Search

This paper is an attempt to extend the debate on language policy development, which so far has been dominated by African linguists and language policy planners. Little attempt has been made in the mathematics education field to highlight the discriminatory nature of some language policies, be they national or institutional polices. Dominant societies have used language to discriminate against other minority groups in numerous societies all over the world. Most research studies on language as a linguistic capital have been conducted by members of the privileged groups and the recommendations that have accompanied such studies do not provide a practical solution as to how the ‘suppressed’ minorities could be ‘liberated’ and be able to participate in their societies in a meaningful way. While language policies have affected immigrants in most European countries, it is a different story in Africa. In Africa the people most affected by discriminatory policies are the indigenous population. The paper presents a case study of one country in Africa where the language policy has been a big obstacle to indigenous learners’ quest to gain access to tertiary education. The paper compares learners’ achievement in English language and mathematics. I argue in this paper that proficiency in English language does not necessarily mean success in mathematics.

Generation of functionally mature organs requires exquisite control of transcriptional programs governing cell state transitions during development. Despite advances in understanding the behavior of adult intestinal stem cells and their progeny, the transcriptional regulators that control the emergence of the mature intestinal phenotype remain largely unknown. Using mouse fetal and adult small intestinal organoids, we uncover transcriptional differences between the fetal and adult state and identify rare adult-like cells present in fetal organoids. This suggests that fetal organoids have an inherent potential to mature, which is locked by a regulatory program. By implementing a CRISPR-Cas9 screen targeting transcriptional regulators expressed in fetal organoids, we establish Smarca4 and Smarcc1 as important factors safeguarding the immature progenitor state. Our approach demonstrates the utility of organoid models in the identification of factors regulating cell fate and state transitions during tissue maturation and reveals that SMARCA4 and SMARCC1 prevent precocious differentiation during intestinal development.

The sebaceous gland (SG) is an essential component of the skin, and SG dysfunction is debilitating 1,2 . Yet, the cellular bases for its origin, development and subsequent maintenance remain poorly understood. Here, we apply large-scale quantitative fate mapping to define the patterns of cell fate behaviour during SG development and maintenance. We show that the SG develops from a defined number of lineage-restricted progenitors that undergo a programme of independent and stochastic cell fate decisions. Following an expansion phase, equipotent progenitors transition into a phase of homeostatic turnover, which is correlated with changes in the mechanical properties of the stroma and spatial restrictions on gland size. Expression of the oncogene KrasG12D results in a release from these constraints and unbridled gland expansion. Quantitative clonal fate analysis reveals that, during this phase, the primary effect of the Kras oncogene is to drive a constant fate bias with little effect on cell division rates. These findings provide insight into the developmental programme of the SG, as well as the mechanisms that drive tumour progression and gland dysfunction.

The processes involved in renewal of the epithelium that lines the mouse stomach remain unclear. Apart from the cells in the isthmus, several other populations located deeper in the gastric glands have been suggested to contribute to the maintenance of the gastric epithelium. Here, we reveal that Lrig1 is expressed in the basal layer of the forestomach and the lower part of glands in the corpus and pylorus. In the glandular epithelium of the stomach, Lrig1 marks a heterogeneous population comprising mainly non-proliferative cells. Yet, fate-mapping experiments using a knock-in mouse line expressing Cre specifically in Lrig1 + cells demonstrate that these cells are able to contribute to the long-term maintenance of the gastric epithelium. Moreover, when cultured in vitro, cells expressing high level of Lrig1 have much higher organoid forming potential than the corresponding cellular populations expressing lower levels of Lrig1. Taken together, these observations show that Lrig1 is expressed primarily by differentiated cells, but that these cells can be recruited to contribute to the maintenance of the gastric epithelium. This confirms previous observations that cells located in the lower segments of gastric glands can participate in tissue replenishment.

The prognostic relevance of masked uncontrolled hypertension (MUCH) is incompletely clear, and its global impact on cardiovascular outcomes and mortality has not been assessed. The aim of this study was to perform a meta-analysis on the prognostic value of MUCH. We searched for articles assessing outcome in patients with MUCH compared with those with controlled hypertension (CH) and reporting adjusted hazard ratio and 95% CI. We identified 6 studies using ambulatory blood pressure monitoring (12 610 patients with 933 events) and 5 using home blood pressure measurement (17 742 patients with 394 events). The global population included 30 352 patients who experienced 1327 events. Selected studies had cardiovascular outcomes and all-cause mortality as primary outcome, and the main result is a composite of these events. The overall adjusted hazard ratio was 1.80 (95% CI, 1.57-2.06) for MUCH versus CH. Subgroup meta-analysis showed that adjusted hazard ratio was 1.83 (95% CI, 1.52-2.21) in studies using ambulatory blood pressure monitoring and 1.75 (95% CI, 1.38-2.20) in those using home blood pressure measurement. Risk was significantly higher in MUCH than in CH independently of follow-up length and types of studied events. MUCH was at significantly higher risk than CH in all ethnic groups, but the highest hazard ratio was found in studies, including black patients. Risk of cardiovascular events and all-cause mortality is significantly higher in patients with MUCH than in those with CH. MUCH detected by ambulatory or home blood pressure measurement seems to convey similar prognostic information.

: Document reviewers: Guy De Backer (ESC Review Co-ordinator) (Belgium), Anthony M. Heagerty (ESH Review Co-ordinator) (UK), Stefan Agewall (Norway), Murielle Bochud (Switzerland), Claudio Borghi (Italy), Pierre Boutouyrie (France), Jana Brguljan (Slovenia), Héctor Bueno (Spain), Enrico G. Caiani (Italy), Bo Carlberg (Sweden), Neil Chapman (UK), Renata Cifkova (Czech Republic), John G. F. Cleland (UK), Jean-Philippe Collet (France), Ioan Mircea Coman (Romania), Peter W. de Leeuw (The Netherlands), Victoria Delgado (The Netherlands), Paul Dendale (Belgium), Hans-Christoph Diener (Germany), Maria Dorobantu (Romania), Robert Fagard (Belgium), Csaba Farsang (Hungary), Marc Ferrini (France), Ian M. Graham (Ireland), Guido Grassi (Italy), Hermann Haller (Germany), F. D. Richard Hobbs (UK), Bojan Jelakovic (Croatia), Catriona Jennings (UK), Hugo A. Katus (Germany), Abraham A. Kroon (The Netherlands), Christophe Leclercq (France), Dragan Lovic (Serbia), Empar Lurbe (Spain), Athanasios J. Manolis (Greece), Theresa A. McDonagh (UK), Franz Messerli (Switzerland), Maria Lorenza Muiesan (Italy), Uwe Nixdorff (Germany), Michael Hecht Olsen (Denmark), Gianfranco Parati (Italy), Joep Perk (Sweden), Massimo Francesco Piepoli (Italy), Jorge Polonia (Portugal), Piotr Ponikowski (Poland), Dimitrios J. Richter (Greece), Stefano F. Rimoldi (Switzerland), Marco Roffi (Switzerland), Naveed Sattar (UK), Petar M. Seferovic (Serbia), Iain A. Simpson (UK), Miguel Sousa-Uva (Portugal), Alice V. Stanton (Ireland), Philippe van de Borne (Belgium), Panos Vardas (Greece), Massimo Volpe (Italy), Sven Wassmann (Germany), Stephan Windecker (Switzerland), Jose Luis Zamorano (Spain).The disclosure forms of all experts involved in the development of these Guidelines are available on the ESC website www.escardio.org/guidelines.

Early and accurate diagnosis of new plant pathogens is vital for the rapid implementation of effective mitigation strategies and appropriate regulatory responses. Most commonly, pathogen identification relies on morphology and DNA marker analysis. However, for new diseases, these approaches may not be sufficient for precise diagnosis. In this study, we used whole-genome sequencing (WGS) to identify the causal agent of a new disease affecting Sarcococca hookeriana (sarcococca). Blight symptoms were observed on sarcococca and adjacent Buxus sempervirens (boxwood) plants in Maryland during 2014. Symptoms on sarcococca were novel, and included twig dieback and dark lesions on leaves and stems. A Calonectria sp. was isolated from both hosts and used to fulfill Koch's postulates but morphology and marker sequence data precluded species-level identification. A 51.4-Mb WGS was generated for the two isolates and identified both as Calonectria pseudonaviculata. A single-nucleotide polymorphism at a noncoding site differentiated between the two host isolates. These results indicate that the same C. pseudonaviculata genotype has the ability to induce disease on both plant species. This study marks the first application of WGS for fungal plant pathogen diagnosis and demonstrates the power of this approach to rapidly identify causal agents of new diseases.

In fibroblasts, platelet-derived growth factor receptor alpha (PDGFRα) is upregulated during growth arrest and compartmentalized to the primary cilium. PDGF-AA mediated activation of the dimerized ciliary receptor produces a phosphorylation cascade through the PI3K-AKT and MEK1/2-ERK1/2 pathways leading to the activation of the Na(+)/H(+) exchanger, NHE1, cytoplasmic alkalinization and actin nucleation at the lamellipodium that supports directional cell migration. We here show that AKT and MEK1/2-ERK1/2-p90(RSK) inhibition reduced PDGF-AA-induced cell migration by distinct mechanisms: AKT inhibition reduced NHE1 activity by blocking the translocation of NHE1 to the cell membrane. MEK1/2 inhibition did not affect NHE1 activity but influenced NHE1 localization, causing NHE1 to localize discontinuously in patches along the plasma membrane, rather than preferentially at the lamellipodium. We also provide direct evidence of NHE1 translocation through the cytoplasm to the leading edge. In conclusion, signals initiated at the primary cilium through the PDGFRαα cascade reorganize the cytoskeleton to regulate cell migration differentially through the AKT and the MEK1/2-ERK1/2-p90(RSK) pathways. The AKT pathway is necessary for initiation of NHE1 translocation, presumably in vesicles, to the leading edge and for its activation. In contrast, the MEK1/2-ERK1/2-p90(RSK) pathway controls the spatial organization of NHE1 translocation and incorporation, and therefore specifies the direction of the leading edge formation.

Background: Terutroban is a selective prostaglandin endoperoxide (TP) receptor antagonist with antithrombotic, antivasoconstrictive and antiatherosclerotic properties and is currently in development for long-term cardiovascular secondary prevention., Objectives: TAIPAD is an international, double-blind, randomized controlled study comparing the effects of five dosages of oral terutroban vs. aspirin and placebo on platelet aggregation in peripheral arterial disease (PAD) patients., Patients/methods: After 10 day's placebo run-in, included patients (n = 435; ankle-brachial pressure index, 0.7 ± 0.1) were randomly allocated to aspirin 75 mg day(-1), terutroban 1, 2.5, 5, 10 or 30 mg day(-1) or placebo. On day 5, the placebo group was reallocated to one of the terutroban groups for the rest of the study (day 83). Ex vivo platelet aggregation induced by the thromboxane analog U46619 (7 μm) was measured 24 h after dosing, as well as platelet aggregation induced by arachidonic acid (AA), collagen and ADP., Results: Terutroban dose-dependently inhibited U46619-induced platelet aggregation at days 5 and 83. At day 5, the inhibition was significant vs. placebo for all terutroban dosages (P < 0.001). Terutroban (5, 10 and 30 mg day(-1)) was at least as effective as aspirin in inhibiting platelet aggregation induced by arachidonic acid (AA), collagen and adenosine diphosphate (ADP). Terutroban was well tolerated, with a safety profile similar to aspirin., Conclusions: In PAD patients, terutroban dose-dependently inhibited platelet aggregation 24 h after dosing, and was at least as effective as aspirin at 5, 10 and 30 mg day(-1). Terutroban was well tolerated., (© 2010 International Society on Thrombosis and Haemostasis.)

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

Our objective was to assess the prognostic significance of the night-time dipping pattern and the night-day blood pressure (BP) ratio for mortality and cardiovascular events in hypertensive patients without major cardiovascular disease at baseline. We performed a meta-analysis on individual data of 3468 patients from four prospective studies performed in Europe. Age of the subjects averaged 61+/-13 years; 45% were men and 61% were under antihypertensive treatment at the time of ambulatory BP monitoring. The night-day BP ratio and 24-h BP averaged, respectively, 0.907+/-0.085/0.866+/-0.095 and 138.1+/-16.4/82.3+/-11.0 mm Hg. Total follow-up time amounted to 23 164 patient-years. We used multivariable Cox regression analysis to assess the outcome of reverse dippers, non-dippers and extreme dippers vs dippers, and to assess the hazard ratios associated with 1 standard deviation higher night-day BP ratio. In comparison with dippers, and with adjustment for confounders and 24-h BP, the incidence of cardiovascular events was worse in reverse dippers (P

Hypertension is a known risk factor for cardiovascular events, and recent data have pointed to peripheral arterial disease (PAD) as another strong risk factor; together, they cause a surprisingly high total risk. This review deals with the clinical management of this dangerous association. The ankle-brachial index helps in the diagnosis of PAD and the estimation of risk. To control risk, lifestyle adaptation is essential. There is no consensus on a first choice of antihypertensive drug. Arguments favor angiotensin-converting enzyme inhibitors, but most patients require several antihypertensive drugs to reach goal pressure (140/90 mm Hg or lower). Moreover, to control the risk of PAD, antiplatelet drugs, antihypertensive drugs, and statins are recommended.

Objective: To assess the prognostic significance of nighttime and daytime blood pressure (BP), their ratio and the nighttime dipping pattern for mortality and recurrent cardiovascular (CV) events in patients with CV disease at baseline., Background: The prognostic value of ambulatory BP has not been reported in hypertensive patients with a history of CV disease., Methods: We performed a meta-analysis on individual data of 302 patients with hypertension and CV disease from three prospective studies performed in Europe., Results: Age of the patients averaged 69+/-9 years; 50% were men and 62% were under antihypertensive treatment at the time of ambulatory BP monitoring. Office, daytime and nighttime BP averaged 161+/-20/86+/-12, 144+/-16/83+/-11 and 132+/-18/72+/-12 mmHg. Total follow-up time amounted to 2049 patient--years. Multivariable Cox regression analysis revealed that nighttime BP, but not daytime BP significantly predicted CV mortality (P< or =0.05) and major CV events (P< or =0.01) after adjustment for office BP and other confounders. When both nighttime and daytime BP were entered into the models, the predictive power of nighttime BP remained significant (P< or =0.05); daytime BP did not add prognostic precision to nighttime BP. The systolic nightday BP ratio predicted all outcomes, and outcome was significantly worse in reverse dippers and nondippers than in dippers, both before and after adjustment for 24-h BP (P< or =0.05)., Conclusion: Nighttime BP is the better predictor of death and recurrent CV events in hypertensive patients with a history of CV disease. The night-day BP ratio and the dipping pattern significantly predict outcome, even after adjustment for 24-h BP.

Our aim was to assess the prognostic significance of nighttime and daytime ambulatory blood pressure and their ratio for mortality and cause-specific cardiovascular events in hypertensive patients without major cardiovascular disease at baseline. We performed a meta-analysis on individual data of 3468 patients from 4 prospective studies performed in Europe. Age of the subjects averaged 61+/-13 years, 45% were men, 13.7% smoked, 8.4% had diabetes, and 61% were under antihypertensive treatment at the time of ambulatory blood pressure monitoring. Office, daytime, and nighttime blood pressure averaged 159+/-20/91+/-12, 143+/-17/87+/-12, and 130+/-18/75+/-12 mm Hg. Total follow-up amounted to 23 164 patient-years. We used multivariable Cox regression analysis to assess the hazard ratios associated with 1 standard deviation higher blood pressure. Daytime and nighttime systolic blood pressure predicted all-cause and cardiovascular mortality, coronary heart disease, and stroke, independently from office blood pressure and confounding variables. When these blood pressures were entered simultaneously into the models, nighttime blood pressure predicted all outcomes, whereas daytime blood pressure did not add prognostic precision to nighttime pressure. Appropriate interaction terms indicated that the results were similar in men and women, in younger and older patients, and in treated and untreated patients The systolic night-day blood pressure ratio predicted all outcomes, which only persisted for all-cause mortality after adjustment for 24-hour blood pressure. In conclusion, nighttime blood pressure is in general a better predictor of outcome than daytime pressure in hypertensive patients, and the night-day blood pressure ratio predicts mortality, even after adjustment for 24-hour blood pressure.