Search

Mixed martial arts' popularity has increased in recent years, alongside descriptive research and evidence-based performance recommendations. Guidelines for (both chronic and acute) weight making exist; however, how these translate in real-life scenarios and detailed investigations on practices in larger groups deserve attention. The present study examined the body mass (BM) and composition of 33 professional mixed martial arts athletes preparing for 80 fights. Athletes were supported by on-site dietitians, who encouraged evidence-based practices. Fasted BM was measured throughout the last ∼10 days before all bouts (acute weight management phase). A subset of athletes had body composition assessed before and after the chronic weight loss phase for 40 fights. Most athletes engaged in chronic BM loss, and all engaged in acute weight loss. Many lost fat-free mass (FFM) during the chronic phase, with rates of BM loss <0.5% best preserving FFM. Regardless of losses, the present athletes possessed greater FFM than other combat sport athletes and engaged in greater acute weight loss. Dehydration in the 24–48 hr before the weigh-in was not reflective of weight regain after the weigh-in, rather BM 7–10 days before the weigh-in was most reflective. These findings suggest that many mixed martial arts athletes could increase FFM at the time of competition by maintaining leaner physiques outside of competition and/or allowing increased time to reduce BM chronically. Acutely, athletes can utilize evidence-based protocols, eliminating carbohydrates, fiber, sodium, and finally fluid in a staged approach, before the weigh-in, reducing the amount of sweating required, thus theoretically better protecting health and preserving performance. [ABSTRACT FROM AUTHOR]

Purpose: Successful participation in taekwondo (TKD) requires athletes to possess quick decision-making abilities and demonstrate technical proficiency during competition. Dehydration, occurring during both training and competition, is widely recognized to have various negative effects. Methods: This study investigated the impact of different levels of dehydration on cognitive function, as measured by the Vienna Test System, and the specific performance of kicking techniques among TKD athletes. Using a randomized crossover design, 12 participants were involved in the study. Before and after 1 hour of training at 80% of maximal heart rate, participants were weighed and provided urine samples. All participants were randomly assigned to 3 different hydration conditions: the euhydrated (EUH) group had unrestricted access to fluid consumption, while the hypohydrated (HYP) and severely HYP (S-HYP) groups experienced reductions of 2.0% and 4.0% of their initial body weight, respectively. Results: The EUH group exhibited better reaction speed in reaction-time test-form S1 than the HYP and S-HYP groups. Notably, the EUH group demonstrated a significantly higher success rate in the front-side kick (EUH 98%, HYP 90%, S-HYP 88%; P <.05). However, the success rates of back roundhouse kick and free head kick were similar among the 3 statuses. Furthermore, postexercise heart rates were found to be significantly higher in the HYP and S-HYP groups compared with the EUH group. Conclusions: This study provides insight into the negative effects of dehydration on cognitive function and TKD-specific performance. It is recommended that TKD athletes maintain optimal hydration levels during training and competition to ensure optimal performance. [ABSTRACT FROM AUTHOR]

This study investigated (a) differences between males and females for changes in serum, tear, and urine osmolality, hematocrit, and urine specific gravity following acute passive dehydration and (b) assessed the reliability of these biomarkers separately for each sex. Fifteen males (age: 26.3 ± 3.5 years, body mass: 76 ± 7 kg) and 15 females (age: 28.8 ± 6.4 years, body mass: 63 ± 7 kg) completed a sauna protocol twice (5–28 days apart), aiming for 4% body mass loss (BML). Urine, blood, and tear markers were collected pre- and postdehydration, and change scores were calculated. Male BML was significantly greater than that of females in Trial 1 (3.53% ± 0.55% vs. 2.53% ± 0.43%, p <.001) and Trial 2 (3.36% ± 0.66% vs. 2.53% ± 0.44%, p =.01). Despite significant differences in BML, change in hematocrit was the only change marker that displayed a significant difference in Trial 1 (males: 3% ± 1%, females: 2% ± 1%, p =.004) and Trial 2 (males: 3% ± 1%, females: 1% ± 1%, p =.008). Regression analysis showed a significant effect for sex (male) predicting change in hematocrit (β = 0.8, p =.032) and change in serum osmolality (β = −3.3, p =.005) when controlling for BML but not for urinary or tear measures. The intraclass correlation coefficients for females (ICC 2, 1) were highest for change in urine specific gravity (ICC =.62, p =.006) and lowest for change in tear osmolarity (ICC = −.14, p =.689), whereas for males, it was posthematocrit (ICC =.65, p =.003) and post tear osmolarity (ICC =.18, p =.256). Generally, biomarkers showed lower test–retest reliability in males compared with females but, overall, were classified as poor–moderate in both sexes. These findings suggest that the response and reliability of hydration biomarkers are sex specific and highlight the importance of accounting for BML differences. [ABSTRACT FROM AUTHOR]

We examined the sweat characteristics and fluid balance of elite female field hockey players during two heat training camps. Fourteen elite female field hockey players from the Australian national squad participated in two heat training camps held ∼6 months apart, following winter- (Camp 1) and summer-based training (Camp 2). Daily waking body mass (BM) and urine specific gravity (USG) were collected, along with several markers of sweat and fluid balance across two matches per camp. There was a 19% mean reduction in estimated whole-body sweat sodium concentration from Camp 1 (45.8 ± 6.5 mmol/L) to Camp 2 (37.0 ± 5.0 mmol/L; p <.001). Waking urine specific gravity ≥ 1.020 was observed in 31% of samples, with no significant differences in mean urine specific gravity or BM between camps (p >.05), but with substantial interindividual variation. Intramatch sweat rates were high (1.2–1.8 L/hr), with greater BM losses in Camp 1 (p =.030), resulting in fewer players losing ≥2% BM in Camp 2 (0%–8%), as compared with Camp 1 (36%–43%; p =.017). Our field data suggest that elite female field hockey players experience substantial sweat losses during competition in the heat regardless of the season. In agreement with previous findings, we observed substantial interindividual variation in sweat and hydration indices, supporting the use of individualized athlete hydration strategies. [ABSTRACT FROM AUTHOR]

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Introduction: Severe hypernatremia is a critical situation, and when coupled with intravascular depletion and hypotension can create a treatment dilemma.Case Report: We present the case of a medically complex patient who had gradually worsening alteration of mental status and mean arterial pressures in the 50s on presentation to the emergency department.Conclusion: Final diagnoses included severe hypernatremia and hypovolemic shock secondary to poor oral intake. We used judicious fluid repletion with gradual improvement in sodium levels and permissive hypotension to avoid rapid osmotic shifts. Balancing reperfusion and the risk for osmotic effects of aggressive fluid resuscitation can be a challenging situation for the multidisciplinary team.

The reliance on wasteful stoichiometric reagents to accomplish dehydration reactions such as esterification, amidation, and alcohol substitution is a longstanding challenge in synthetic chemistry. To address this problem, an electrochemical approach has been developed as a new conceptual platform for dehydration reactions. As a proof-of-concept demonstration, an electrochemical esterification protocol has been described that proceeds at room temperature, without acid or base additives, and without consuming stoichiometric reagents. This approach therefore overcomes key complications of esterification chemistry, and we envision that it will similarly enable improvements to a range of important, related transformations. 1 Introduction 2 An Electrochemical Design for Catalytic Dehydration 3 Electrochemical Esterification 4 Conclusions [ABSTRACT FROM AUTHOR]

Introduction: Ileostomy, frequently created after colorectal resections, hinders the physiologic function of the colon and can lead to dehydration and acute kidney injury due to high stoma outputs. This study aimed to evaluate the effectiveness of preventive measures on ileostomy-induced dehydration and related readmissions in a high-volume unit. Methods: In this prospective cohort study at a high-volume colorectal surgery department in Turkiye, the Prospective Ileostomy-induced Dehydration Prevention Bundle Project (PIDBP) was assessed from March 2021 to March 2022. The study enrolled patients undergoing colorectal surgery with ileostomy and involved comprehensive inpatient stoma care, education, and a structured post-discharge follow-up. The follow-up included the "Hydration follow-up scale" to monitor ileostomy output and related complications. The primary outcome was the readmission rate due to dehydration-related complications. The patients receiving the bundle intervention were compared with patients treated in the preceding year, focusing on the effectiveness of interventions such as dietary adjustments, fluid therapy, and pharmacological management. Results: In the study, 104 patients were analyzed, divided into 54 pre-bundle and 50 bundle group patients, with no significant differences in patient characteristics. While the overall readmission rate due to dehydration was 12.5%, a significant reduction in dehydration-related readmissions was observed in the bundle group compared to the pre-bundle group (2% vs. 22%, p = 0.002). Univariate analysis identified high stoma output (> 800 ml/24 h) (p < 0.001), chronic renal failure (CRF) (p = 0.01), postoperative ileus (p = 0.03), higher ASA status (p = 0.04), extended hospital stays (p = 0.03), and small bowel resections (especially in J-pouch patients) (p < 0.001) as significant predictors of readmission. Multivariate analysis revealed that the mean ileostomy output before discharge was the sole significant predictor of dehydration-related readmission (OR 1.01), with an optimal cutoff of 877.5 ml/day identified with an area under the curve (AUC) of 0.947, demonstrating high sensitivity (92.3%) and specificity (86.8%) in predicting readmission risk. Conclusion: The Prospective Ileostomy-induced Dehydration Prevention Bundle Project significantly reduced readmission rates after colorectal surgery. [ABSTRACT FROM AUTHOR]

Catalytic esterification in water has been achieved with the aid of a commercially available polymer-supported lipase, Novozym-435. Remarkably, this well-known biocatalyst demonstrates significant activity towards esterification using just water as the reaction medium. This methodology features representative esterifications of complex acids and alcohols, in the presence of unprotected amines. The work disclosed leading to esters typically requires only two equivalents of alcohol, although conversion for water-soluble alcohols appears to require increased loadings. Recycling of both the aqueous medium and catalyst are documented, highlighting the potential of this new technology, especially using directed evolution on the enzyme involved. Pharmaceutically relevant compounds are efficiently esterified (e.g., Ibuprofen, Tolmetin, and Ticagrelor) and multi-step, one-pot chemoenzymatic sequences can be performed to demonstrate the robustness of this catalytic aqueous system. [ABSTRACT FROM AUTHOR]

This article discusses medication management during sick days for patients with and without impaired renal function. The study found that patients with impaired renal function were often using high-risk drugs and were at risk for acute renal failure during sick days. However, there were no differences in medication management between patients with and without impaired renal function. The study suggests that healthcare professionals should improve information provision and support patients in their drug management during sick days. It also emphasizes the importance of involving informal caregivers in the process. [Extracted from the article]

Purpose: Patients with impaired renal function using medication that affects glomerular filtration rate are at increased risk of developing acute kidney injury (AKI) leading to hospital admissions. The risk increases during periods of dehydration due to diarrhoea, vomiting or fever (so-called "sick days"), or high environmental temperatures (heat wave). This study aims to gain insight into the characteristics and preventability of medication-related admissions for AKI and dehydration in elderly patients. Methods: Retrospective case series study in patients aged ≥ 65 years with admission for acute kidney injury, dehydration or electrolyte imbalance related to dehydration that was defined as medication-related. General practitioner's (GP) patient records including medication history and hospital discharge letters were available. For each admission, patient and admission characteristics were collected to review the patient journey. A case-by-case assessment of preventability of hospital admissions was performed. Results: In total, 75 admissions were included. Most prevalent comorbidities were hypertension, diabetes, and known impaired renal function. Diuretics and RAS-inhibitors were the most prevalent medication combination. Eighty percent of patients experienced non-acute onset of symptoms and 60% had contacted their GP within 2 weeks prior to admission. Around 40% (n = 29) of admissions were considered potentially preventable if pharmacotherapy had been timely and adequately adjusted. Conclusion: A substantial proportion of patients admitted with AKI or dehydration experience non-acute onset of symptoms and had contacted their GP within 2 weeks prior to admission. Timely adjusting of medication in these patients could have potentially prevented a considerable number of admissions. [ABSTRACT FROM AUTHOR]

The article presents a case study of an 18-year-old male with adrenal insufficiency, characterized by dizziness, shortness of breath, and weight loss. Topics discussed include the diagnosis of primary adrenal insufficiency, treatment with glucocorticoids and mineralocorticoids, and the importance of screening for additional autoimmune endocrine disorders.

Objective: To describe the association between day‐to‐day peak pain severity and clinical factors in individuals with chronic migraine (CM). Background: Little is known about how clinical factors relate to day‐to‐day pain severity in individuals with CM. Methods: Adults with CM were enrolled into this observational prospective cohort study that collected daily data about headache, associated symptoms, and lifestyle factors using a digital health platform (N1‐Headache™) for 90 days. "Migraine days" were defined as days in which a headache occurred that had features described by the International Classification of Headache Disorders criteria. On these days, peak pain severity was recorded on a 4‐point scale; on non‐headache days peak pain severity was imputed as "0/none". The associations between peak pain severity and 12 clinical factors were modeled and adjusted for sex, age, daily headache, presence of menstrual bleeding, day of the week, and disability. All numerical and Likert scale variables were standardized prior to analysis. Results: Data were available for 392 participants (35,280 tracked days). The sample was predominantly female (90.6%), with a mean (standard deviation) age of 39.9 (12.8) years. In the final multivariable model with random intercept and slopes, higher than typical self‐reported levels of standardized stress (odds ratio [OR] 1.07, 95% confidence interval [CI] 1.04–1.11), standardized irritability (OR 1.05, 95% CI 1.02–1.08), standardized sadness (OR 1.05, 95% CI 1.02–1.07), fatigue (OR 1.25, 95% CI 1.15–1.36), eyestrain (OR 1.38, 95% CI 1.26–1.52), neck pain (OR 1.94, 95% CI 1.76–2.13), skin sensitivity (OR 1.61, 95% CI 1.44–1.80), and dehydration (OR 1.29, 95% CI 1.18–1.42) were associated with higher reported peak pain severity levels, while standardized sleep quality (OR 0.96, 95% CI 0.93–0.99) and standardized waking feeling refreshed (OR 0.84, 95% CI 0.81–0.88) were associated with lower reported peak pain severity levels. The inclusion of a random intercept and random slopes improved upon more parsimonious models and illustrated large differences in individuals' reporting of peak severity according to the levels of the associated clinical factors. Conclusion: Our data showed that the experience of CM, from a pain severity perspective, is complex, related to multiple clinical variables, and highly individualized. These results suggest that future work should aim to study a personalized approach to both medical and behavioral interventions for CM based on which clinical factors relate to the individual's experience of pain severity. Plain Language Summary: People with chronic migraine (CM) have a high frequency of attacks (≥15 days/month), yet little is known about their day‐to‐day experience of pain. We looked at the relationship between 12 clinical factors, including mood, sleep, stress, and day‐to‐day pain severity scores in adults with CM. We found that people's experience of pain severity and its relationship to different clinical factors was very individualized, with a lot of variability between people. [ABSTRACT FROM AUTHOR]

Fresh mushrooms have a long history of cultivation and consumption, but high postharvest losses are a concern in the commercial production of mushrooms worldwide. Thermal dehydration is widely used in the preservation of commercial mushrooms, but the flavor and taste of mushrooms are significantly altered after dehydration. Non-thermal preservation technology, which effectively maintains the characteristics of mushrooms, is a viable alternative to thermal dehydration. The objective of this review was to critically assess the factors affecting fresh mushroom quality after preservation is remarkable, with the ultimate goal of developing and promoting non-thermal preservation technology for preserving fresh mushroom quality, effectively extending the shelf life of fresh mushrooms. The factors influencing the quality degradation process of fresh mushrooms discussed herein include the internal factors associated with the mushroom itself and the external factors associated with the storage environment. We present a comprehensive discussion of the effects of different non-thermal preservation technologies on the quality and shelf life of fresh mushrooms. To prevent quality loss and extend the shelf life after postharvest, hybrid methods, such as physical or chemical techniques combined with chemical techniques, and novel nonthermal technologies are highly recommended. [ABSTRACT FROM AUTHOR]

Intravenous fluids are commonly prescribed to children in hospitals. However, there are risks associated with their use. In order to safely prescribe these clinicians should understand the indications for their use, the principles underpinning their use and know the likely complications associated with intravenous fluid administration in children. Intravenous fluids should be prescribed depending on individual needs of each child and with careful monitoring and re-assessment. This review aims to provide a general approach to fluid prescription in children, providing some background of different physiological principles, different fluid composition, and the role of anti-diuretic hormone in fluid homeostasis. Fluid prescription is discussed, with an approach taking into consideration resuscitation boluses, dehydration, replacing ongoing losses and maintenance requirements. Case examples are provided to further facilitate readers' comprehension. Electrolyte abnormalities and an approach to the management of deranged electrolytes is addressed. Complications associated with fluid administration are highlighted, in particular, emphasizing the assessment and emergency management of the child with suspected cerebral oedema or hyponatraemic encephalopathy. Special consideration and discussion is given to the differing approach to fluid management of children in the setting of burns or diabetic ketoacidosis. [ABSTRACT FROM AUTHOR]

Background Malnutrition is a public health problem that affects physical and psychosocial well-being. It manifests as a rapid deterioration in nutritional status and bilateral edema due to inadequate food intake or illness. Methods This study is a retrospective cohort of 1208 children with severe acute malnutrition (SAM) in Sofala Province from 2018 to 2022. It includes hospitalized children aged 6–59 months with SAM and related complications. The dependent variable is recovery, and the independent variables include age, sex of the child, vomiting, dehydration, hypoglycemia, nutritional edema and anthropometry. Survival curves were plotted using the Kaplan–Meier method, and bivariable and multivariable Cox regression analyses were performed. Results The crude analysis revealed significant factors for nutritional recovery in children with SAM, including age, weight, height, malaria, diarrhea and dehydration. Children under 24 months had a 28% lower likelihood of recovery. Weight below 6.16 kg decreased the likelihood by 2%, and height above 71.1 cm decreased it by 20%. Conversely, malaria, diarrhea and dehydration increased the likelihood of recovery. However, after adjustment, only diarrhea remained a significant predictor of nutritional recovery. Conclusion This study found that diarrhea is a predictor of nutritional recovery in children with SAM. [ABSTRACT FROM AUTHOR]

Summary An empirical model was developed for dehydrating tomato's peels and seeds (TPS) at three different temperatures (i.e. 50 °C, 60 °C and 70 °C). The model assumes that there is an initial constant drying rate period (first stage) followed by a decreasing drying rate period (second stage). To assess the goodness of fitting procedure, the mean relative deviation modulus E¯%$$ \left(\overline{E}\%\right) $$ was calculated. Results indicate that the model can adequately describe the dehydration data. The robustness of the model was further tested by evaluating the dependence of model parameters on the temperature, using an Arrhenius‐type equation. Recorded findings show that model parameters changed with the temperature, thus confirming that the proposed model can be advantageously used to describe the dehydration kinetic of TPS. The influence of TPS dehydration on temperature was also assessed by calculating the dehydration rate as function of TPS water content. Results demonstrate that the dehydration rate increases as the testing temperature increases too. In both drying stages, the difference between the dehydration rate at 50 °C and the one at the other two temperatures is more marked. [ABSTRACT FROM AUTHOR]

The double oxalates MI3[MIII(C2O4)3] possess rich crystallochemistry and can be used as precursors for various ceramic materials. The article discusses a case of Li3[Al(C2O4)3]. A series of previously unknown hydrates (Li3[Al(C2O4)3] ⋅ 5.5H2O, Li3[Al(C2O4)3] ⋅ 4H2O, Li3[Al(C2O4)3] ⋅ H2O) was found for this composition, their crystal structure and temperatures of mutual transformations determined. Transformation from Li3[Al(C2O4)3] ⋅ 4H2O to Li3[Al(C2O4)3] ⋅ H2O was found to be accompanied by a change in the topology of the bonding network. Uniaxial negative thermal expansion was found for anhydrous Li3[Al(C2O4)3]. Thermal decomposition of Li3[Al(C2O4)3] was demonstrated to be a promising way to obtain precursors for aluminate ceramics. [ABSTRACT FROM AUTHOR]

Background: Oral fluid intake decreases in advanced cancer in the dying phase of illness. There is inadequate evidence to support the assessment, and management, of hydration in the dying. Bioelectrical impedance analysis (BIA) is a body composition assessment tool. BIA has the potential to inform clinal management in advanced cancer, by examining the relationships between hydration status and clinical variables. Aim: BIA was used to determine the association between hydration status, symptoms, clinical signs, quality-of-life and survival in advanced cancer, including those who are dying (i.e. in the last week of life). Materials and methods: We conducted a prospective observational study of people with advanced cancer in three centres. Advance consent methodology was used to conduct hydration assessments in the dying. Total body water was estimated using the BIA Impedance index (Height – H (m)2 /Resistance – R (Ohms)). Backward regression was used to identify factors (physical signs, symptoms, quality of life) that predicted H2/R. Participants in the last 7 days of life were further assessed with BIA to assess hydration changes, and its relationship with clinical outcomes. Results: One hundred and twenty-five people participated (males n = 74 (59.2%), females, n = 51 (40.8%)). We used backward regression analysis to describe a statistical model to predict hydration status in advanced cancer. The model demonstrated that 'less hydration' (lower H2/R) was associated with female sex (Beta = -0.39, p < 0.001), increased appetite (Beta = -0.12, p = 0.09), increased dehydration assessment scale score (dry mouth, dry axilla, sunken eyes - Beta = -0.19, p = 0.006), and increased breathlessness (Beta = -0.15, p = 0.03). 'More hydration' (higher H2/R) was associated with oedema (Beta = 0.49, p < 0.001). In dying participants (n = 18, 14.4%), hydration status (H2/R) was not significantly different compared to their baseline measurements (n = 18, M = 49.6, SD = 16.0 vs. M = 51.0, SD = 12.1; t(17) = 0.64, p = 0.53) and was not significantly associated with agitation (rs = -0.85, p = 0.74), pain (rs = 0.31, p = 0.23) or respiratory tract secretions (rs = -0.34, p = 0.19). Conclusions: This is the first study to use bioimpedance to report a model (using clinical factors) to predict hydration status in advanced cancer. Our data demonstrates the feasibility of using an advance consent method to conduct research in dying people. This method can potentially improve the evidence base (and hence, quality of care) for the dying. Future BIA research can involve hydration assessment of cancers (according to type and stage) and associated variables (e.g., stage of illness, ethnicity and gender). Further work can use BIA to identify clinically relevant outcomes for hydration studies and establish a core outcome set to evaluate how hydration affects symptoms and quality-of-life in cancer. Key message: What is already known about this topic? - Oral fluid intake decreases in people with advanced cancer, especially when they approach the dying phase of their illness. - There is inadequate evidence to support hydration assessment and decision making in the dying phase of illness. - It is important to understand which clinical factors are associated with hydration status in advanced cancer, to enable healthcare professionals, to evaluate hydration status and support clinical decision making. - Bioimpedance is a non-invasive technology, which has potential to identify clinically relevant variables for cancer hydration assessment. What this paper adds. - This is the first study to use bioimpedance to report a model (using clinical factors) to predict hydration status in advanced cancer. - The variables with combined significance for predicting hydration status were biological sex, appetite, dry mouth, dry axilla, sunken eyes, breathlessness and oedema. In the dying phase, hydration status did not significantly change compared to baseline, and hydration status was not significantly associated with survival. Implications for practice, theory or policy. - Further work can use bioimpedance to identify clinically relevant outcomes for hydration studies, to establish a core outcome set to evaluate how hydration affects symptoms and quality-of-life in cancer. [ABSTRACT FROM AUTHOR]

Hydration status plays a key role in healthy ageing, and it is potentially affected by several factors, including drug consumption. However, research on this issue to date is scarce, especially in highly vulnerable groups, such as the elderly. We aimed to study the relationship linking hydration status, analysed by means of a validated questionnaire, 24 h urine analysis, body composition assessment, and drug consumption in a sample of old adults. A total of 144 elders were included in the study. Cardiovascular drug consumption was significantly associated with a lower water intake in men (β = −0.282, p = 0.029). Moreover, urinary analysis revealed that total drug intake as well as the consumption of diuretics and cardiovascular drugs were associated with poorer hydration status, whereas genito-urinary drugs were associated with an opposite effect, and these results were confirmed in terms of body composition. Hence, total drug consumption (β = −0.205), diuretic (β = −0.408), cardiovascular (β = −0.297), and genito-urinary drugs (β = 0.298) were significantly associated (p < 0.05) with total body water. The obtained results confirmed the impact of chronic treatment with certain drugs on hydration status. Nutritional interventions may be of great interest in certain population groups in order to prevent complications due to altered hydration status. [ABSTRACT FROM AUTHOR]

The harsh and dry conditions of desert environments have resulted in genomic adaptations, allowing for desert organisms to withstand prolonged drought, extreme temperatures, and limited food resources. Here, we present a comprehensive exploration of gene expression across five tissues (kidney, liver, lung, gastrointestinal tract, and hypothalamus) and 19 phenotypic measurements to explore the whole-organism physiological and genomic response to water deprivation in the desert-adapted cactus mouse (Peromyscus eremicus). The findings encompass the identification of differentially expressed genes and correlative analysis between phenotypes and gene expression patterns across multiple tissues. Specifically, we found robust activation of the vasopressin renin-angiotensin-aldosterone system (RAAS) pathways, whose primary function is to manage water and solute balance. Animals reduced food intake during water deprivation, and upregulation of PCK1 highlights the adaptive response to reduced oral intake via its actions aimed at maintained serum glucose levels. Even with such responses to maintain water balance, hemoconcentration still occurred, prompting a protective downregulation of genes responsible for the production of clotting factors while simultaneously enhancing angiogenesis which is thought to maintain tissue perfusion. In this study, we elucidate the complex mechanisms involved in water balance in the desert-adapted cactus mouse, P. eremicus. By prioritizing a comprehensive analysis of whole-organism physiology and multi-tissue gene expression in a simulated desert environment, we describe the complex response of regulatory processes. [ABSTRACT FROM AUTHOR]

Combat sports athletes often undergo rapid body mass loss (BML), which presents health risks. Hydration testing has been proposed as a possible solution to reduce or eliminate rapid BML. However, combat sports athletes may exhibit distinct physiological characteristics due to repeated exposure to BML. Thus, traditional and emerging hydration biomarkers should be investigated to determine their potential suitability for field use in this cohort. This study examined whether BML can explain changes in serum and urine osmolality (SosmΔ, UosmΔ), tear osmolarity (TosmΔ), hematocrit (HctΔ), and urine‐specific gravity (USGΔ) after mild–moderate passive dehydration. Biomarker reliability was also assessed across two trials. Fifteen male and female combat sports athletes (age: 26.3 ± 5.3 years, body mass: 67.7 ± 9.9 kg) underwent a sauna protocol twice (5–28 days apart) aiming for 4% BML. The average BML in Trials 1 and 2 was 3.0 ± 0.7%. Regression analysis revealed that BML explained HctΔ (R2 = 0.22, p = 0.009) but not SosmΔ (R2 = 0.11, p = 0.079) or other biomarkers. Intraclass correlation coefficients (ICCs) were significant for all biomarkers except TosmΔ (ICC = 0.06, p = 0.37) and post‐Tosm (ICC = 0.04, p = 0.42); post‐Hct performed best (ICC = 0.82, p < 0.001). Contingency tables with post‐Sosm (295 mOsm/kg) and post‐USG (1.020) cutoffs revealed an 80% true negative rate (TNR) and a 62% true positive rate (TPR). Increasing the Sosm cutoff to 301 mOsm/kg decreased the TNR to 52% but increased the TPR to 83%. Although blood parameters were most sensitive to BML, they could only explain 11%–22% of biomarker variation. The typical USG cutoff misclassified 42% of athletes postdehydration, and reliability was generally poor‐moderate. Alternative strategies should be pursued to manage rapid BML in combat sports. [ABSTRACT FROM AUTHOR]

Background: Sleeve gastrectomy (SG) increased in popularity after 2010 but recent data suggest it has concerning rates of gastroesophageal reflux and need for conversions. This study aims to evaluate recent trends in the utilization of bariatric procedures, associated complications, and conversions using an administrative claims database in the United States. Methods: We included adults who had bariatric procedures from 2000 to 2020 with continuous enrollment for at least 6 months in the MarketScan Commercial Claims and Encounters database. Index bariatric procedures and subsequent revisions or conversions were identified using CPT codes. Baseline comorbidities and postoperative complications were identified with ICD-9-CM and ICD-10 codes. Cumulative incidences of complications were estimated at 30-days, 6-months, and 1-year and compared with stabilized inverse probability of treatment weighted Kaplan–Meier analysis. Results: We identified 349,411 bariatric procedures and 5521 conversions or revisions. The sampled SG volume appeared to begin declining in 2018 while Roux-en-Y gastric bypass (RYGB) remained steady. Compared to RYGB, SG was associated with lower 1-year incidence [aHR, (95% CIs)] for 30-days readmission [0.65, (0.64–0.68)], dehydration [0.75, (0.73–0.78)], nausea or vomiting [0.70, (0.69–0.72)], dysphagia [0.55, (0.53–0.57)], and gastrointestinal hemorrhage [0.43, (0.40–0.46)]. Compared to RYGB, SG was associated with higher 1-year incidence [aHR, (95% CIs)] of esophagogastroduodenoscopy [1.13, (1.11–1.15)], heartburn [1.38, (1.28–1.49)], gastritis [4.28, (4.14–4.44)], portal vein thrombosis [3.93, (2.82–5.48)], and hernias of all types [1.36, (1.34–1.39)]. There were more conversions from SG to RYGB than re-sleeving procedures. SG had a significantly lower 1-year incidence of other non-revisional surgical interventions when compared to RYGB. Conclusions: The overall volume of bariatric procedures within the claims database appeared to be declining over the last 10 years. The decreasing proportion of SG and the increasing proportion of RYGB suggest the specific complications of SG may be driving this trend. Clearly, RYGB should remain an important tool in the bariatric surgeon's armamentarium. [ABSTRACT FROM AUTHOR]

The McMurdo Dry Valleys in Southern Victoria Land, Antarctica, are known for their extreme aridity, cold, and nutrient‐poor conditions. These valleys provide a valuable comparison to environments on Mars. The survival of microorganisms in these areas hinges on their ability to withstand dehydration due to the limited availability of liquid water. Some microorganisms have adapted to survive extended periods of metabolic inactivity and dehydration, a physiological response to the harsh conditions in which they exist. This adaptation is significant for astrobiology studies as it allows for testing the resilience of microorganisms under extraterrestrial conditions, exploring the boundaries and potential for life beyond Earth. In this study, we examined the survivability, metabolic activity, cellular membrane integrity, and ultrastructural damage of Cryomyces antarcticus, a eukaryotic organism used for astrobiological studies, following two dehydration processes. We conducted a fast dehydration process, simulating what happens on the surface of Antarctic rocks under typical environmental conditions, and a slow dehydration process, which is commonly used in astrobiological experiments. Our findings revealed a higher percentage of damaged cells following slow dehydration treatments, confirming that rapid dehydration reflects the adaptability of microorganisms to respond to sudden and drastic changes in the Antarctic environment. [ABSTRACT FROM AUTHOR]

We document the complex interaction between metamorphic reactions and deformation behaviour at high‐pressure conditions by combining (micro‐) structural, petrographical and geochemical data from an eclogite body. The well‐equilibrated eclogite fabric is crosscut by mineral veins. Precipitated veins host the eclogitic high‐pressure assemblage with variation in modal composition, indicating that fracturing occurred at eclogite facies conditions. Deflection of the eclogite fabric adjacent to the veins implies ductile reactivation of the veins as flanking structures and strain localization under continuous aseismic shearing. In consequence, the reactivated veins are characterized by undulatory extinction and subgrain formation in quartz indicating crystal plasticity. We show that prograde post‐eclogitization metamorphism resulted in progressive dehydration and melting of the eclogite. Subsequent increase in pore‐pressure‐induced rock failure. The mesoscopic to microscopic characteristics of eclogite‐facies veins indicate a cyclic behaviour of fracturing, vein formation and crystal‐plasticity which demonstrates the strong interaction of chemical and mechanical processes operating at depth. [ABSTRACT FROM AUTHOR]

BACKGROUND: Five computational intelligence approaches, namely Gaussian process regression (GPR), artificial neural network (ANN), decision tree (DT), ensemble of trees (EoT) and support vector machine (SVM), were used to describe the evolution of moisture during the dehydration process of glutinous rice. The hyperparameters of the models were optimized with three strategies: Bayesian optimization, grid search and random search. To understand the parameters that facilitate intelligence model adaptation to the dehydration process, global sensitivity analysis (GSA) was used to compute the impact of the input variables on the model output. RESULT: The result shows that the optimum computational intelligence techniques include the 3‐9‐1 topology trained with Bayesian regulation function for ANN, Gaussian kernel function for SVM, Matérn covariance function combined with zero mean function for GPR, boosting method for EoT and 4 minimum leaf size for DT. GPR has the highest performance with R2 of 100% and 99.71% during calibration and testing of the model, respectively. GSA reveals that all the models significantly rely on the variation in time as the main factor that affects the model outputs. CONCLUSION: Therefore, the computational intelligence models, especially GPR, can be applied for an effective description of moisture evolution during small‐scale and industrial dehydration of glutinous rice. © 2024 Society of Chemical Industry. [ABSTRACT FROM AUTHOR]