Search

The ease with which racemic mixtures crystallize compared with the equivalent chiral systems is routinely taken advantage of to produce crystals of small molecules. However, biological macromolecules such as DNA and proteins are naturally chiral, and thus the limited range of chiral space groups available hampers the crystallization of such molecules. Inspiring work over the past 15 years has shown that racemic mixtures of proteins, which were made possible by impressive advances in protein chemical synthesis, can indeed improve the success rate of protein crystallization experiments. More recently, the racemic crystallization approach was extended to include nucleic acids as a possible aid in the determination of enantiopure DNA crystal structures. Here, findings are reported that suggest that the benefits may extend beyond this. Two racemic crystal structures of the DNA sequence d(CCCGGG) are described which were found to fold into A-form DNA. This form differs from the Z-form DNA conformation adopted by the chiral equivalent in the solid state, suggesting that the use of racemates may also favour the emergence of new conformations. Importantly, the racemic mixture forms interactions in the solid state that differ from the chiral equivalent (including the formation of racemic pseudo-helices), suggesting that the use of racemic DNA mixtures could provide new possibilities for the design of precise self-assembled nanomaterials and nanostructures.

Because microRNAs (miRNAs) are biological indicators for the diagnosis, treatment, and monitoring of tumors, cancers, and other diseases, it is significant to develop a rapid, sensitive, and reliable miRNA detection platform. In this study, based on miRNA-21 detection, DNA-a with a 3′ end overhang and Texas Red fluorophore-labeled 5′ end was designed, which reacts with miRNA-21 and hybridizes with exonuclease III (Exo III), where the part connected to miRNA-21 is hydrolyzed, leaving a-DNA. At the same time, miRNA-21 is released to participate in the following reaction, to achieve cyclic amplification. a-DNA reacts with DNA-b conjugated to gold nanoparticles to achieve fluorescence quenching, with the quenching value denoted as F; additionally, after adding DNA-d and linked streptavidin immunomagnetic beads (SIBs), fluorescence recovery was achieved using DNA-c, with the recovered fluorescence recorded as F0. By comparing the difference in the fluorescence (F0 − F) between the two experiments, the amount of DNA-a hydrolyzed to produce a-DNA was established to determine the target miRNA-21 content. Under optimized conditions, by comparing the changes in the fluorescence signal, the developed strategy shows good sensitivity and repeatability, with a detection limit of 18 pM, good discriminative ability and selectivity, and promise for the early diagnosis of breast and intestinal cancers.

The structure of A-DNA with biological activity is double helix. Researches of A-DNA structure have wide application on the development of DNA drug. In aqueous solution, the structure of A-DNA will have a free transformation over time and be finally stabilized in the B-form. In this work, molecular dynamics simulations have been performed on the A-DNA with sequence of CCCGGCCGGG, to elucidate the influence of ionic valence and temperature on the structural stability of A-DNA in salt solution. The results show that the structure of A-DNA is more stable in AlCl

Accurate parametrization of force fields (FFs) is of ultimate importance for computer simulations to be reliable and to possess a predictive power. In this work, we analyzed, in multi-microsecond simulations of a 40-base-pair DNA fragment, the performance of four force fields, namely, the two recent major updates of CHARMM and two from the AMBER family. We focused on a description of double-helix DNA flexibility and dynamics both at atomistic and at mesoscale level in coarse-grained (CG) simulations. In addition to the traditional analysis of different base-pair and base-step parameters, we extended our analysis to investigate the ability of the force field to parametrize a CG DNA model by structure-based bottom-up coarse-graining, computing DNA persistence length as a function of ionic strength. Our simulations unambiguously showed that the CHARMM36 force field is unable to preserve DNA's structural stability at over-microsecond time scale. Both versions of the AMBER FF, parmbsc0 and parmbsc1, showed good agreement with experiment, with some bias of parmbsc0 parameters for intermediate A/B form DNA structures. The CHARMM27 force field provides stable atomistic trajectories and overall (among the considered force fields) the best fit to experimentally determined DNA flexibility parameters both at atomistic and at mesoscale level. Ministry of Education (MOE) Accepted version This work was supported by the Singapore Ministry of Education Academic Research Fund (AcRF) Tier 2 (MOE2014-T2-1-123 (ARC51/14)) and Tier 3 (MOE2012- T3-1-001) grants (to L.N.) and by the Swedish Research Council (grant 2017-03950 to A.P.L.).

BACKGROUND This study aimed to identify hub genes and pathways in a rat model of renal ischemia-reperfusion injury (IRI) using bioinformatics analysis of the Gene Expression Omnibus (GEO) microarray dataset and integration of gene expression profiles. MATERIAL AND METHODS GEO software and the GEO2R calculation method were used to analyze two mRNA profiles, including GSE 39548 and GSE 108195. The co-expression of differentially expressed genes (DEGs) were identified and searched in the DAVID and STRING databases for pathway and protein-protein interaction (PPI) analysis. Cytoscape was used to draw the PPI network. DEGs were also analyzed using the Molecular Complex Detection (MCODE) algorithm. Cytoscape and cytoHubba were used to analyze the hub genes and visualize the molecular interaction networks. Rats (n=20) included the IRI model group (n=10) and a control group (n=10). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was used to measure and compare the expression of the identified genes in rat renal tissue in the IRI model and the control group. RESULTS Ten hub genes were identified, STAT3, CD44, ITGAM, CCL2, TIMP1, MYC, THBS1, IGF1, SOCS3, and CD14. Apart from IGF1, qRT-PCR showed that expression of these genes was significantly increased in renal tissue in the rat model of IRI. The HIF-1alpha signaling pathway was involved in IRI in the rat model, which was supported by MCODE analysis. CONCLUSIONS In a rat model of renal IRI, bioinformatics analysis of the GEO dataset and integration of gene expression profiles identified involvement of HIF-1alpha signaling and the STAT3 hub gene.

P element transposase catalyzes the mobility of P element DNA transposons within the Drosophila genome. P element transposase exhibits several unique properties, including the requirement for a guanosine triphosphate cofactor and the generation of long staggered DNA breaks during transposition. To gain insights into these features, we determined the atomic structure of the Drosophila P element transposase strand transfer complex using cryo-EM. The structure of this post-transposition nucleoprotein complex reveals that the terminal single-stranded transposon DNA adopts unusual A-form and distorted B-form helical geometries that are stabilized by extensive protein-DNA interactions. Additionally, we infer that the bound guanosine triphosphate cofactor interacts with the terminal base of the transposon DNA, apparently to position the P element DNA for catalysis. Our structure provides the first view of the P element transposase superfamily, offers new insights into P element transposition and implies a transposition pathway fundamentally distinct from other cut-and-paste DNA transposases.

Metal-mediated base pairs expand the repertoire of nucleic acid structures and dynamics. Here we report solution structures and dynamics of duplex DNA containing two all-natural C-HgII-T metallo base pairs separated by six canonical base pairs. NMR experiments reveal a 3:1 ratio of well-resolved structures in dynamic equilibrium. The major species contains two (N3)T-HgII-(N3)C base pairs in a predominantly B-form helix. The minor species contains (N3)T-HgII-(N4)C base pairs and greater A-form characteristics. Ten-fold different 1J coupling constants (15N,199Hg) are observed for (N3)C-HgII (114 Hz) versus (N4)C-HgII (1052 Hz) connectivities, reflecting differences in cytosine ionization and metal-bonding strengths. Dynamic interconversion between the two types of C-HgII-T base pairs are coupled to a global conformational exchange between the helices. These observations inspired the design of a repetitive DNA sequence capable of undergoing a global B-to-A-form helical transition upon adding HgII, demonstrating that C-HgII-T has unique switching potential in DNA-based materials and devices., Metal-mediated base pairs expand the repertoire of nucleic acid structures and dynamics. Here, the authors prepared a metallo-DNA duplex including two C-Hg(II)-T base pairs separated by six normal Watson-Crick base pairs and investigated its solution structure and dynamics using NMR spectroscopy.

Double stranded DNA can adopt different forms, the so-called A-, B-, and Z-DNA, which play different biological roles. In this work, the thermodynamic and the kinetic parameters for the base-pair closing and opening in A-DNA and B-DNA were calculated by all-atom molecular dynamics simulations at different temperatures. The thermodynamic parameters of the base pair in B-DNA were in good agreement with the experimental results. The free energy barrier of breaking a single base stack results from the enthalpy increase ΔH caused by the disruption of hydrogen bonding and base-stacking interactions, as well as water and base interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss ΔS caused by the restriction of torsional angles and hydration. It was found that the enthalpy change ΔH and the entropy change ΔS for the base pair in A-DNA are much larger than those in B-DNA, and the transition rates between the opening and the closing state for the base pair in A-DNA are much slower than those in B-DNA. The large difference of the enthalpy and entropy change for forming the base pair in A-DNA and B-DNA results from different hydration in A-DNA and B-DNA. The hydration pattern observed around DNA is an accompanying process for forming the base pair, rather than a follow-up of the conformation.

The use of a small molecule compound to reduce toxic repeat RNA transcripts or their translated aberrant proteins to target repeat-expanded RNA/DNA with a G4C2 motif is a promising strategy to treat C9orf72-linked disorders. In this study, the crystal structures of DNA and RNA–DNA hybrid duplexes with the -GGGCCG- region as a G4C2 repeat motif were solved. Unusual groove widening and sharper bending of the G4C2 DNA duplex A-DNA conformation with B-form characteristics inside was observed. The G4C2 RNA–DNA hybrid duplex adopts a more typical rigid A form structure. Detailed structural analysis revealed that the G4C2 repeat motif of the DNA duplex exhibits a hydration shell and greater flexibility and serves as a ‘hot-spot’ for binding of the anthracene-based nickel complex, NiII(Chro)2 (Chro = Chromomycin A3). In addition to the original GGCC recognition site, NiII(Chro)2 has extended specificity and binds the flanked G:C base pairs of the GGCC core, resulting in minor groove contraction and straightening of the DNA backbone. We have also shown that Chro-metal complexes inhibit neuronal toxicity and suppresses locomotor deficits in a Drosophila model of C9orf72-associated ALS. The approach represents a new direction for drug discovery against ALS and FTD diseases by targeting G4C2 repeat motif DNA.

DNA bases can adopt energetically unfavorable tautomeric forms that enable the formation of Watson-Crick-like (WC-like) mispairs, which have been proposed to give rise to spontaneous mutations in DNA and misincorporation errors in DNA replication and translation. Previous NMR and computational studies have indicated that the population of WC-like guanine-thymine (G-T) mispairs depends on the environment, such as the local nucleic acid sequence and solvation. To investigate these environmental effects, herein G-T mispair tautomerization processes are studied computationally in aqueous solution, in A-form and B-form DNA duplexes, and within the active site of a DNA polymerase λ variant. The wobble G-T (wG-T), WC-like G-T*, and WC-like G*-T forms are considered, where * indicates the enol tautomer of the base. The minimum free energy paths for the tautomerization from the wG-T to the WC-like G-T* and from the WC-like G-T* to the WC-like G*-T are computed with mixed quantum mechanical/molecular mechanical (QM/MM) free energy simulations. The reaction free energies and free energy barriers are found to be significantly influenced by the environment. The wG-T→G-T* tautomerization is predicted to be endoergic in aqueous solution and the DNA duplexes but slightly exoergic in the polymerase, with Arg517 and Asn513 providing electrostatic stabilization of G-T*. The G-T*→G*-T tautomerization is also predicted to be slightly more thermodynamically favorable in the polymerase relative to these DNA duplexes. These simulations are consistent with an experimentally driven kinetic misincorporation model suggesting that G-T mispair tautomerization occurs in the ajar polymerase conformation or concertedly with the transition from the ajar to the closed polymerase conformation. Furthermore, the order of the associated two proton transfer reactions is predicted to be different in the polymerase than in aqueous solution and the DNA duplexes. These studies highlight the impact of the environment on the thermodynamics, kinetics, and fundamental mechanisms of G-T mispair tautomerization, which plays a role in a wide range of biochemically important processes.

In ordinary aqueous solution, B-DNA is the major structural form of DNA. After the addition of ethanol, DNA is thought to be aggregated/condensed in the A-form structure. However, there is uncertainty as to whether the B-to-A conformational change is connected to the aggregation/condensation steps. In this study, we performed all-atom molecular dynamics simulations and calculated the free-energy surface involved in the A/B conformational transition for isolated and aggregated Dickerson-Drew dodecamers (DDDs) in water and 85% ethanol environments. We found in the case of an isolated DDD, the overall free-energy profile is entirely downhill to give the B-DNA conformation in both water and 85% ethanol. However, in the aggregated state and 85% ethanol environment, there is a free-energy minimum associated with the A-DNA region in addition to the global B-DNA minimum, and there is a ∼3 kcal/mol free-energy barrier to the A-to-B conformational change. The molecular dynamics results suggest that aggregation of DNA is essential for forming A-DNA.

The controlled immobilization of biomolecules onto surfaces is relevant in biosensing and cell biological research. Spatial control is achieved by surface-tethering molecules in micro- or nanoscale patterns. Yet, there is an increasing demand for temporal control over how long biomolecular cargo stays immobilized until released into the medium. Here, we present a DNA hybridization-based approach to reversibly anchor biomolecular cargo onto micropatterned surfaces. Cargo is linked to a DNA oligonucleotide that hybridizes to a sequence-complementary, surface-tethered strand. The cargo is released from the substrate by the addition of an oligonucleotide that disrupts the duplex interaction via toehold-mediated strand displacement. The unbound tether strand can be reloaded. The generic strategy is implemented with small-molecule or protein cargo, varying DNA sequences, and multiple surface patterning routes. The approach may be used as a tool in biological research to switch membrane proteins from a locally fixed to a free state, or in biosensing to shed biomolecular receptors to regenerate the sensor surface.

The functional B-conformation of DNA succumbs to the A-form at low water activity. Methods for room temperature DNA storage that rely upon ‘anhydrobiosis’, thus, often encounter the loss of DNA activity due to the B→A-DNA transition. Here, we show that ionic liquids, an emerging class of green solvents, can induce conformational transitions in DNA and even rescue the dehydrated DNA in the functional B-form. CD spectroscopic analyses not only reveal rapid transition of A-DNA in 78% ethanol medium to B-conformation in presence of ILs, but also the high resistance of IL-bound B-form to transit to A-DNA under dehydration. Molecular dynamics simulations show the unique ability of ILs to disrupt Na+ ion condensation and form ‘IL spine’ in DNA minor groove to drive the A→B transition. Implications of these findings range from the plausible use of ILs as novel anhydrobiotic DNA storage medium to a switch for modulating DNA conformational transitions.

The right-handed DNA helix exhibits two major conformations, A-DNA and B-DNA, depending on the environmental conditions. The B-DNA to A-DNA (B→A) transition is sequence specific, cooperative, and reversible. The reduced water activity due to the addition of solvents like ethanol or the presence of protein or drug molecules causes B→A transition. In several biological cases, B→A transition occurs at a local level where small fragments of a long DNA sequence undergoes B→A transition. In this review, we have discussed various aspects of B→A transition such as the role of water, sequence specificity, mechanism of B→A transition, etc. The review primarily focuses on the B→A mechanism involved at a local level, and finally its connection to the global transition in theoretical and experimental studies.

B- to A-DNA transition is known to be sensitive to the macroscopic properties of the solution, such as salt and ethanol concentrations. Microenvironmental effects on DNA conformational transition have been broadly studied. Providing an intuitive picture of how DNA responds to environmental changes is, however, still needed. Analyzing the chemical equilibrium of B-to-A DNA transition at critical concentrations, employing explicit-solvent simulations, is envisioned to help understand such microenvironmental effects. In the present study, free-energy calculations characterizing the B- to A-DNA transition and the distribution of cations were carried out in solvents with different ethanol concentrations. With the addition of ethanol, the most stable structure of DNA changes from the B- to A-form, in agreement with previous experimental observation. In 60% ethanol, a chemical equilibrium is found, showing reversible transition between B- and A-DNA. Analysis of the microenvironment around DNA suggests that with the increase of ethanol concentration, the cations exhibit a significant tendency to move toward the backbone, and mobility of water molecules around the major groove and backbone decreases gradually, leading eventually to a B-to-A transition. The present results provide a free-energy view of DNA microenvironment and of the role of cation motion in the conformational transition.

The motors that drive double-stranded DNA (dsDNA) genomes into viral capsids are among the strongest of all biological motors for which forces have been measured, but it is not known how they generate force. We previously proposed that the DNA is not a passive substrate but that it plays an active role in force generation. This “scrunchworm hypothesis” holds that the motor proteins repeatedly dehydrate and rehydrate the DNA, which then undergoes cyclic shortening and lengthening motions. These are captured by a coupled protein–DNA grip-and-release cycle to rectify the motion and translocate the DNA into the capsid. In this study, we examined the interactions of dsDNA with the dodecameric connector protein of bacteriophage ϕ29, using molecular dynamics simulations on four different DNA sequences, starting from two different conformations (A-DNA and B-DNA). In all four simulations starting with the protein equilibrated with A-DNA in the channel, we observed transitions to a common, metastable, highly scrunched conformation, designated A*. This conformation is very similar to one recently reported by Kumar and Grubmüller in much longer MD simulations on B-DNA docked into the ϕ29 connector. These results are significant for four reasons. First, the scrunched conformations occur spontaneously, without requiring lever-like protein motions often believed to be necessary for DNA translocation. Second, the transition takes place within the connector, providing the location of the putative “dehydrator”. Third, the protein has more contacts with one strand of the DNA than with the other; the former was identified in single-molecule laser tweezer experiments as the “load-bearing strand”. Finally, the spontaneity of the DNA–protein interaction suggests that it may play a role in the initial docking of DNA in motors like that of T4 that can load and package any sequence.

The structure of double-stranded DNA (dsDNA) is sensitive to solvent conditions. In solution, B-DNA is the favored conformation under physiological conditions, while A-DNA is the form found under low water activity. The A-form is induced locally in some protein-DNA complexes, and repeated transitions between the B- and A-forms have been proposed to generate the forces used to drive dsDNA into viral capsids during genome packaging. Here, we report analyses on previous molecular dynamics (MD) simulations on B-DNA, along with new MD simulations on the transition from A-DNA to B-DNA in solution. We introduce the A–B Index (ABI), a new metric along the A–B continuum, to quantify our results. When A-DNA is placed in an equilibrated solution at physiological ionic strength, there is no energy barrier to the transition to the B-form, which begins within about 1 ns. The transition is essentially complete within 5 ns, although occasionally a stretch of a few base pairs will remain A-like for up to ~10 ns. A comparison of four sequences with a range of predicted A-phobicities shows that more A-phobic sequences make the transition more rapidly than less A-phobic sequences. Simulations on dsDNA with a region of roughly one turn locked in the A-form allow us to characterize the A/B junction, which has an average bend angle of 20–30°. Fluctuations in this angle occur with characteristic times of about 10 ns.

CRISPR (clustered regularly interspaced short palindromic repeat) endonucleases are at the forefront of biotechnology, synthetic biology and gene editing. Methods for controlling enzyme properties promise to improve existing applications and enable new technologies. CRISPR enzymes rely on RNA cofactors to guide catalysis. Therefore, chemical modification of the guide RNA can be used to characterize structure-activity relationships within CRISPR ribonucleoprotein (RNP) enzymes and identify compatible chemistries for controlling activity. Here, we introduce chemical modifications to the sugar–phosphate backbone of Streptococcus pyogenes Cas9 CRISPR RNA (crRNA) to probe chemical and structural requirements. Ribose sugars that promoted or accommodated A-form helical architecture in and around the crRNA ‘seed’ region were tolerated best. A wider range of modifications were acceptable outside of the seed, especially D-2′-deoxyribose, and we exploited this property to facilitate exploration of greater chemical diversity within the seed. 2′-fluoro was the most compatible modification whereas bulkier O-methyl sugar modifications were less tolerated. Activity trends could be rationalized for selected crRNAs using RNP stability and DNA target binding experiments. Cas9 activity in vitro tolerated most chemical modifications at predicted 2′-hydroxyl contact positions, whereas editing activity in cells was much less tolerant. The biochemical principles of chemical modification identified here will guide CRISPR-Cas9 engineering and enable new or improved applications.

Apart from being storage devices for genetic information, nucleic acids can provide regulatory structures through evolutionarily optimized sequences. The interaction of proteins binding specifically to such sequences and resulting secondary structures, or the exposure of single-stranded DNA add a versatile regulatory framework for cells. Biochemical and structural biology experiments have revealed important underlying concepts of protein-DNA interactions but are often limited by ensemble averaging or static information. To decipher the dynamics of conformations adopted by protein-DNA complexes, single-molecule approaches have become a powerful resource over the past two decades. In particular single-molecule FRET (smFRET), which allows a read-out of DNA or protein conformations, became widely used. Here, we illustrate how to implement the technique and exemplarily describe how smFRET yields insights into conformational changes of DNA secondary structures induced by the single-stranded DNA binding protein SSB. We further explain how we use smFRET to study mechanisms of the replication initiator DnaA and the competition of DnaA and SSB for single-stranded DNA. We anticipate that smFRET will further develop into a particularly useful technique to study dynamic competitions of proteins for the same DNA substrate.

Because of open problems in the relation between results obtained by relaxation experiments and molecular dynamics simulations on the B-A transition of DNA, relaxation measurements of the B-A dynamics have been extended to a wider range of conditions. Field-induced reaction effects are measured selectively by the magic angle technique using a novel cell construction preventing perturbations from cell window anisotropy. The kinetics was recorded for the case of poly[d(AT)] up to the salt concentration limit of 4.4 mM, where aggregation does not yet interfere. Now experimental data on the B-A dynamics are available for poly[d(AT)] at salt concentrations of 0.18, 0.73, 2.44 and 4.4 mM. In all cases, a spectrum of time constants is found, ranging from ~ 10 μs up to components approaching ~ 1 ms. The relatively small dependence of these data on the salt concentration indicates that electrostatic effects on the kinetics are not as strong as may be expected. The ethanol content at the transition center is a linear function of the logarithm of the salt concentration, and the slope is close to that expected from polyelectrolyte theory. The B-A transition dynamics was also measured in D2O at a salt concentration of 2.4 mM: the center of the transition is found at 20.0 mol/l H2O and at 20.1 mol/l D2O with an estimated accuracy of ± 0.1 mol/l; the spectrum of time constants at the respective transition centers is very similar. The experimental results are discussed regarding the data obtained by molecular dynamics simulations.

The objective of this study is to evaluate the structure and protein recognition properties of hybrid four-way junctions (4WJs) composed of DNA and peptide nucleic acid (PNA) strands. We compare a classic immobile DNA junction, J1, vs. six PNA-DNA junctions, including a number with blunt DNA ends and multiple PNA strands. Circular dichroism (CD) analysis reveals that hybrid 4WJs are composed of helices that possess structures intermediate between A- and B-form DNA, the apparent level of A-form structure correlates with the PNA content. The structure of hybrids that contain one PNA strand is sensitive to Mg(+2). For these constructs, the apparent B-form structure and conformational stability (Tm) increase in high Mg(+2). The blunt-ended junction, b4WJ-PNA3, possesses the highest B-form CD signals and Tm (40.1 °C) values vs. all hybrids and J1. Protein recognition studies are carried out using the recombinant DNA-binding protein, HMGB1b. HMGB1b binds the blunt ended single-PNA hybrids, b4WJ-PNA1 and b4WJ-PNA3, with high affinity. HMGB1b binds the multi-PNA hybrids, 4WJ-PNA1,3 and b4WJ-PNA1,3, but does not form stable protein-nucleic acid complexes. Protein interactions with hybrid 4WJs are influenced by the ratio of A- to B-form helices: hybrids with helices composed of higher levels of B-form structure preferentially associate with HMGB1b.

Platinum-based chemotherapeutics exert their therapeutic efficacy via the formation of DNA adducts which interfere with DNA replication, transcription and cell division and ultimately induce cell death. Repair and tolerance of these Pt-DNA lesions by nucleotide excision repair (NER) and homologous recombination (HR) can substantially reduce the effectiveness of therapy. Inhibition of these repair pathways, therefore, holds the potential to sensitize cancer cells to Pt treatment and increase clinical efficacy. Replication Protein A (RPA) plays essential roles in both NER and HR, along with its role in DNA replication and DNA damage checkpoint activation. Each of these functions is, in part, mediated by RPA binding to single-stranded DNA (ssDNA). Here we report the synthesis and characterization of novel derivatives of RPA small molecule inhibitors and their activity in models of epithelial ovarian cancer (EOC) and non-small cell lung cancer (NSCLC). We have synthesized analogs of our previously reported RPA inhibitor TDRL-505 and determined the structure-activity relationships. These data led us to the identification of TDRL-551, which exhibited a greater than 2-fold increase in in vitro activity. TDRL-551 showed synergy with Pt in tissue culture models of EOC and in vivo efficacy, as a single agent and in combination with platinum, in a NSCLC xenograft model. These data demonstrate the utility of RPA inhibition in EOC and NSCLC and the potential in developing novel anticancer therapeutics that target RPA-DNA interactions.

Hydration forces between DNA molecules in the A- and B-Form were studied using a newly developed technique enabling simultaneous in situ control of temperature and relative humidity. X-ray diffraction data were collected from oriented calf-thymus DNA fibers in the relative humidity range of 98%–70%, during which DNA undergoes the B- to A-form transition. Coexistence of both forms was observed over a finite humidity range at the transition. The change in DNA separation in response to variation in humidity, i.e. change of chemical potential, led to the derivation of a force-distance curve with a characteristic exponential decay constant of ∼ 2 A for both A- and B-DNA. While previous osmotic stress measurements had yielded similar force-decay constants, they were limited to B-DNA with a surface separation (wall-to-wall distance) typically > 5 A. The current investigation confirms that the hydration force remains dominant even in the dry A-DNA state and at surface separation down to ∼ 1.5 A, within the first hydration shell. It is shown that the observed chemical potential difference between the A and B states could be attributed to the water layer inside the major and minor grooves of the A-DNA double helices, which can partially interpenetrate each other in the tightly packed A phase. The humidity-controlled X-ray diffraction method described here can be employed to perform direct force measurements on a broad range of biological structures such as membranes and filamentous protein networks.

The structure and dynamics of DNA are governed by a sensitive balance between base stacking and pairing, hydration, and interactions with ions. Force-field models that include explicit representations of electronic polarization are capable of more accurately modeling the subtle details of these interactions versus commonly used additive force fields. In this work, we validate our recently refined polarizable force field for DNA based on the classical Drude oscillator model, in which electronic degrees of freedom are represented as negatively charged particles attached to their parent atoms via harmonic springs. The previous version of the force field, called Drude-2013, produced stable A- and B-DNA trajectories on the order of hundreds of nanoseconds, but deficiencies were identified that included weak base stacking ultimately leading to distortion of B-DNA duplexes and unstable Z-DNA. As a result of extensive refinement of base nonbonded terms and bonded parameters in the deoxyribofuranose sugar and phosphodiester backbone, we demonstrate that the new version of the Drude DNA force field is capable of simulating A- and B-forms of DNA on the microsecond time scale and the resulting conformational ensembles agree well with a broad set of experimental properties, including solution X-ray scattering profiles. In addition, simulations of Z-form duplex DNA in its crystal environment are stable on the order of 100 ns. The revised force field is to be called Drude-2017.

Empirical force fields seek to relate the configuration of a set of atoms to its energy, thus yielding the forces governing its dynamics, using classical physics rather than more expensive quantum mechanical calculations that are computationally intractable for large systems. Most force fields used to simulate biomolecular systems use fixed atomic partial charges, neglecting the influence of electronic polarization, instead making use of a mean-field approximation that may not be transferable across environments. Recent hardware and software developments make polarizable simulations feasible, and to this end, polarizable force fields represent the next generation of molecular dynamics simulation technology. In this work, we describe the refinement of a polarizable force field for DNA based on the classical Drude oscillator model by targeting quantum mechanical interaction energies and conformational energy profiles of model compounds necessary to build a complete DNA force field. The parametrization strategy employed in the present work seeks to correct weak base stacking in A- and B-DNA and the unwinding of Z-DNA observed in the previous version of the force field, called Drude-2013. Refinement of base nonbonded terms and reparametrization of dihedral terms in the glycosidic linkage, deoxyribofuranose rings, and important backbone torsions resulted in improved agreement with quantum mechanical potential energy surfaces. Notably, we expand on previous efforts by explicitly including Z-DNA conformational energetics in the refinement.

We present here a comparison of three different X-ray crystal structures of DNA tetradecamer sequence d(CCCGGGTACCCGGG)

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. MOE (Min. of Education, S’pore) Published version

The ion atmosphere around nucleic acids is an integral part of their solvated structure. However, detailed aspects of the ionic distribution are difficult to probe experimentally, and comparative studies for different structures of the same sequence are almost non-existent. Here, we have used large-scale molecular dynamics simulations to perform a comparative study of the ion distribution around (5'-CGCGCGCGCGCG-3')2 dodecamers in solution in B-DNA, A-RNA, Z-DNA and Z-RNA forms. The CG sequence is very sensitive to ionic strength and it allows the comparison with the rare but important left-handed forms. The ions investigated include Na(+), K(+) and Mg(2 +), with various concentrations of their chloride salts. Our results quantitatively describe the characteristics of the ionic distributions for different structures at varying ionic strengths, tracing these differences to nucleic acid structure and ion type. Several binding pockets with rather long ion residence times are described, both for the monovalent ions and for the hexahydrated Mg[(H2O)6](2+) ion. The conformations of these binding pockets include direct binding through desolvated ion bridges in the GpC steps in B-DNA and A-RNA; direct binding to backbone oxygens; binding of Mg[(H2O)6](2+) to distant phosphates, resulting in acute bending of A-RNA; tight 'ion traps' in Z-RNA between C-O2 and the C-O2' atoms in GpC steps; and others.

The effect of reduced dielectric environments on the conformational sampling of DNA was examined through molecular dynamics simulations. Different dielectric environments were used to model one aspect of cellular environments. Implicit solvent based on the Generalized Born methodology was used to reflect different dielectric environments in the simulations. The simulation results show a tendency of DNA structures to favor noncanonical A-like conformations rather than canonical A- and B-forms as a result of the reduced dielectric environments. The results suggest that the reduced dielectric response in cellular environments may be sufficient to enhance the sampling of A-like DNA structures compared to dilute solvent conditions.

Metal ion homeostasis in bacteria relies on metalloregulatory proteins to upregulate metal resistance genes and enable the organism to preclude metal toxicity. The copper sensitive operon repressor (CsoR) family is widely distributed in bacteria and controls the expression of copper efflux systems. CsoR operator sites consist of G-tract containing pseudopalindromes of which the mechanism of operator binding is poorly understood. Here, we use a structurally characterized CsoR from Streptomyces lividans (CsoR(Sl)) together with three specific operator targets to reveal the salient features pertaining to the mechanism of DNA binding. We reveal that CsoR(Sl) binds to its operator site through a 2-fold axis of symmetry centred on a conserved 5'-TAC/GTA-3' inverted repeat. Operator recognition is stringently dependent not only on electropositive residues but also on a conserved polar glutamine residue. Thermodynamic and circular dichroic signatures of the CsoR(Sl)-DNA interaction suggest selectivity towards the A-DNA-like topology of the G-tracts at the operator site. Such properties are enhanced on protein binding thus enabling the symmetrical binding of two CsoR(Sl) tetramers. Finally, differential binding modes may exist in operator sites having more than one 5'-TAC/GTA-3' inverted repeat with implications in vivo for a mechanism of modular control.

Base stacking is known to make an important contribution to the stability of DNA and RNA, and accordingly, significant efforts are ongoing to calculate stacking energies using ab initio quantum mechanical methods. To date, impressive improvements have been made in the model chemistries used to perform stacking energy calculations, including extensions that include robust treatments of electron correlation with extended basis sets, as required to treat interactions where dispersion makes a significant contribution. However, those efforts typically use rigid monomer geometries when calculating the interaction energies. To overcome this, in the present work, we describe a novel internal coordinate definition that allows the relative, intermolecular orientation of stacked base monomers to be constrained during geometry optimizations while allowing full optimization of the intramolecular degrees of freedom. Use of the novel reference frame to calculate the impact of full geometry optimization versus constraining the bases to be planar on base monomer stacking energies, combined with density-fitted, spin-component scaling MP2 treatment of electron correlation, shows that full optimization makes the average stacking energy more favorable by -3.4 and -1.5 kcal/mol for the canonical A and B conformations of the 16 5' to 3' base stacked monomers. Thus, treatment of geometry optimization impacts the stacking energies to an extent similar to or greater than the impact of current state of the art increases in the rigor of the model chemistry itself used to treat base stacking. Results also indicate that stacking favors the B-form of DNA, though the average difference versus the A-form decreases from -2.6 to -0.6 kcal/mol when the intramolecular geometry is allowed to fully relax. However, stacking involving cytosine is shown to favor the A-form of DNA, with that contribution generally larger in the fully optimized bases. The present results show the importance of allowing geometry optimization, as well as properly treating the appropriate model chemistry, in studies of nucleic acid base stacking.

The X-ray crystal structure of the DNA tetradecamer sequence d(CCGGGGTACCCCGG)(2) is reported at 1.4 Å resolution in the tetragonal space group P4(1)2(1)2. The sequence was designed to fold as a four-way junction. However, it forms an A-type double helix in the presence of barium chloride. The metal ion could not be identified in the electron-density map. The crystallographic asymmetric unit consists of one A-type double helix with 12 base pairs per turn, in contrast to 11 base pairs per turn for canonical A-DNA. A large number of solvent molecules have been identified in both the grooves of the duplex and around the backbone phosphate groups.

Little is known about the influence of multiple consecutive ‘non-standard’ (Z, 6-amino-5-nitro-2(1H)-pyridone, and P, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one) nucleobase pairs on the structural parameters of duplex DNA. P:Z nucleobase pairs follow standard rules for Watson–Crick base pairing but have rearranged hydrogen bonding donor and acceptor groups. Using the X-ray crystal structure as a starting point, we have modeled the motions of a DNA duplex built from a self-complementary oligonucleotide (5΄-CTTATPPPZZZATAAG-3΄) in water over a period of 50 μs and calculated DNA local parameters, step parameters, helix parameters, and major/minor groove widths to examine how the presence of multiple, consecutive P:Z nucleobase pairs might impact helical structure. In these simulations, the PZ-containing DNA duplex exhibits a significantly wider major groove and greater average values of stagger, slide, rise, twist and h-rise than observed for a ‘control’ oligonucleotide in which P:Z nucleobase pairs are replaced by G:C. The molecular origins of these structural changes are likely associated with at least two differences between P:Z and G:C. First, the electrostatic properties of P:Z differ from G:C in terms of density distribution and dipole moment. Second, differences are seen in the base stacking of P:Z pairs in dinucleotide steps, arising from energetically favorable stacking of the nitro group in Z with π–electrons of the adjacent base.

Nucleic acids adopt a broad array of hydrogen-bonded structures that enable their diverse roles in the cell; even the familiar DNA double helix displays subtle architectural nuances that are sequence dependent. While there have been many approaches for recognition of B-form nucleic acids, A-form DNA recognition has lagged behind. Here, using a tight binding fluorescein-neomycin (F-neo) conjugate that can probe the electrostatic environment of A-form DNA major groove, we developed a fluorescent displacement assay to be used as a screen for DNA duplex-binding compounds. As opposed to intercalating dyes that can significantly perturb DNA structure, the groove binding F-neo allows the probing of native DNA conformation. In combination with the assay development and probing of DNA grooves, we also report the synthesis and binding of a series of neomycin-anthraquinone conjugates, two units with a known preference for binding GC rich DNA. The assay can be used to identify duplex DNA-binding compounds, as well as probe structural features of a target DNA duplex, and can easily be scaled up for high throughput screening of compound libraries.

Because of repeated claims that A-DNA cannot exist without aggregation or condensation, the state of DNA restriction fragments with 84–859 bp has been analyzed in aqueous solutions upon reduction of the water activity. Rotational diffusion times τd measured by electric dichroism at different water activities with a wide variation of viscosities are normalized to values τc at the viscosity of water, which indicate DNA structures at a high sensitivity. For short helices (chain lengths \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\ell} $$\end{document}ℓ ≤ persistence length p), cooperative formation of A-DNA is reflected by the expected reduction of the hydrodynamic length; the transition to the A-form is without aggregation or condensation upon addition of ethanol at monovalent salt ≤1 mM. The aggregation boundary, indicated by a strong increase of τc, is shifted to higher monovalent salt (≥4 mM) when ethanol is replaced by trifluoroethanol. The BA transition is not indicated anymore by a cooperative change of τc for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\ell} $$\end{document}ℓ » p; τc values for these long chains decrease upon reduction of the water activity continuously over the full range, including the BA transition interval. This suggests a non-cooperative BC transition, which induces DNA curvature. The resulting wide distribution of global structures hides changes of local length during the BA transition. Free A-DNA without aggregation/condensation is found at low-salt concentrations where aggregation is inhibited and/or very slow. In an intermediate range of solvent conditions, where the A-form starts to aggregate, a time window remains that can be used for analysis of free A-DNA in a quasi-equilibrium state.

Natural RNAs, especially tRNAs, are extensively modified to tailor structure and function diversities. Uracil is the most modified nucleobase among all natural nucleobases. Interestingly, >76% of uracil modifications are located on its 5-position. We have investigated the natural 5-methoxy (5-O-CH(3)) modification of uracil in the context of A-form oligonucleotide duplex. Our X-ray crystal structure indicates first a H-bond formation between the uracil 5-O-CH(3) and its 5'-phosphate. This novel H-bond is not observed when the oxygen of 5-O-CH(3) is replaced with a larger atom (selenium or sulfur). The 5-O-CH(3) modification does not cause significant structure and stability alterations. Moreover, our computational study is consistent with the experimental observation. The investigation on the uracil 5-position demonstrates the importance of this RNA modification at the atomic level. Our finding suggests a general interaction between the nucleobase and backbone and reveals a plausible function of the tRNA 5-O-CH(3) modification, which might potentially rigidify the local conformation and facilitates translation.

Molecular dynamics simulations have been performed to characterize the conformation of DNA that is present when DNA links gold nanoparticles to form nanoparticle superlattice crystals. To model the DNA-linked gold nanoparticles, four strands of DNA are used to connect two gold surfaces, with a small interstrand separation and high added salt to match experiment. A-form DNA was assumed for the initial conformation, as this form of DNA has a length per base-pair that matches lengths that have been inferred from X-ray measurements. The DNA structure was monitored for 40 ns, and the distributions of the slide and z(p) coordinates were obtained from the simulations. We find that all the double-stranded DNA (ds-DNA) strands transform from A- to B-DNA during the simulations. In addition, single-stranded DNAa (ss-DNAs) that are used to connect the ds-DNA to each surface are found to become adsorbed on the gold surfaces during this process, and the ds-DNAs bend (∼143°) at their junctions with the two gold surfaces to accommodate the observed distance between gold surfaces using B-form DNA. We infer from this that the short length of DNA between the gold surfaces is not due to the presence of A-DNA.

The crystal structure of the tetradecanucleotide sequence d(CCCCGGTACCGGGG)(2) has been determined at 2.5 Å resolution in the tetragonal space group P4(1). This sequence was designed with the expectation of a four-way junction. However, the sequence crystallized as an A-DNA duplex and represents more than one full turn of the A-helix. The crystallographic asymmetric unit consists of one tetradecanucleotide duplex. The structural parameters of the A-type DNA duplex structure and the crystal-packing arrangement are described. One Mn(2+) ion was identified with direct coordination to the N7 position of G(13) and a water molecule at the major-groove side of the C(2)·G(13) base pair.

We report the 2.6Å resolution crystal structure of the tetra-decamer d(CGCGGGTACCCGCG) in the tetragonal space group P4₃. This sequence contains the KpnI restriction site GGTACC in the centre which is flanked by alternating 'CG' sequences, and has a 'TA' step at the centre. These are features could favour the left-handed Z type helix. Despite this, overall the molecule has the A form. This is the first tetra-decamer crystallized in the A-DNA conformation, i.e. more than one full turn of the A helix. The crystallographic asymmetric unit consists of one tetra-decamer duplex. The helical twist and slide, as well as the base pair-base pair stacking interactions show alternations at the alternating pyrimidine-purine and purine-pyrimidine base steps. This variation is reminiscent of the dinucleotide repeat in left-handed Z-DNA helices. The crystal packing is unlike other A-DNA crystal structures, with each helix having a large number of contacts of many different types with symmetry-related neighbours.

Nucleic acids can fold into well-defined 3D structures that help determine their function. Knowing precise nucleic acid structures can also be used for the design of nucleic acid-based therapeutics. However, locations of hydrogen atoms, which are key players of nucleic acid function are normally not determined with X-ray crystallography. Accurate determination of hydrogen atom positions can provide indispensable information on protonation states, hydrogen bonding, and water architecture in nucleic acids. Here, we used neutron crystallography in combination with X-ray diffraction to obtain joint X-ray/neutron structures at both room- and cryo-temperatures of a self-complimentary A-DNA oligonucleotide d[GTGG(C(Se))CAC](2) containing 2’-SeCH(3) modification on Cyt5 (C(Se)) at pH 5.6. We directly observed protonation of a backbone phosphate oxygen of Ade7 at room temperature. The proton is replaced with hydrated Mg(2+) upon cooling the crystal to 100K, indicating that metal binding is favoured at low temperature, whereas proton binding is dominant at room temperature.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

s We describe a new method used for quantitating weak interactions between proteins in which the weak interaction is “assisted” by a known DNA–DNA interaction. Oligonucleotides, which are conjugated to proteins of interest, contain short complementary DNA sequences that provide additional binding energy for protein–protein interactions. A stretch of unpaired bases links the protein to the hybridizing DNA sequence to allow formation of both protein–protein and DNA–DNA interactions with minimal structural interference. We validated the DNA-assisted binding method using heterodimerizing coiled-coil proteins. The method was then used to measure the predicted weak interaction between two domains of the Escherichia coli l -arabinose operon regulatory protein AraC. The interaction between domains has the expected magnitude ( K d = 0.37 mM) in the absence of arabinose. Upon addition of arabinose, we detected a weaker and unexpected interaction, which may necessitate modification of the proposed mechanism of AraC. The DNA-assisted binding method may also prove useful in the study of other weak protein–protein interactions.

We have previously shown that a critical region of the gata2 promoter contains an inverted CCAAT box and adopts a partial A-form DNA structure in vitro. At gastrula stages of development transcription requires binding of CBTF (CCAAT box transcription factor), a multi-subunit transcription factor, to this region. Xilf3 is one component of CBTF and the double stranded RNA binding domains (dsRBDs) of Xilf3 must be active for both binding to, and transcription from, this promoter. Here we determine the contribution of DNA sequence and structure at the gata2 promoter to transcriptional activity. In all the constructs we tested a CCAAT box was a requirement for full activity. However, base substitutions that increase B-form structure propensity in the sequences flanking the CCAAT box are equally able to decrease activity even if a CCAAT box is present. In contrast, mutations that maintain A-form propensity in these regions also maintain, or increase, transcription factor binding and transcriptional activity. We propose a two-component model for the interaction of CBTF with the gata2 promoter, requiring both a CCAAT sequence and flanking A-form DNA structures. These results support a novel role for dsRBDs in transcriptional regulation and suggest a function for A-form DNA in vivo.

The energies of intra- and inter-strand stacking interactions in model d(GpC) and d(CpG) two-base-pair steps were estimated by MP2/aug-cc-pVDZ single point calculations corrected for basis superposition errors. The stacked two-nucleobase pairs were constructed using experimental values of base pair and base step parameters taken from Nucleic Acid Database (http://ndbserver.rutgers.edu/). Three distinct polymorphic forms were analysed, namely A-, B- and Z-DNA. The applied methodology enables statistical analysis of structural and energetic diversities. The structural relationships between polymorphic forms are quite complex and depend on the sequence of pairs. The variability of parameters such as shift and tilt is almost the same irrespective of the polymorphic form and sequence of steps analysed. In contrast, shift and twist distributions easily discriminate all three polymorphic forms of DNA. Interestingly, despite significant structural diversities, the energies of the most frequent energy ranges are comparable irrespective of the polymorphic form and base sequence. There was observed compensation of inter- and intra-strand interactions, especially for d(GpC) and d(CpG) steps found in A- and B-DNA. Thus, among many other roles, these pairs act as a kind of energetic buffer, balancing the double helix.

In recent years, significant progress has been made towards uncovering the physical mechanisms of low-hydration polymorphism in double-helical DNA. The effect appears to be mechanistically similar in different biological systems, and it is due to the ability of water to form spanning H-bonded networks around biomacromolecules via a quasi-two-dimensional percolation transition. In the case of DNA, disintegration of the spanning H-bonded network leads to electrostatic condensation of DNA strands because, below the percolation threshold, water loses its high dielectric permittivity, whereas the concentration of neutralizing counterions becomes high. In this Concept article arguments propose that this simple electrostatic mechanism represents the universal origin of low-hydration polymorphism in DNA.