic RNA via poly-A+ selection. In the past 10 years, methods to perform ribosomal RNA (rRNA) depletion of total RNA have been developed as an alternative, aiming for better coverage of whole transcriptomic RNA, both polyadenylated and non-polyadenylated transcripts. The purpose of this study was to determine which library preparation method is optimal for lncRNA investigations in the horse. Using liver and cerebral parietal lobe tissues from two healthy Thoroughbred mares, RNA-seq libraries were prepared using standard poly-A+ selection and rRNA-depletion methods. Averaging the two biologic replicates, poly-A+ selection yielded 327 and 773 more unique lncRNA transcripts for liver and parietal lobe, respectively. More lncRNA were found to be unique to poly-A+ selected libraries, and rRNA-depletion identified small nucleolar RNA (snoRNA) to have a higher relative expression than in the poly-A+ selected libraries. Overall, poly-A+ selection provides a more thorough identification of total lncRNA in equine tissues while rRNA-depletion may allow for easier detection of snoRNAs.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM.

BackgroundA subset of horses deficient in alpha-tocopherol (α-TP) develop muscle atrophy and vitamin E-responsive myopathy (VEM) characterized by mitochondrial alterations in the sacrocaudalis dorsalis medialis muscle (SC).ObjectivesTo quantify muscle histopathologic abnormalities in subclinical α-TP deficient horses before and after α-TP supplementation and compare with retrospective (r)VEM cases.AnimalsProspective study; 16 healthy α-TP-deficient Quarter Horses. Retrospective study; 10 retrospective vitamin E-responsive myopathy (rVEM) cases .MethodsBlood, SC, and gluteus medius (GM) biopsy specimens were obtained before (day 0) and 56 days after 5000 IU/450 kg horse/day PO water dispersible liquid α-TP (n = 8) or control (n = 8). Muscle fiber morphology and mitochondrial alterations were compared in samples from days 0 and 56 and in rVEM cases.ResultsMitochondrial alterations more common than our reference range (

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

This study focuses the theoretical underpinning of the so-called semantic gap. By analysing the discourses on ideals and practices of image search and image use in terms of different understandings of 'information' and 'communication' this study illuminates the epistemological foundation of different ways of thinking about image descriptions. More precisely, it compares the discourse for metadata production, standards and information management with the discourse among humanities scholars. Close readings of handbooks, best practice and interviews with metadata producers discloses a discourse imbued by a mechanical model for communication and information transmission and a focus on objectivity and effectiveness. Simultaneously, interviews with humanities scholars and close readings of recent archival theory reveal another understanding of metadata as historically, institutionally, and even individually situated interpretations. As this study shows, attentiveness to the theoretical underpinning of the different ideals, wants and needs of metadata for images may illuminate why these differences exists. [ABSTRACT FROM AUTHOR]