Search

Food safety is a serious issue worldwide and practical detection method is vital for the supervision of food safety. It is necessary to establish efficient and economical methods to detect antibiotics, especially antibiotics in complex systems. This study employs citric acid and m-phenylenediamine to synthesize N, P-codoped carbon dots (N, P-CDs) by a microwave-assisted method. Anhydrous ethanol and phosphoric acid are essential to the properties of N, P-CDs. A "turn-on" fluorescent probe based on N, P-CDs was established for detecting ciprofloxacin (CIP) with detection limit down to 24.2 nm. Semiquantitative test stripe and a PS color detection system for CIP were developed to achieve visual and smart detection. The test stripe is applied to the visual detection of CIP residues in milk and a popular Chinese cuisine, Malatang, for the first time. N, P-CDs can also be used to detect pH in the range of pH 7.5-12., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

Background: In the process of food production, ciprofloxacin (CIP), a highly prescribed fluoroquinolone antibiotic, is often excessively used to reduce the risk of bacterial infection. However, this overuse can cause severe harm to human health, including allergic responses, gastrointestinal complications, and potential renal dysfunction. The development of a robust and precise detection method for CIP is crucial, given the interconnection between food security and human health. Compared to the single-mode detection methods currently in use, dual-mode detection provides enhanced accuracy in detecting results due to its inherent self-validation and self-correction capabilities., Results: Herein, a photoelectrochemical and photoelectrochromic self-validated dual-mode sensing platform was developed to detect CIP in milk by laser etching method, signal generation (SG) region, signal output (SO) region and conductive channel was integrated on the same fluoide-doped tin oxide electrode and Ti 3 C 2 /ZnO composite was modified in the electron SG region, and Prussian blue (PB) was electrodeposited in the SO region. By irradiating the SG region, photogenerated electrons are generated and injected into the SO region through the conductive pathway, resulting in the reduction of the PB to Prussian white (PW). Because the binding of CIP to its specifically recognized aptamers hinders electron transfer, a "Signal-Off" response mechanism can be used for simultaneous quantitative detection of CIP using photocurrent or color changes, which presents a great advantage in the detection process., Significance: By integrating different detection mechanisms within a single linear range, the constructed dual-mode sensor has a wide detection range and low detection limit in milk samples. Additionally, it shows good selectivity in anti-interference experiments, providing a new idea for the development of visual analysis and detection platforms for food safety., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Additive abuse in fishery, such as tricaine methanesulfonate (MS222), ciprofloxacin (CPFX), and malachite green (MG), threatens public human health and interferes with the ecological equilibrium of water resources. However, the majority of the present detection methods suffer from high costs, complex operations, and poor portability. Therefore, real-time and rapid detection of the above additive by mobile devices is becoming increasingly important. Here we report the fabrication and performance of an entirely electrochemical system with USB-stick size for simultaneous detection of MS222, CPFX, and MG, as well as pH and permittivity. The limits of detections are 0.17, 0.67, and 0.28 µg/mL, while the resolution ratios are 10 %, 10 %, and 5 % for MS222, MG, and CPFX, respectively. For both pH and permittivity, they have linear regressions measured by brightness and capacitance of the sample respectively, at the range of 1.5-9 (pH) and 10-20 (permittivity). The interference experiments, using target analytes (40 μg/mL) and 15 interfering analytes (80 μg/mL), demonstrated the anti-interference performance of the sensor patches. The field studies on carps, catfishes, and chubs indicated that the developed integrated portable system could be used for real sample analysis with high performance., Competing Interests: Declaration of Competing Interest We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service, and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled, “Fully integrated sensor array for additives, permittivity, and pH monitoring for fishery”., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Fast and sensitive quantification of drugs as emerging pollutants in water bodies is a pressing need in contemporary society, to prevent serious environmental concerns that could negatively impact on human health. This explains the surge of interest in this field, and the need to identify highly selective sensing systems. Addressing this issue, in this work we synthesized two D-glucamine functionalized fluorophores bearing self-assembling cores, as 1,8-naphthalimide and naphthalene diimide. We studied their self-assembly in water solution, and characterized the aggregated formed by determining their stability constant, their morphology and size by scanning electron microscopy, resonance light scattering and dynamic light scattering, as well their solid-state emission ability. Then, we studied their sensing ability, in water, towards pharmaceutically active compounds such as ciprofloxacin, nalidixic acid, carbamazepine and diclofenac sodium salt, by fluorescence investigation. Data collected show that the self-assembling ability is significantly affected by the fluorophore structure, which in turn also determines sensing ability. In particular, the naphtalene diimide-based probe was the most sensitive, with LOD as low as 0.01 μM in the presence of nalidixic acid, which is in line and competitive with more complex sensing systems, recently reported in the literature., (© 2024 The Author(s). Chemistry - A European Journal published by Wiley-VCH GmbH.)

Novel boron-doped carbon dots (BCDs) with extended afterglow characteristics were synthesized via a one-step solvothermal method using acrylamide, sulfosalicylic acid, and sodium tetraborate as protective matrices. The presence of boron from sodium tetraborate introduced an empty orbital, allowing it to form a more extended conjugated system with adjacent oxygen atoms, thereby lowering the energy level of the lowest unoccupied molecular orbital in the system. The phosphorescence emission of these BCDs exhibits a red shift over time from 450 to 500 nm. These BCDs have been effectively utilized to produce anti-counterfeit phosphorescent powder. Additionally, the BCDs display optimal fluorescence excitation at 330 nm and optimal emission at 420 nm. They demonstrate a detection limit for ciprofloxacin hydrochloride of 37 nM in the 1-100 µM concentration range and 26 nM in the 100-210 µM range. This fluorescence detection is governed by an inner filter effect. Real sample testing further confirms that these BCDs serve as excellent sensors for ciprofloxacin hydrochloride., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Exposure to biosolids in human waste handling occupations is associated with a risk for illness due to microbial infections. Although several years of exposure to biosolids might be hypothesized to be a prophylaxis against infection, the risks associated with infections from antibiotic-resistant organisms can also be a potential concern. Therefore, this study aimed to conduct a screening level risk assessment by deriving occupational exposure limits (OELs) characterizing the risks of adverse health effects among workers in human waste handling occupations with a focus on exposure to two pharmaceuticals commonly found in biosolids: ciprofloxacin (CIP) and azithromycin (AZ). Epidemiological and exposure studies of workers exposed to biosolids were identified through searches of major scientific databases. Screening OELs (sOELs) for these antibiotics were derived using a standardized methodology. The airborne concentrations of CIP and AZ antibiotics were determined using an exposure factors approach. The health-based exposure limits (i.e., sOELs) and the acceptable daily exposure (ADE) values for both of these antibiotics were derived as 80 μg/m 3 and 12 μg/kg-day, respectively. An exposure factor approach suggested that inhalation route exposures to CIP and AZ are well below the sOELs and ADE daily doses, and likely too low to cause direct adverse health effects through antibiotic inhalation. A critical review of epidemiological studies on different occupations handling biosolids showed that the workers in industries with potential biosolids exposure have experienced an increased incidence of microbial-exposure-related illness. The health effects seen in the workers have been attributed to bacterial, viral, and protozoan infections. To the extent that bacteria are the pathogen of concern, it is not clear whether these bacteria are resistant to antibiotics commonly found in biosolids. It is also unclear whether the presence of antibiotics or antibiotic-resistant bacteria increases the susceptibility of these workers. Additional studies will provide more definitive estimates of inhalation and dermal exposures to CIP and AZ and could verify the exposure estimates in this study based on the literature and common exposure factors.

Enrofloxacin (EF) is a broad-spectrum and highly efficient antibiotic commonly used for treating diseases in aquatic animals. However, its abuse in aquaculture applications often leads to excess residue in tissues of grass carp (Ctenopharyngodon idella). Hence, this study aimed to estimate the withdrawal time (WT) of EF and its metabolite of ciprofloxacin (CF) administered medicated feed in natural culture environments and conduct a risk assessment. Plasma and tissue samples were gathered at appropriate time points and detected by high-performance liquid chromatography. The data homogeneity was evaluated by Bartlett's test and Cochran's test. The linearity of the regressed line was evaluated by visual inspection and F test. Outliers were estimated on a normal probability scale by plotting the standardized residual versus their cumulative frequency distribution. Finally, the WT was calculated to be 51 days in muscle + skin based on the maximum residue limit of 100 µg/kg. After 51 days, the concentration of EF and CF fell below 10 µg/kg. The estimated daily intake was calculated to be 0.009 µg/kg/d. Hazard quotient was computed to be 0.002, which was far below one. These results suggested that calculated WT of EF could ensure the safety of products from grass carp for humans., (© 2024. The Author(s), under exclusive licence to Springer Nature B.V.)

The prevalent presence of pharmaceuticals in aquatic ecosystems underscores the necessity for developing cost-effective techniques to remove them from water. The utilization of affordable precursors in producing activated carbon, capable of rivaling commercial alternatives, remains a persistent challenge. The adsorption of diclofenac and ciprofloxacin onto a novel pinewood-derived activated carbon (FPWAC) was explored, employing a sequential activation process involving ammonium nitrate (NH 4 NO 3 ) treatment followed by sodium hydroxide (NaOH) activation. The produced FPWAC was then thoroughly characterized by employing several techniques. The removal of diclofenac and ciprofloxacin in water and real wastewater effluent was examined in batch tests. The optimum removal conditions were an FPWAC dosage of 1 g L -1 , pH 6, mixture concentration of 25 mg L -1 , and a temperature of 25 °C. The FPWAC was able to remove both pharmaceuticals for up to six cycles, with more than 95% removal for water and 90% for wastewater in the first cycle. The adsorption performance fitted well with the non-linear Freundlich isotherm for both pollutants. The kinetics of adsorption of diclofenac followed a pseudo-first-order model, while ciprofloxacin showed adherence to the pseudo-second-order model. FPWAC proved its potency as a low-cost adsorbent for pharmaceutical removal from wastewater., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

Introduction: In regenerative endodontics, eradicating antibiotic residues from root canals is imperative, given their detrimental effects on human apical papilla stem cells. Previous antibiotic removal studies lacked precision in identifying types and quantities of residual antibiotics. High-performance liquid chromatography (HPLC) enhances sensitivity and specificity, enabling accurate detection and quantification of residual drugs. Using HPLC analysis, this study explored the influence of vehicles and irrigation solutions and methods on double antibiotic paste (DAP) removal from root canals., Methods: Two DAP formulations, each containing 5 mg/mL ciprofloxacin and metronidazole, were created using distinct vehicles: macrogol and propylene glycol (MP) or hydroxypropyl methylcellulose (HPMC). Subsequently, 5 μL of DAP was applied to 200 simulated immature teeth with open apices (n = 100 per formulation) and cultured for 28 days at 37°C. Samples were then divided into 11 groups (n = 20 per group), and canals were irrigated with 17% ethylenediaminetetraacetic acid or 10% citric acid, employing a positive pressure syringe or passive ultrasonic irrigation. The irrigation solution and dentin sample from each tooth were evaluated via HPLC for ciprofloxacin and metronidazole quantification., Results: Citric acid exhibited significantly superior efficacy in antibiotic removal from root canals, with no observable effect of irrigation methods on drug removal. The HPMC-based DAP formulation significantly enhanced ciprofloxacin removal compared with MP-based DAP., Conclusions: For antibiotic paste removal from root canals, citric acid is effective, and HPMC is a preferable vehicle over MP. Overall, HPLC is a valuable method for detecting, removing, and quantifying residual antibiotics in root canals., (Copyright © 2024 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.)

Based on the previously developed Al 3+ /CuNCs probe, the matrix effect (ME) derived from protein was investigated in the fluorescence determination of fluoroquinolones (FQs) residues in eggs, and a sample pretreatment method was established to rapidly reduce the ME. Molecular docking results indicated that the three main egg proteins and FQs were bound by hydrogen bond, van der Waals force, and alkyl groups, leading to the loss of FQs response signal, and then produced ME. After trichloroacetic acid treatment, the mean particle size of egg matrix decreased, the protein secondary structure changed, and the crystal structure was destroyed. The corresponding ME of the supernatant obtained by centrifugation was only 0.7 %. The standard addition experiment confirmed that the proposed pretreatment method improved the accuracy and reliability of the fluorescence probe. This work is helpful to promote the practical application of fluorescence analysis in the rapid monitoring of food safety hazard factors., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier Ltd.)

The abuse of antibiotics has seriously threatened human health and living environment. Nevertheless, the detection of quinolones is currently mainly performed by high-cost and cumbersome means, such as High-Performance Liquid Chromatography (HPLC). Herein, we reported a novel method based on copper-doped MoO x nanoparticles (Cu-MoO x NPs) with peroxidase-like enhancement activity for the easy preparation, sensitive and rapid visualization of quinolone detection. Cu-MoO x NPs can make the chromogenic substrate 3,3',5,5'-Tetramethylbenzidine (TMB) change from colorless to blue. Moreover, the addition of quantitative quinolone antibiotics can significantly accelerate the TMB oxidation reaction. Based on this phenomenon, a colorimetric method for detecting quinolone antibiotics was established with a good linear relationship ranging from 1 × 10 -6  M to 1.3 × 10 -4  M, and the detection limit was 0.310 μM for ciprofloxacin (CIP) and 0.520 μM for levofloxacin (LVFX). Furthermore, the mechanism was also explored, and the results showed that the peroxidase-like activity of Cu-MoO x NPs was probably derived from the generated OH, 1 O 2 , oxygen vacancies and partially reduced Cu + , and on the other hand was derived from quinolone antibiotics and nanozymes electrostatic interaction between them., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

The simultaneous detection of multiple analytes through a single fluorescence sensor is highly attractive. In this study, phosphorus-doped graphitic carbon nitride quantum dots (P-CNQDs) were developed, achieving multi-mode sensing through three distinct response mechanisms. The preparation involved using melamine as the carbon and nitrogen source and ammonium dihydrogen phosphate as the phosphorus source. Uniform and narrowly distributed P-CNQDs were successfully synthesized through chemical oxidation and hydrothermal methods, with an average size of 2.4 nm. These unique P-CNQDs exhibited fluorescence quenching through photo-induced electron transfer (PET) in response to Ag + . Additionally, the formation of hydrogen bonds and coordination interactions between P-CNQDs-Ag + and ciprofloxacin (CIP) led to a pronounced fluorescence response to CIP by the chelation enhanced fluorescence (CHEF) mechanism. Furthermore, leveraging the principle of fluorescence resonance energy transfer (FRET), P-CNQDs-CIP served as a ratio fluorescence sensor for riboflavin (RF), enabling ultra-sensitive detection of RF. The combination of PET, CHEF, and FRET response mechanisms successfully facilitated multi-mode sensing for Ag + , CIP, and RF. The detection ranges were 0.05-100 μM, 0.002-2 μM, and 0.05-60 μM, with corresponding lowest detection limits of 17.1 nM, 1.1 nM, and 29.2 nM, respectively. This versatile sensor has been effectively applied to real samples, including the detection of river water and vitamin B 2 tablets., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier B.V.)

Portable near-infrared (NIR) spectrophotometers have emerged as valuable tools for identifying substandard and falsified pharmaceuticals (SFPs). Integration of these devices with chemometric and machine learning models enhances their ability to provide quantitative chemical insights. However, different NIR spectrophotometer models vary in resolution, sensitivity, and responses to environmental factors such as temperature and humidity, necessitating instrument-specific libraries that hinder the wider adoption of NIR technology. This study addresses these challenges and seeks to establish a robust approach to promote the use of NIR technology in post-market pharmaceutical analysis. We developed support vector machine and partial least squares regression models based on binary mixtures of lab-made ciprofloxacin and microcrystalline cellulose, then applied the models to ciprofloxacin dosage forms that were assayed with high performance liquid chromatography (HPLC). A receiver operating characteristic (ROC) analysis was performed to set spectrophotometer independent NIR metrics to evaluate ciprofloxacin dosage forms as "meets standard," "needs HPLC assay," or "fails standard." Over 200 ciprofloxacin tablets representing 50 different brands were evaluated using spectra acquired from three types of NIR spectrophotometer with 85% of the prediction agreeing with HPLC testing. This study shows that non-brand-specific predictive models can be applied across multiple spectrophotometers for rapid screening of the conformity of pharmaceutical active ingredients to regulatory standard., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Published by Elsevier B.V.)

Antibiotics are a new type of environmental pollutants. Due to its wide application in many fields, antibiotic residues are ubiquitous in the wastewater environments. Given their potential threat on water ecosystem functioning and public health, the detection of antibiotic residues in wastewater environments has become very necessary. Based on the complexation of Al 3+ with flumequine (FLU), ciprofloxacin (CIP) and doxycycline hydrochloride (DOX), their molecular conjugated area were increased and fluorescence intensity were enhanced, combined with synchronous fluorescence spectrometry (SFS) had good selectivity and high sensitivity, a novel method of Al 3+ sensitized synchronous fluorescence spectrometry for the determination of FLU, CIP and DOX residues in wastewater was established. When the wavelength difference (Δλ) was selected 115.0 nm, synchronous fluorescence spectra of the three antibiotics could be well separated and the interference of wastewater matrix were eliminated primely. The new SFS made good use of spectral separation instead of conventional chemical separation, and the actual wastewater sample could be directly determined after simple filtration. The experiment results showed that the concentrations of FLU, CIP and DOX in the range of 0.5000-800.0 ng·mL -1 , 0.5000-640.0 ng·mL -1 and 10.00-3500 ng·mL -1 had a good linear relationship with fluorescence intensity. The detection limits of three antibiotics were 0.02054 ng·mL -1 , 0.03956 ng·mL -1 and 0.8524 ng·mL -1 , respectively. Recovery rates of three antibiotics in wastewater samples were 90.72%-98.23%, 88.68%-95.08% and 85.94%-96.70%. The new SFS established in this experiment had the advantages of simple, rapid, sensitive, accurate and good selectivity. Simultaneous and rapid detection of FLU, CIP and DOX residues in wastewater was successfully realized. It had good application prospects in real-time water quality monitoring., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper, (Copyright © 2024 Elsevier Ltd. All rights reserved.)

This study aimed to assess the current water quality status across various regions within the Fayoum depression by examining water canals, drains, and potential contaminants impacting public health and the local ecosystem. Additionally, an adsorption treatability investigation was conducted on various antibiotics identified during the assessment. Fifteen sampling points were selected across the Fayoum depression, covering surface water bodies and agricultural drainage systems during both winter and summer seasons. Physico-chemical, microbiological, and antibiotic analyses were performed on collected water samples. The water quality parameters investigated included pH, electrical conductivity, total dissolved solids (TDS), total coliforms, fecal coliforms, and concentrations of antibiotics such as ciprofloxacin and tetracycline. The findings revealed significant variations in water quality parameters among different water sources, categorizing them into three types: irrigation canals, polluted canals, and drains. High contamination levels were observed in certain water canals and drains due to untreated sewage and agricultural drainage discharge. Notably, elevated TDS levels (exceeding 1200 mg/L), microbial indicators count (with total coliforms reaching up to 2.3 × 10 6 CFU/100 mL), and antibiotics (with concentrations of ciprofloxacin and tetracycline exceeding 4.6 µg/L) were detected. To mitigate antibiotic contamination, a Phyto-adsorption treatability study using magnetite nanoparticles prepared with Phragmites australis plant extract demonstrated promising results, achieving complete removal of high antibiotic concentrations with an adsorption capacity of up to 67 mg/g. This study provides updated insights into water quality in the Fayoum depression and proposes a novel approach for addressing antibiotic contamination, potentially safeguarding human and environmental health., (© 2024. The Author(s).)

The effects on the adsorption of fluoroquinolone antibiotics of long-term soil heterogeneity induced by land-use were investigated. Three different land use areas with their two organic matter (OM) pools were tested for the adsorption of three antibiotics widely detected in the environment (ciprofloxacin, norfloxacin, ofloxacin). The soils were separated into two size fractions, > 63 µm fraction and < 63 µm fractions for the fast and slow OM pools, respectively. Any effect of land use on adsorption was only observed in the slow pool in the increasing order: arable land, grassland, and forest. The composition of the soil organic matter (SOM) did influence adsorption in the slow pool, but not in the bulk soilsThis was, because: 1) the ratio of the slow pool was low, as in forest, 2) the ratio of the slow pool was high but its adsorption capacity was low due to its SOM composition, as in arable land and grassland. Soils containing a large slow SOM pool fraction with aliphatic dominance were found to be more likely to adsorb micropollutants. It is our contention that the release of contaminated water, sludge, manure or compost into the environment should only be undertaken after taking this into consideration., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier B.V. All rights reserved.)

An electrochemical sensor based on an electroactive nanocomposite was designed for the first time consisting of electrochemically reduced graphene oxide (ERGO), polyaniline (PANI), and poly(alizarin red S) (PARS) for ciprofloxacin (CIPF) detection. The ERGO/PANI/PARS-modified screen-printed carbon electrode (SPCE) was constructed through a three-step electrochemical protocol and characterized using FTIR, UV-visible spectroscopy, FESEM, CV, LSV, and EIS. The new electrochemical CIPF sensor demonstrated a low detection limit of 0.0021 μM, a broad linear range of 0.01 to 69.8 μM, a high sensitivity of 5.09 μA/μM/cm 2 , and reasonable selectivity and reproducibility. Moreover, the ERGO/PANI/PARS/SPCE was successfully utilized to determine CIPF in milk with good recoveries and relative standard deviation (< 5%), which were close to those with HPLC analysis., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

The research outlined a novel approach for creating a sensitive and efficient ratio fluorescent probe for ciprofloxacin (CIP) detection. The method used the biomass materials passionfruit shell and diethylenetriamine as carbon and nitrogen sources, respectively, to prepare blue fluorescent carbon quantum dots (b-CQDs) with an average size of 3.29 nm and a quantum yield of 19.6% by a hydrothermal method. The newly designed b-CQDs/riboflavin ratio fluorescent probe demonstrates a distinct advantage for CIP monitoring, exhibiting a marked increase in fluorescence intensity at 445 nm upon interaction with CIP, while maintaining a stable intensity at 510 nm. In the water system, the I 445 nm /I 510 nm ratio of the fluorescent probe showed a significant linear relationship with CIP at the concentrations of 0-250 μmol·L -1 , and the probe boasts a low detection limit of 0.86 μmol·L -1 . The outstanding selectivity, broad detection range, low detection limits, and high quantum yield of the b-CQDs highlight their significant potential in the development of advanced sensing probes for efficient detection of ciprofloxacin, offering promising insights for future sensor technology advancements., (© 2024 John Wiley & Sons Ltd.)

Antibiotics as emerging pollutants are frequently detected in surface water, raising concerns about the associated risk of antibiotic resistance genes (ARGs). Despite the widespread apprehension, there are still research gaps in the occurrence of antibiotic pollution in surface water and the associated ecological risks to aquatic organisms in China. Here, we established a dataset of antibiotic pollution in surface water in China during 2018-2022, which encompassed 3 368 concentration values of 128 antibiotics reported in 124 articles. Our analysis showed that antibiotic concentrations were predominantly in the ng/L-μg/L range, reaching up to 26 μg/L. Notably, sulfonamides (e.g., sulfamethoxazole) and quinolones (e.g., ciprofloxacin) were frequently reported at high concentrations. The pollution degree of antibiotics represented by sulfamethoxazole, ciprofloxacin, roxithromycin, and tetracycline exhibited no significant variation across different years but was lower in summer than that in spring and autumn. Additionally, distinct spatial distribution characteristics of the pollution were observed. According to calculation results of the aquatic ecological risk assessment model and the weighted frequency, we proposed a list of priority antibiotics including clarithromycin, erythromycin, sulfamethoxazole, ofloxacin, and oxytetracycline in surface water. Last but not least, this study points out the deficiencies in current research on the occurrence and ecological risks of antibiotics in surface water of China and provides viable screening strategies and monitoring recommendations in this context.

Citizen scientist-based environmental monitoring and public education are becoming increasingly popular. However, current technologies for antibiotic-based novel contaminant identification are still restricted to laboratory sample collection and analysis due to detection methodologies and apparatus limitations. This study developed a time-resolved immunofluorescence-based simultaneous field-based assay for ciprofloxacin (CIP) and enrofloxacin (ENR) that matches test results to geographic locations. The assay helps the public understand the potential levels of antibiotic exposures in their environments and helps them take appropriate action to reduce risk. The assay was developed using smartphones and social software in addition to rapid testing. The method uses a portable, low-cost analytical kit with a smartphone app to build a field-based detection platform for the detection and analysis of ENR and CIP in water and aquatic products. The methodological evaluation was good, with detection limits of 0.4 ng/mL and 0.5 ng/g for ENR in water and fish, and quantification limits of 1.2 ng/mL and 1.4 ng/g, with recoveries of 89.0 %-101.0 % and 78.0 %-97.0 %. For CIP in water and fish, the limits of detection were 0.3 ng/mL and 0.4 ng/g, the limits of quantification were 0.9 ng/mL and 1.2 ng/g, and the recoveries were 75.0 %-91.0 % and 72.0 %-89.0 %, both with coefficients of variation <15 %. These limits were sufficient to prevent the two antibiotics from crossing over during simultaneous detection. The assay was validated using real samples to assess the effectiveness of the assay platform in field deployments, and the results were consistent with those obtained through liquid chromatography-tandem mass spectrometry (LC-MS) and enzyme-linked immunoassay (ELISA) techniques. In addition, the TRFIA assay process requires less time, uses more portable instruments, and is less complex than traditional methods. This study provides a new scientific, accurate, and rapid detection method for antibiotic detection by citizen scientists, helping scientists to obtain a wider range of data and providing more opportunities to solve scientific problems., Competing Interests: Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: ShunLong Meng, Chao Song reports financial support was provided by the Central Public Interest Scientific Institution Basal Research Fund, the Freshwater Fisheries Research Center. Chao Song reports financial support was provided by Wuxi City Science and Technology Information Research Institute. Chao Song reports a relationship with 2. Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences that includes: employment., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10 -9 - 200 × 10 -9  M), detection limit (1.0 × 10 -9  M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Objectives: The quality of amoxicillin capsules, ceftriaxone for injection, and ciprofloxacin tablets was evaluated to determine whether there is any difference in quality when comparing the country of origin. This was undertaken because it has been claimed that antibiotics manufactured in Europe are of superior quality to those originating from Africa or Asia., Methods: Samples of amoxicillin capsules, ceftriaxone for injection, and ciprofloxacin tablets were collected from three randomly selected wholesale pharmacies in each city, namely Arusha, Dar es Salaam and Mwanza, Tanzania. The collected samples of collected brands were subjected to quality control testing as per their respective pharmacopoeial monographs. Amoxil 250 mg capsules (Glaxo Wellcome, Mayenne, France), Rocephin (Roche, Switzerland) and Cipro-Denk 500 (Allphamed Pharbil Arzneimittel GmbH, Gottingen, Germany) were used as reference brands for the other generic brands of amoxicillin, ceftriaxone and ciprofloxacin, respectively., Results: A total of 31 brands (10 different brands of amoxicillin capsules, 9 of ceftriaxone sodium injections, and 12 of ciprofloxacin tablets) were collected from the targeted regions and subjected to quality control testing. All samples of collected brands complied with the requirements of their respective pharmacopoeial monographs., Conclusions: There was no significant difference in quality between brands of amoxicillin capsules, ceftriaxone for injection, and ciprofloxacin tablets manufactured in Africa and Asia against those manufactured in Europe in terms of compliance with the respective pharmacopoeial monographs., (© The Author(s) 2024. Published by Oxford University Press on behalf of British Society for Antimicrobial Chemotherapy.)

Solar Fenton is an important and extensively used advanced oxidation process (AOP) to degrade pharmaceutical pollutants. The objective of this study was to evaluate the performance of simultaneous degradation of the mixed pollutants (amoxicillin, acetaminophen, and ciprofloxacin) for an aqueous solution using the solar Fenton process. Operating parameters such as pH, iron doses, H 2 O 2 doses, pollutant concentrations, and time were studied. From the experimental results, the ideal conditions were obtained for the removal of mixed pollutants such as pH 3, Fe 2+ 0.04 mM, H 2 O 2 4 mM, the concentration of the mixed pollutants 5 mg/L, solar radiation 400 W/m 2 , and time 10 min, respectively. The pseudo-first-order kinetics were utilized to investigate the degradation efficacy of the mixed pollutants. The result of the study indicates that the degradation efficiency was > 99% for the mixed pollutants. A maximum of 63% mineralization was observed, and hydroxyl radical scavenger effects were studied. The best optimal conditions were applied to assess the spiked wastewater (municipal wastewater (MWW) and hospital wastewater (HWW)). The highest elimination rates for AMX, ACET, and CIP were observed as 65%, 89%, and 85% for MWW and 76%, 92%, and 80% for HWW, respectively. The degraded by-products were detected by LC-ESI-MS in the water matrix (aqueous solution and spiked wastewater), and ECOSAR analysis was performed for the transformed products. The study concluded that the solar Fenton technique is promising and effective for the removal of mixed pollutants from the water matrix., (© 2024. The Author(s), under exclusive licence to Springer Nature Switzerland AG.)

Biochar has been utilized to reduce ciprofloxacin (CIP) residues in soil. However, little is known about the effect of biochar-derived dissolved organic matter (DOM) on residual CIP transformation. Thus, we analyzed the residual soil CIP as influenced by biochar generated from rice straw (RS3 and RS6), pig manure (PM3 and PM6), and cockroach shell (CS3 and CS6) at 300 °C and 600 °C. The three-dimensional excitation-emission matrix (3D-EEM), parallel factor analysis (PARAFAC) and two-dimensional correlation spectral analysis (2D-COS) were used to describe the potential variation in the DOM-CIP interaction. Compared with CK, biochar amendment increased the water-soluble CIP content by 160.7% (RS3), 55.2% (RS6), 534.1% (PM3), 277.5% (PM6), 1160.6% (CS3) and 703.9% (CS6), indicating that the biochar feedstock controlled the soil CIP release. The content of water-soluble CIP was positively correlated with the content of dissolved organic carbon (r = 0.922, p < 0.01) and dissolved organic nitrogen (r = 0.898, p < 0.01), suggesting that the major influence of the water-soluble CIP increase was DOM. The fluorescence quenching experiment showed that the interaction between DOM and CIP triggered static quenching and the creation of a DOM complex. The mean log K of protein-like material (4.977) was higher than that of terrestrial humus-like material (3.491), suggesting that the protein-like material complexed CIP was more stable than the humus-like material. Compared with pyrolysis at 300 °C, pyrolysis at 600 °C decreased the stability of the complex of protein-like material and CIP by 0.44 (RS), 1.689 (PM) and 0.548 (CS). This result suggested that the influence of temperature change was more profound on PM biochar-derived DOM than on RS and CS. These insights are essential for understanding CIP transportation in soil and controlling CIP contamination with biochar., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

In this study, a novel Ce 2 MgMoO 6 /CNFs (cerium magnesium molybdite double perovskite decorated on carbon nanofibers) nanocomposite was developed for selective and ultra-sensitive detection of ciprofloxacin (CFX). Physical characterization and analytical techniques were used to explore the morphology, structure, and electrocatalytic characteristics of the Ce 2 MgMoO 6 /CNFs nanocomposite. The sensor has a wide linear range (0.005-7.71 μM and 9.75-77.71 μM), a low limit of detection (0.012 μM), high sensitivity (0.807 μA μM -1  cm -2 nM), remarkable repeatability, and an appreciable storage stability. Here, we used density functional theory to investigate CFX and oxidized CFX as well as the locations of the energy levels and electron transfer sites. Furthermore, the Ce 2 MgMoO 6 /CNFs-modified electrode was successfully tested in food samples (milk and honey), indicating an acceptable response with a recovery percentage and relative standard deviation of less than 4%, which is comparable to that of GC-MS. Finally, the developed sensor exhibited high selectivity and stability for CFX detection., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

The research study describes the development of a hybrid nanocomposite called nitro-doped carbon nanodots/polyaniline/molecularly imprinted polymer ( N -CNDs/PAni/MIP). This composite is specifically engineered to function as a durable and flexible dual-response sensor to detect and analyze pharmaceutical organic contaminants (POCs). Powder X-Ray diffraction (PXRD), Fourier transform infrared (FT-IR), thermogravimetric analysis (TGA), transmission electron microscopy (TEM), and scanning electron microscopy (SEM) were employed to perform an exhaustive structural and morphological analysis of N -CNDs/PAni/MIP. N -CNDs/PAni/MIP emitted blue luminescence under ultraviolet irradiation and exhibited typical excitation-dependent emission properties. It can act as fluorescent probe for the detection of CIPRO with high selectivity and sensitivity with an IF value of 4.2. Furthermore, N -CNDs/PAni/MIP exhibited high peroxidase-like catalytic behavior. After adding CIPRO to the N -CNDs/PAni/MIP/TMB/H 2 O 2 system, the blue color of the solution faded due to the reduction of blue ox-TMB to colorless TMB. Based on these two phenomena, with CIPRO as the target analyte, the N -CNDs/PAni/MIP dual sensor showed a minimal detection limit of 70 pM for the fluorescent signaling platform and 3.5 nM for the colorimetric probe with a linear range of 0.038-200 nM. The fluorometric and colorimetric assays based on N -CNDs/PAni/MIP for CIPRO detection were then successfully applied to lentic water as well as to tap water samples, demonstrating the sensitivity and dependability of the instrument. Furthermore, the synthesized PVA ( N -CNDs/PAni/MIP) films enable the recognition of CIPRO, and these films have the potential to be integrated into portable sensing devices, providing a practical solution for rapid and on-site detection of CIPRO in various samples.

Underwater bubbling plasma (UBP) coupled with diatomite-CoFe 2 O 4 (Dt-CFO) activated peroxymonosulfate (PMS) was proposed for the degradation of ciprofloxacin hydrochloride (CIP) in this work. The catalyst sample of Dt-CFO with large specific surface area, rich active sites and excellent magnetic property was prepared by the hydrothermal method and systematically characterized to investigate its material properties. The combination of UBP and Dt-CFO activated PMS (UBP/Dt-CFO/PMS) showed excellent synergy with the synergistic factor of 1.98, and reached the CIP degradation percentage of 94.7%, which corresponded to the kinetic constant of 0.097 min -1 . Dt-CFO with the diatomite content of 30 wt% achieved the best catalytic activity in the reaction system. Higher catalyst and PMS dose, peak voltage, pulse frequency and lower initial CIP concentration were beneficial for CIP removal. The addition of Cl - , HCO 3 - , SO 4 2- and humic acid suppressed CIP degradation, while NO 3 - had no effect on CIP removal. The Dt-CFO composite exhibited excellent reusability and low leaching metal amount, demonstrating its good stability. SO 4 - ·, ·OH, ·O 2 - , 1 O 2 , e aq , O 3 and H 2 O 2 were the active species confirmed to be involved in CIP degradation. The redox circles of ≡ Co(Ⅱ)/≡Co(Ⅲ) and ≡ Fe(Ⅱ)/≡Fe(Ⅲ) on Dt-CFO surface and the plasma-induced physicochemical effects dominated PMS activation. The decomposition process of CIP was explored through fluorescence spectra. Three degradation pathways were inferred, and the toxicity analysis showed the toxicity of CIP solution weakened after discharge treatment., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

To date, there is an increased risk to public health and the environment due to the presence of pharmaceutically active compounds within drinking water supply and distribution networks. Owing to this, a direct injection-HPLC/MS-MS method was developed for the simultaneous determination of 16 active pharmaceutical compounds in tap water samples: amoxicillin, ampicillin, cephalexin, cefotaxime, cefuroxime, ciprofloxacin, clarithromycin, clindamycin, chloramphenicol, cyproterone, erythromycin, flutamide, spironolactone, sulfamethoxazole, tamoxifen, and trimethoprim. Limits of detection (LOD) ranged from 0.2 to 6.0 µg/L while quantification limits (LOQ) from 0.3 to 20 µg/L. Recovery percentages were between 70 and 125%. Total analysis time was short, with all compounds being resolved in less than 2.1 min. Of the 22 tap water samples collected and analyzed, the highest concentrations corresponded to amoxicillin (147 µg/L) and ciprofloxacin (44 µg/L). The findings could set a precedent for establishing safe levels of these compounds and increasing standards for tap water quality in this region., (© 2024. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.)

The present work provides the first data on the occurrence of different classes of pharmaceuticals and personal care products (PPCPs) in surface marine sediments from an Arctic fjord (Kongsfjorden, Svalbard Islands, Norway). The target compounds included: ciprofloxacin; enrofloxacin; amoxicillin; erythromycin; sulfamethoxazole; carbamazepine; diclofenac; ibuprofen; acetylsalicylic acid; paracetamol; caffeine; triclosan; N,N-diethyl-meta-toluamide; 17β-estradiol; 17α-ethinyl estradiol and estrone. Sampling was performed in the late summer, when high sedimentation rates occur, and over 5 years (2018-2022). Based on the environmental concentrations (MECs) found of emerging contaminants and the relative predicted no-effect concentrations (PNECs), an environmental risk assessment (ERA) for sediments was performed, including the estimation of the Risk Quotients (RQs) of selection and propagation of antimicrobial resistance (AMR) in this Arctic marine ecosystem. Sediments were extracted by Pressurized Liquid Extraction (PLE) and the extracts were purified by Solid Phase Extraction (SPE). Analytical determination was conducted with liquid chromatography-high-resolution mass spectrometry (HPLC-HRMS). PPCPs were detected in the sediments along the fjord in all the years investigated, with overall concentrations similar in most cases to those reported in urbanized areas of the planet and ranging from a minimum of 6.85 ng/g for triclosan to a maximum of 684.5 ng/g for ciprofloxacin. This latter was the only antibiotic detected but was the most abundant compound (32 %) followed by antipyretics (16 %), hormones (14 %), anti-inflammatories (13 %), insect repellents (11 %), stimulants (9 %), and disinfectants (5 %). Highest concentrations of all PPCPs detected were found close to the Ny-Ålesund research village, where human activities and the lack of appropriate wastewater treatment technologies were recognized as primary causes of local contamination. Finally, due to the presence in the sediments of the PPCPs investigated, the ERA highlights a medium (0.1 < RQ < 1) to high risk (RQ > 1) for organisms living in this Arctic marine ecosystem, including high risk of the spread of AMR., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier B.V.)

Antibiotics are widely prioritized pharmaceuticals frequently adopted in medication for addressing numerous ailments of humans and animals. However, the non-judicious disposal of ciprofloxacin (CIP) with concentration levels exceeding threshold limit in an aqueous environment has been the matter of growing concern nowadays. CIP is found in various waterways with appreciable mobility due to its limited decay in solidified form. Hence, the effective eradication strategy of this non-steroidal anti-inflammatory antibiotic from aqueous media is pivotal for preventing the users and the biosphere from their hazardous impacts. Reportedly several customary techniques like reverse osmosis, precipitation, cross-filtration, nano-filtration, ion exchange, microbial remediation, and adsorption have been employed to eliminate CIP from water. Out of them, adsorption is ascertained to be a potential method because of lesser preliminary investment costs, ease of operation, greater efficiency, less energy usage, reduced chemical and biological slurry production, and ready availability of precursor materials. Towards remediation of ciprofloxacin-laden water, plenty of researchers have used different adsorbents. However, the present-day challenge is opting the promising sorbent and its application towards industrial scale-up which is vital to get reviewed. In this article, adsorbents of diverse origins are reviewed in terms of their performances in CIP removal. The review stresses the impact of various factors on sorptive assimilation of CIP, adsorption kinetics, isotherms, mechanism of ionic interaction, contrivances for CIP detection, cost estimation and reusability assessments of adsorbents also that may endorse the next-generation investigators to decide the efficacious, environmental appealing and cost-competitive adsorbents for effective riddance of CIP from wastewater., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

The distinct characteristics of active species produced during the photocatalytic reaction can result in alterations in the degradation routes of organic pollutants with diverse chemical structures. The relationship between the active species and degradation pathways of organic pollutants lacks a direct experimental or characterization method, so in-depth research is still needed to understand the details of their interactions. In this study, sulfur-doped bulk carbon nitride (SBCN) was prepared based on bulk carbon nitride (BCN), and the process of S-doping enhancing the production of O 2 1 was revealed. Through the degradation experiment, the degradation rate of CIP by SBCN reached 91 %, which was higher than that of BCN (66 %). The increase of degradation rate was mainly attributed to the increase of O 2 1. Through the density functional theory (DFT) calculation of CIP and its degradation intermediate, due to the preferential oxidation of CIP by O 2 1, O 2 1 changes the initial degradation direction of CIP, releasing more attack sites for ˙O 2 - , thereby achieving more efficient degradation of CIP through the synergy of O 2 1 and ˙O 2 - . In this study, the attack preferences of the active species and their synergistic promotion provide important insights for the efficient photocatalytic degradation of organic pollutants., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Water pollution induced by antibiotics has garnered considerable concern, necessitating urgent and effective removal methods. This study focused on exploring ciprofloxacin (CIP) removal by duckweed and assessing CIP bioaccumulation and toxic effects within duckweed under varying dissolved organic matter categories, pH levels, and nutrient (nitrogen (N) and phosphorus (P)) levels. The results revealed the proficient and rapid elimination of CIP from water by duckweed, resulting in 86.17 % to 92.82 % removal efficiency at the end of the 7-day experiment. Across all exposure groups, varying degrees of CIP bioaccumulation in duckweed were evident, with uptake established as a primary pathway for CIP elimination within this plant. Additionally, five CIP metabolites were identified in duckweed tissues. Interestingly, the presence of humic acid (HA) and fulvic acid (FA) reduced CIP absorption by duckweed, with FA yielding a more pronounced impact. Optimal CIP removal was recorded at a pH of 7.5, while duckweed displayed heightened physiological stress induced by CIP at pH 8.5. Although the influence of N and P concentrations on CIP removal by duckweed was modest, excessive N and P levels intensified the physiological strain of CIP on duckweed., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier B.V. All rights reserved.)

As two emerging pollutants of great concern, microplastics (MPs) and antibiotics inevitably cooccur in various aquatic environments and interact with each other, impacting the fate and ecological risks. Aging obviously complicates their interaction and deserves further study. Therefore, the adsorption-desorption behaviors of ciprofloxacin (CIP) onto polystyrene (PS) fragments with various aging extent were investigated, and the key physiochemical properties influencing the interaction and the interaction mechanisms were clarified by redundancy analysis, FTIR and XPS spectra. The physicochemical properties of PS MPs were significantly changed with aging time, and the morphological and chemical changes seemed to occur asynchronously. The adsorption of CIP onto the pristine PS MPs relied on physisorption, especially the ion-involving electrostatic and cation-π interaction. Due to the hydrogen bonding formed by the C-OH, CO, and O-CO groups of PS and CIP, the adsorption capacities of the aged PS MPs were greatly increased. The desorption efficiency of CIP from MPs in the gastric fluid was closely related to the solution ionic strengths, C-OH and CO groups of MPs, while that in the intestinal fluid was associated with O-CO groups of MPs. The different impact factors could be well described by the differences in the chemical components and pHs of the simulated gastric and intestinal fluids. This study gives a comprehensive understanding of the adsorption-desorption behaviors of antibiotics onto MPs at a molecular level and indicates that MPs could act as Trojan horses to transport antibiotics into aquatic organisms., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper, (Copyright © 2023 Elsevier Ltd. All rights reserved.)

The invention and production of Ciprofloxacin (CIP) have a positive impact on medical treatment, but the overuse of CIP is also harmful to the environment. In this paper, we prepared a novel film material for detection of CIP by in situ synthesis of zinc-based metal-organic framework (Zn-BDC) on TEMPO-oxidized cellulose nanofibers (TOCNF). The nanoscale Zn-BDC were uniformly distributed on the TOCNF that was beneficial to realize the transparency and functionality of Zn-BDC@TOCNF whose transparency was up to 87 %. Zn-BDC@TOCNF showed no fluorescence itself while showed bright fluorescence upon the contact of CIP, which was proposed as the aggregation-induced emission (AIE) of CIP that defused and assembled in the Zn-BDC@TOCNF. There was a certain linear relationship between fluorescence intensity and concentration of CIP (R 2  = 0.994, LOD = 0.083 μM). In the detection process, CIP could still fluoresce in Zn-BDC@TOCNF even if it was interfered by other ions and small biological molecules, and the weak acid environment was conducive to AIE of CIP. Generally, it was of great significance to establish a rapid and effective monitoring mechanism for CIP in water for environmental protection and ecological balance., Competing Interests: Declaration of competing interest We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled., (Copyright © 2023. Published by Elsevier B.V.)

Enrofloxacin (ENR) and its metabolite Ciprofloxacin (CIP) are both a class of fluoroquinolone antibiotics effective against a broad-spectrum microbial infection. Recent surge in the consumption of CIP and ENR has been linked to increased cases of drug-resistant pathogens. This is due to the fact that the antibiotic residues remain in milk, meat, soil and environmental water for a prolonged duration. Although gold standard methods such as LC-MS are sensitive, they suffer from expensive operation and maintenance cost, and would need dedicated facilities and tedious sample preparation steps. Such limitations make on site detection impossible for regulatory bodies in developing countries. To address this issue, we developed a portable device that can detect the presence of CIP and ENR antibiotics in the range of parts per billion (ppb) concentrations accurately. It consists of a polyaniline (PAni) coated U-bent optical fiber with anti-ENR/CIP antibody immobilized on the polymer surface. The sensor relies on the principle of evanescent wave absorbance by antigen-antibody complex. The sensor showed limit of detection (LOD) of 1 ppb with a linear range of operation from 1 ppb to 500 ppb (R 2  = 0.96-0.99) in lake water, waste water treatment plant effluent, urine, blood serum, milk and meat samples. The recovery of the sensor ranges from 88% to 120% indicating reasonable accuracy. The sensor has excellent selectivity towards CIP and ENR and showed stability for four weeks indicating its field deployability and robustness. The portable sensor is scalable and contract has been given to an industry partner to mass manufacture the device., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Developing simultaneous detection methods for multiple targets is crucial for the field of food analysis. Herein, enrofloxacin (ENR) and ciprofloxacin (CIP) were taken as model targets. For the first time, a strategy to generate group-specific split aptamers was established by revealing and splitting the critical binding domain, and the split aptamers were exploited to design a four-way DNA junction (4WJ) which could regulate the enzymatic activity of chitosan oligosaccharide (COS)-AuNPs nanozyme to develop a colorimetric aptasensor. A pair of split aptamers were obtained for ENR (K d = 15.00 nM) and CIP (K d = 4.870 nM). The mechanism of COS binding with double-stranded DNA in the 4WJ was elucidated. Under optimal conditions, the colorimetric aptasensor enabled a wide linear detection range of 1.4-1400 nM and a limit of detection (LOD) of 321.1 pM and 961.0 pM towards ENR and CIP, respectively, which exhibited excellent sensitivity, selectivity, and availability in detecting ENR/CIP in seafood. This study expands the general strategies for generating robust aptamers and nanozyme complex and provides a good reference for developing multi-target detection methods., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier B.V. All rights reserved.)

As a widely used and hard-to-degrade pharmaceuticals and personal care product (PPCP), ciprofloxacin (CIP) was frequently found in water environment and the detected concentration was gradually increased. Although zero-valent iron (ZVI) has been shown to be effective in destroying refractory organic pollutants, the practical application and sustained catalytic performance is not satisfactory. Herein, introduction of ascorbic acid (AA) and employment of pre-magnetized Fe 0 was achieved to maintain a high-concentration of Fe 2+ during persulfate (PS) activation. Pre-Fe 0 /PS/AA system presented the best performance for CIP degradation, achieving almost complete elimination of 5 mg/L CIP within 40 min in the reaction conditions of 0.2 g/L pre-Fe 0 ，0.05 mM AA and 0.2 mM PS. The CIP degradation retarded as excess pre-Fe 0 and AA were added, therefore, the optimum dosages of pre-Fe 0 and AA were determined to be 0.2 g/L and 0.05 mM, respectively. The CIP degradation gradually decreased as the initial pH increased from 3.05 to 11.03. The presence of Cl - , HCO 3 - , Al 3+ , Cu 2+ and humic acid significantly influenced the performance of CIP removal, while Zn 2+ , Mg 2+ , Mn 2+ , and NO 3 - slightly affected the CIP degradation. Combined with the results of HPLC analysis and previous literature, several possible degradation pathways of CIP were proposed., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Active chlorines (ACs) can selectively oxidize contaminants with benzene rings to recycle surfactants, which greatly facilitates the resource cycle. This paper firstly utilized Tween 80 to assist in ex-situ washing the ciprofloxacin (CI) contaminated soil, including the solubilization experiment, shake washing and soil column washing, all of which showed that 2 g/L of Tween 80 (TW 80) was the most effective in removing CI. Then electrochemically treated the collected soil washing effluent (SWE) at 10 V with an electrolyte of 20 mM NaCl + 10 mM Na 2 SO 4 ; Pre-experiments screened the range of electrode spacing, pH and temperature, based on which an orthogonal design Table L 9 (3 4 ) was designed. Visual analysis and ANOVA were performed on the ciprofloxacin removal efficiency and Tween 80 retention efficiency during the orthogonal experiments in 9 groups, and the results showed that CI was usually degraded within 30 min, and 50% of TW 80 was still present at the end of the experiment, and there was no significant effect of all three factors. LC-MS demonstrated that CI was mainly degraded synergistically by ·OH and ACs, and ·OH effectively reduced the biotoxicity of the SWE, so the mixed electrolyte may be more suitable for the electrochemical recycling system of ACs. This paper conducted the washing remediation study of CI-contaminated soil for the first time, and applied the theory of selective oxidation by ACs on benzene ring to treat the SWE, which provides a new treatment idea for antibiotic-contaminated soil., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Antibiotics are among the most common medicine groups since they are used to treat infectious diseases, as nutritional supplements in livestock breeding, and for preservation in the food industry. Turkey is among the highest antibiotic consumers in the world. In the present study, the most popular 14 antibiotics available in Turkey were monitored in one hospital sewage and two urban wastewater treatment plant influents and effluents seasonally in Istanbul province, the largest metropolitan center in Turkey. The present research aimed to develop a robust analytical method to determine 14 antibiotics, including six chemical groups, in environmental matrices which are considered significant antibiotic pollution sources, namely hospital sewage and urban wastewater. Solid-phase extraction (SPE) and UPLC-MS/MS analysis parameters included optimized column temperature, eluent, mobile phase, and flow rate. Three SPE cartridges were employed in recovery studies. The antibiotic recovery rates varied between 40 and 100%, and all analytes were identified within 3 min with UPLC-MS/MS under optimal conditions. It was determined that method detection limits (MDLs) varied between 0.07 and 2.72 µg/L for the antibiotics. In all seasons, the highest beta-lactam group antibiotic concentrations were identified in hospital sewage. The season with the greatest variety of antibiotics in urban wastewater was spring. Clarithromycin and ciprofloxacin were the antibiotics determined at the highest concentration in the influent and effluent of the wastewater treatment plant in all seasons. This study showed that the most widely used beta-lactam group antibiotics were found in high amounts in hospital sewage wastewater but in low concentrations in the treatment plants, and hence, it is seen that the degradability of beta-lactam group antibiotics was high. The presence of clarithromycin, ciprofloxacin, lincomycin, levofloxacin, and trimethoprim antibiotics in hospital sewage in higher amounts and also in inlet and outlet of wastewater treatment plants proves that those are resistant antibiotics., (© 2023. The Author(s), under exclusive licence to Springer Nature Switzerland AG.)

Preparation of high-performance activated carbon from agroforestry waste biomass can effectively improve the shortcomings of traditional biomass carbon performance. Using the waste biomass peony seeds shell (PSS) as the precursors in this study, high performance activated carbon was prepared by the KOH two-step activation method and used to remove congo red (CR) and ciprofloxacin (CIP) in water pollution. The obtained PSS-based activated carbons (PSACs) were characterized by SEM, EDS, N 2 adsorption-desorption isotherm, FTIR, and XRD methods. The results showed that the activated carbon at 700 °C (PSAC-700) had an ultra-high specific surface area (2980.96 m 2 /g), excellent micropore volume (1.12 cm 3 /g), and abundant surface functional groups. The results of adsorption performance revealed that PSAC-700 exhibited excellent adsorption capacity for CR (q max  = 2003.2 mg/g) and CIP (q max  = 782.3 mg/g), which was superior to the carbon-based adsorbents reported reviously in the literature. Langmuir model could well describe the adsorption process of PSACs for CR and CIP, indicating that the pollutant molecules were uniformly adsorbed on the surface monolayer. The regeneration experiment suggested that after three cycles, the adsorption capacities of PSAC-700 for CR and CIP reached 1814 mg/g and 697 mg/g, respectively, with good repeatability. The preparation of PSAC-700 in this study has high adsorption capacity and strong application, which is an ideal material for wastewater purification adsorbent and has broad application prospect., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

The abuse of enrofloxacin (ENR) in aquaculture and the lack of monitoring of other metabolites except ciprofloxacin (CIP) may lead to unknown harmful effects on human health. In this study, ENR metabolites were screened in real fish samples based on ultrahigh-performance liquid chromatography coupled with Q-Orbitrap mass spectrometry combined with Compound Discoverer software, and another metabolite deethylene-ENR besides CIP was detected and identified for the first time. Correspondingly, a method for the determination of ENR and CIP and the semi-quantitative analysis of deethylene-ENR in aquatic products was established. Method validation illustrated that excellent linearity and satisfactory recoveries of analytes were obtained. Limits of detection of ENR and CIP were both 0.1 μg kg -1 , and their limits of quantification both 1 μg kg -1 . CIP and deethylene-ENR were detected in 12 of 14 ENR-positive fish samples, so deethylene-ENR should be of concern as a possible risk candidate in aquatic products., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

MPs can adsorb antibiotics to coexist and accumulate in the aquatic environment in the form of complexes, resulting in unforeseeable adverse consequences. The adsorption behavior and mechanism of three antibiotics amoxicillin (AMX), ciprofloxacin (CIP), and tetracycline (TC) by four MPs Polyvinyl chloride (PVC), polystyrene (PS), polypropylene (PP), and polyethylene (PE) were studied. Results showed that the adsorption of antibiotics onto MPs follows the pseudo-second-order kinetic and the Freundlich isotherm model, indicating a multilayer chemical adsorption. Combined with FTIR, XRD, and SEM analyses, the adsorption behavior was simultaneously governed by physical processes. Additionally, the equilibrium adsorption capacity was inhibited in the research concentration range of NaCl from 10 mg/L to 10 g/L. The higher the salt concentration, the more pronounced the inhibition phenomenon was. The high (9) and low (3) pH also inhibited the adsorption of antibiotics to MPs. The humic acid (HA) concentration in the range of 0-20 mg/L generally inhibited the MPs-antibiotics adsorption, but the higher HA concentration showed less inhabitation than the lower one. The adsorption inhibition of TC on the four MPs by SA also followed the above rule. However, the adsorption inhibition of sodium alginate (SA) on AMX and CIP on the four MPs was enhanced with its concentration (0-50 mg/L)., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier B.V. All rights reserved.)

In this work, Mn 2 O 3 /Fe 2 O 3 (MFO) was synthesized and used to activate monopersulfate (MPS) for the degradation of ciprofloxacin (CIP). The effect of several parameters was studied on CIP degradation. Under the optimum conditions (pH = 6.3 (natural pH), MFO = 300 mg/L and MPS = 2 mM), around 92% of CIP was decomposed. Nitrite, phosphate and bicarbonate ions had a strong inhibitory effect on the MFO/MPS process while the effect of chloride and nitrate ions was neutral. The catalytic activity of MFO was also studied by other chemical oxidants such as peroxydisulfate, periodate, hydrogen peroxide, percarbonate and peracetic acid. Scavenging tests showed that the role of sulfate radicals is more than hydroxyl radicals. MFO exhibited high catalytic activity in four recycling with insignificant leaching of Mn and Fe. During CIP oxidation, 45.5% carbon mineralization occurred and antibacterial activity of treated CIP solution was reduced. Finally, MFO/MPS was applied on actual wastewater (hospital effluent) and the results showed that MFO/MPS can be considered as a practical method for the treatment of contaminated water with emerging pollutants.

The seasonal distribution and dynamic evolution of antibiotics in wastewater from main treatment areas and in sludge and their resistance selection potential and ecotoxicological risk were studied at a municipal wastewater treatment plant in Jinan, East China. Ten antibiotics were selected, and all were detected in wastewater and sludge samples, with fluoroquinolones showing the highest detection concentrations and frequencies. Seasonal fluctuations in the antibiotic concentrations in the influent, effluent, and sludge were observed, with the highest values in winter in most cases. The dynamic evolution of antibiotics during the treatment process differed among the seasons. The antibiotic removal efficiencies were incomplete, ranging from - 40.47 to 100%. Mass balance analysis showed that sulfonamides, roxithromycin, and metronidazole were mainly removed through biological processing, whereas fluoroquinolones, doxycycline, and chloramphenicol were removed through sludge adsorption. Levofloxacin, as well as a mixture of the 10 antibiotics from the effluent, could pose a low ecotoxicological risk to Daphnia in the receiving waters. Additionally, levofloxacin and ciprofloxacin in the effluent and ciprofloxacin and metronidazole in the sludge may facilitate the selection of antibiotic-resistant bacteria in the environment., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Antibiotics enter into agricultural land, via manure application or wastewater irrigation. The practices of using untreated wastewater in the agricultural system help in the bioaccumulation of antibiotics in vegetables and other crops. Exposure to the bioaccumulated antibiotics poses serious health risks to ecosystem and human. In this study, the prevalence of two fluoroquinolones (levofloxacin and ciprofloxacin), their bioaccumulation in five crops (Daucus carota L., Pisum sativum L., Raphanus raphanistrum L., Lactuca sativa L., Spinacia oleracea L.), and associated human health risks were investigated. Lettuce showed highest bioaccumulation of levofloxacin (LEV) (12.66 μg kg -1 ) and carrot showed high bioaccumulation of ciprofloxacin (CIP) (13.01 μg kg -1 ). In roots, bioconcentration factor (BCF root ) was observed to be relatively high in radish (LEV 0.24-0.43, CIP 0.32-0.49) and observed to be lower in spinach (LEV 0.05-0.13, CIP 0.12-0.19). The translocation factor (TF) for LEV and CIP was generally >1 for all five crops under all treatment. The final transfer and distribution of LEV and CIP in the edible parts of the crops were as follows: leaves > shoots > roots for both antibiotics. Risk quotient of both LEV and CIP in current study is found to be in between 0.018 and 0.557 and shows a medium risk (0.1 to 1) to human health due the discharge of untreated wastewater into the fields. However, our study reports that both antibiotics do accumulate in the edible plant parts; therefore, it poses potential risks to human health., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Microplastics are plastic particles less than 5 mm in diameter and are widely present in water environments. Their unique surface structures can adsorb coexisting pollutants in the surrounding environment, such as antibiotics and metal ions, leading to compound pollution. The adsorption of ciprofloxacin on polyethylene microplastics under different environmental conditions (pH and salinity) was investigated. The Freundlich model fitted well at 25 °C, indicating that the adsorption of ciprofloxacin by polyethylene microplastics was multilayered, and Fourier Transform infrared spectroscopy (FTIR) analysis indicated that the adsorption of ciprofloxacin by polyethylene microplastics was physical. The kinetic adsorption of ciprofloxacin on polyethylene microplastics followed a pseudo-second-order mode. Heavy metals (Cu 2+ , Cr 3+ , Cr 6+ , Cd 2+ , and Pb 2+ ) affected the adsorption of ciprofloxacin by microplastics, which was related to the type and concentration of metal ions and the valence state of the ions. The acute toxicity of microplastics and the microplastic-ciprofloxacin-Cu 2+ complex were evaluated using luminescent Photobacterium phosphoreum, demonstrating the polyethylene toxicity microplastic-ciprofloxacin-Cu 2+ complex was mainly caused by Cu 2+ and ciprofloxacin rather than microplastics. This study provides theoretical support for the environmental behavior and ecological effects of microplastics in aqueous environments., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

The synthetic antibiotics fluoroquinolones are popular due to their good antibacterial performance and low price, but the risk to human health caused by their residues has attracted great attention. In this study, an ultra-sensitive mAb, 4D7, was prepared with an IC 50 of 0.027 ng mL -1 to norfloxacin (NOR) and cross-reactivity of 19.7-47.7% to lomefloxacin (LOM), pefloxacin (PEF), ofloxacin (OFL), enrofloxacin (ENR), ciprofloxacin (CIP), and danofloxacin (DAN). Based on mAb 4D7 and Eu-fluorescent microspheres, a rapid and sensitive immunochromatographic strip was developed for the detection of fluoroquinolone residues in fish and milk. The detection ranges (IC 20 -IC 80 ) of the strip for the detection of NOR, PEF, LOM, OFL, ENR, CIP and DAN were 0.19-1.1 μg kg -1 , 0.39-2.1 μg kg -1 , 0.5-2.6 μg kg -1 , 0.43-3.3 μg kg -1 , 0.61-3.5 μg kg -1 , 0.69-5.5 μg kg -1 , 0.52-3.4 μg kg -1 in fish, and 0.027-0.19 μg kg -1 , 0.049-0.34 μg kg -1 , 0.069-0.39 μg kg -1 , 0.06-0.41 μg kg -1 , 0.089-0.65 μg kg -1 , 0.12-0.81 μg kg -1 , 0.091-0.52 μg kg -1 in milk, respectively. The recovery rates in spiked sample tests were 88.6-113.6% with a coefficient of variation less than 8.4%. Thus the newly-developed strip was sensitive and reliable for rapid on-site detection of fluoroquinolone residues in fish and milk.

Hybrid methods with an enhanced oxidation capacity have been proposed for the removal of organic contaminants based on combining hydrodynamic cavitation (HC) with advanced oxidation processes (AOPs). In this study, we utilize the synergetic effect between photocatalytic processes and HC to strengthen ciprofloxacin (CIP) degradation by P-doped TiO 2 catalysts. In comparison to a degradation ratio of 20.37 % in HC and 55.7 % in P-TiO 2 -based photocatalytic processes alone, the CIP degradation ratio reached as high as 90.63 % in HC-assisted photocatalytic processes with the optimal experimental parameters. The mechanic microjets treatment originated from HC make P-TiO 2 nano photocatalysts with significantly increased surface area, smaller particle sizes, cleaner surface and improved dispersion, which were found using SEM, TEM, and BET analysis. Possible degradation mechanisms and reaction pathways of CIP during hybrid HC + photocatalytic processes were explored by coupling free radical capture experiments and liquid chromatography-mass spectrometry . This hybrid HC + photocatalytic technique has a potential application in the treatment of antibiotic sewage at the industrial level., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 The Author(s). Published by Elsevier B.V. All rights reserved.)

The sorption kinetics of two of the most frequently used antibiotics onto recycled (weathered) polyvinyl chloride (PVC) was investigated, using Freundlich and Langmuir isotherm models. Various experimental conditions were set, including pH, contact time, rotational speed, temperature, and initial concentration. The batch experimental results indicated that Freundlich model was better fitted than Langmuir (R 2 : 98.7 and 84.7, for CIP and CLA respectively). Maximum adsorption capacity is 45.9 mg/g and 22.0 mg/g for CIP and CLA, respectively. Enthalpy (ΔH), and entropy (ΔS) values were negative for CIP, indicating that the reaction was exothermic and spontaneous, respectively. It was vice versa for CLA. Field emission scanning electron microscope (FESEM) and Fourier transform infrared spectrometer (FT-IR) analysis confirmed the physical adsorption mechanism. The results demonstrated that the recycled PVC microplastic has a good capacity for adsorption for both antibiotics.

A Raman-based label-free analytical method was developed to detect the antibiotic ciprofloxacin (CIP) in various pharmaceutical formulations in the presence of different matrices (e.g., ear drops, eye drops and infusion solutions). The Raman spectral analysis is performed for semiquantification in the case of a low background Raman signal, i.e., the signal originating from the excipient and carrier substance of the formulation does not interfere with the fingerprint spectrum of ciprofloxacin. In the case of a background spectrum rich in Raman modes originating from the excipient and carrier substance of the formulation, the pharmaceutical formulation is diluted 1:5000, and thus, the background signal is undetectable. Due to the high affinity of ciprofloxacin towards metallic surfaces, surface-enhanced Raman spectroscopy (SERS) is applied to allow for the sensitive detection of ciprofloxacin. Moreover, the developed measurement routine can be applied to monitor the degradation of the active component ciprofloxacin within the pharmaceutical formulation. The developed assay can therefore be extended to the pharmaceutical industry for quality control in assay applications or the preparation of individualized medicines., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have influenced the work reported in this paper., (Copyright © 2022 Elsevier B.V. All rights reserved.)