Search

Oxytocin is a neurohypophysial peptide released into general circulation from posterior pituitary gland. It is involved in different physiological roles, including milk ejection from the mammary gland, stimulation of uterine smooth muscle contraction during labour and affects cognitive processes, tolerance, adaptation and complex sexual and maternal behaviour. The main objective of the present research was to determine the complete donkey oxytocin-neurophysin I encoding gene (OXT) sequences and to detect genetic diversity at this locus. Using the genomic DNA as template, we sequenced and compared the whole OXT gene of 5 Italian donkeys: 2 Amiatine, 2 Ragusana and 1 Grigio Siciliano donkeys. On average the gene extends over 946 bp, composed of 517 bp of exonic regions and 429 bp of intronic regions, with an A/T and G/C content of about 27% and 73%, respectively. Furthermore, the 5’ flanking region (876 bp) was sequenced. The gene contains only three exons, ranging in size from 202 bp (exons 2) to 155 bp (exon 3), and two introns of 315 bp (intron 1) and 114 bp (intron 2). The first exon encodes a peptide leader (19 amino acids residues encoded by the nucleotides from 41 and 97), the nonapeptide hormone (from nucleotide 98 to 124), the tripeptide processing signal (GKR) (from nucleotides 125 and 133) and the first 9 of 94 residues of neurophysin I; the second exon encodes the central part of neurophysin I (67 aa), while the third exon encodes the COOH–terminal region of neurophysin I (18 aa). Among the different species of animals of species of livestock animals, the OXT donkey gene sequence showed the highest degree of similarity with the horse (98%) vs. ruminants (75%) and camelids (76%). The comparison of the sequences obtained allowed the identification of 5 SNPs: g.263A>G, g.334A>G, g.436T>C and g.304A>C in intron 1 and g.124G>A in promoter region. This last polymorphic site falls into a potential binding site for the transcription factor GATA-1 (www.generegulation. com). With this study, we provide the first contribution to the characterisation of the genomic sequence of the OXT gene and first examples of markers found at this locus in donkey. The detected polymorphisms represent a good opportunity to carry out studies focussed on the identification of significant association with the physiological processes controlled by this hormone as already performed in other species.

Lysozyme is known to be a natural antimicrobial agent since it catalyses the hydrolysis of glycosidic bonds of mucopolysaccharides in bacterial cell walls.It inhibites the development of many pathogens bacteria, thus making the milk somewhat selective in regards to the milk bacteria content. Three major distinct types of lysozymes have been identified: chicken-type (c-type), invertebrate-type (i-type), and goose-type (g-type). In particular, there are at least 4 non-stomach lysozyme genes in ruminants (i.e., mammary gland, kidney, trachea, intestinal). Lysozymes in ruminants and equine milk are considered to be the c-type because of their similarity to chicken egg white lysozyme.The c-type lysozyme content in donkey’s milk varies during the different stages of lactation with a mean value of 1.0 mg/mL and proved to be higher than that in bovine, ovine, caprine (traces), whereas it was very close to mare’s milk. In the equine species, the c-type lysozyme encoding gene (4 exons) maps on chromosome 6 and transcribes a mRNA of 1329bp, coding for a protein of 148aa. To our knowledge, no information on genetic variability has been reported so far at this locus in donkey.Consequently, in order to detected variability, total RNA was extracted from milk somatic cells of 6 unrelated Ragusana donkeys reared in Central Italy. The mRNA fragment comprised between the last 84nt of exon 1 and the first 285nt of exon 4 was amplified by RT-PCR and sequenced. Primers (For GCAAGGTCTTTGAAAGATGT and Rev ACCAGCATTAGTTCTATTCG) were designed using as template the genomic donkey sequence (EMBL ID: NW_014638180). The obtained sequence (465bp) is relative to the cDNA tract spanning the last 64nt of exon 1 to the 236thnt of exon 4. Stop codon is located at the 65th-67thnt of exon 4. Sequences’comparison showed a transition G→A at the 160thnt of exon 2 (NW_014638180:g1784688C>T) responsible for the aa change Arg90→Gln. The presence of the codon CGA at exon 2 of the donkey milk lysozyme encoding gene might represent the ancestral condition of the gene in equidae, as it has also been found in other donkey and male sequences. The identification of this SNP could represent the first report of polymorphism at this locus in donkey. Next step of the research will be the analysis of a large number of samples in order to establish the frequency of this mutation in donkey species and to evaluate if and how the new genetic variant may influence functional and biological properties of donkey's milk

Despite the growing diffusion of cosmopolite specialized breeds, several autochthonous cattle breeds and populations are still bred in Italy. The aim of this study was to provide a high-resolution picture of the genome-wide diversity and population structure of Italian local cattle breeds using medium-density genome-wide SNP markers. After data editing, the dataset included 800 samples from 32 breeds that were genotyped for 31 013 SNPs. For several breeds we observed a low level of polymorphism and genetic diversity, that together with the small effective population sizes confirmed threat of extinction. According to the runs of homozygosity analysis, evidence of recent inbreeding was strong in some breeds. Low pair-wise genetic differentiation values, shared ancestry, admixture events, and reticulations observed on the phylogenetic tree between some breeds, all suggest high levels of gene flow. Clear clusters and relationships between breeds that originated from the same region or area were detected. However, in spite the complex admixture history of most breeds, many of the local Italian cattle breeds have retained unique identities and are differentiated breeds, and this can be due to differences in the origin, differences in climate, genetic isolation and inbreeding. This study represents the first exhaustive analysis of Italian cattle diversity. The results largely agreed with the breeding history of the Italian cattle breeds. The population structure and the low genetic diversity presented here for several breeds should be useful in creating conservation strategies. If reproductive isolation within groups of the same herd and area is maintained in subsequent generations, the short-term rate of inbreeding will increase dangerously, resulting in a decrease in the effective population size and seriously damaging the breeds future. Thus, efforts should be made to improve genetic diversity in these breeds. In particular, mating decisions will play an important role in limiting inbreeding and will increase the size of these local breeds.

The current availability of large numbers of single nucleotide polymorphisms (SNPs) throughout the genome makes these markers particularly suitable for the detection of patterns of genetic diversity and of genome-wide homozygosity in animal populations. The aim of this work was to estimate genetic diversity and homozygosity in the Maremmana cattle breed. We used a sample of 149 animals (males and females) geno-typed with the BovineSNP50 v2 (54K) Illumina BeadChip. After editing for call-rate >0.9 and removing SNP unassigned or on the sex chromosomes, 128 animals and 50,814 SNPs were left. We estimated the following genetic parameters: observed and expected heterozygosity (Ho and He), minor allele frequency (MAF), and the F IS statistic. We also scanned the genome for runs of homozygosity (ROH). In the present study, ROH were detected based on 20-SNP-long sliding-windows , and allowing for a maximum of 1 missing and 1 het-erozygote genotype, and a maximum gap between consecutive SNP of 10 5 bp. ROH contained minimum 10 SNPs, and had a minimum length of 1 Mb and a minimum density of 1 SNP every 50 kbps. The average Ho and He were 0.374 ± 0.132 and 0.365 ± 0.120, respectively, and the average MAF was 0.274 ± 0.130. These values are consistent with the range observed in other cattle breeds. We obtained some negative values for F IS (-0.162 to 0.180) which corresponded to animals with lower than average homozygosity. In total, 10,465 ROH were detected (81.75 per animal), with an average length of 2.69 Mb. Most ROH (74%) had length 2 Mb. ROH are contiguous lengths of homozygous genomic segments where the two inherited hap-lotypes are identical. ROH indicate genomic regions where a reduction in heterozygosity occurred, and offer new opportunities to estimate inbreeding (F). The inbreeding coefficient based on ROH (F ROH) was estimated by the ratio between the total ROH length and the size of the genome in each animal. Average F ROH was 0.0869 ± 0.032. Unlike inbreeding estimated based on Ho, F ROH is not influenced by allele frequencies (sampling) and can distinguish recent from ancient inbreeding. However, F ROH requires SNP positions to be known (unlike Ho). Two genomic regions with ROH in over 60% of the animals were found: one on BTA6 (38.6-39.7 Mbps), one on BTA13 (54.3-54.8 Mbps). These may highlight regions where selective pressures have shaped the genome of the Maremmana breed .

Analysis of genomic data is increasingly becoming part of the livestock industry and is an invaluable resource for effective management of breeding programs in small populations. The recent availability of genome-wide SNP panels allows providing background information concerning genome structure in domestic animals, opening new perspectives to livestock genetics. BOVITA was established to join local efforts and resources for the genomic characterization of Italian local cattle breeds. Despite the growing diffusion of some cosmopolite specialized breeds, several autochthonous breeds are still bred in Italy. The main aim of the BOVITA is to investigate the genomic structure of Italian local cattle breeds, to provide information on their genetic status that will be useful for the management of the genetic variability, as a contribution to biodiversity conservation and prioritization actions. A total of about 800 animals (20-32 per breed) belonging to thirty Italian cattle breeds (Agerolese, Barà-Pustertaler, Burlina, Cabannina, Calvana, Chianina, Cinisara, Garfagnina, Italian Brown, Italian Holstein, Italian Simmental, Marchigiana, Maremmana, Modenese, Modicana, Mucca Pisana, Pezzata Rossa d’Oropa, Piedmontese, Pinzgau, Podolica, Pontremolese, Pustertaler, Reggiana, Rendena, Romagnola, Rossa Siciliana, Sarda, Sardo-Bruna, Sardo-Modicana and Ottonese-Varzese) and two cosmopolitan breeds (Charolaise and Limousine) genotyped with the Illumina BovineSNP50 v2 BeadChip array were collected for the analysis. The genotypes of several breeds were detected in the frame of the project, whereas for some breeds these data are derived by previous studies. The dataset will be analyzed to: study several aspects of population genetic diversity, multi-dimensional scaling plot, population structure, linkage disequilibrium, and runs of homozygosity. In addition, comparative analysis of conserved haplotypes will be conducted to identify genomic segments under selection pressure. Such information also provides important insights into the mechanisms of evolution and is useful for the annotation of significant functional genomics regions. Data analysis will also be useful to select SNPs suitable for parentage test and breed genetic traceability. The analysis of the data will pinpoint the genetic distinctiveness of Italian breeds. Moreover, the obtained results contribute to a better characterization of history and genetic structure of Italian cattle breeds.

The Italian Goat Consortium (IGC), joined the effort of many Universities and Research Institutes, in a comprehensive study of the Italian goat population genetic makeup using a medium density (54K) SNPs chip. Currently IGC has geno- typed more than 1,000 animals from more than 30 goat breeds and populations from all Italian geographical and agro- ecological areas of goat rearing. The aim of this work is to obtain a clear picture of the Italian caprine biodiversity, to reconstruct the ancestry, to disentangle the genetic background and to assess the relationships among and within the investigated breeds. To date, the IGC dataset includes about 50 million genotypes. The data were quality checked by excluding markers and individuals on the basis of missing genotypes, minor allele frequency and close individual relatedness. Genetic relationships among and within breeds was investigated by Multi-Dimensional Scaling and Principal Component Analysis. Population structure, ancestry models and admixture were estimated by ADMIXTURE and fastSTRUCTURE software. Finally, phylogenic trees were recon- structed with PHYLIP software suite starting from shared-allele identity by state, and Reynolds distance matrices, while past migration events were modeled with TreeMix software. The results confirmed high levels of genetic polymorphism and confirmed the North-South geographical pattern of diver- sity, previously reported on a smaller sample of Italian goat breeds. The analysis also revealed a pivotal role of Central Italy in connecting the genetic resources of the northern and southern areas of the country, and confirms the genetic isola- tion of insular breeds. Moreover, some breeds show clearly distinctive and homogeneous gene pools, whereas other breeds present complex and, in some cases, dishomogeneous genetic background. Even if "A breed is a group of domestic animals, termed such by common consent of the breeders" (Lush J.L., 1994), genomic tools are useful in understanding the genetic back- ground of populations and in defining their relationships or uniqueness. These tools can complement the traditional ones in providing farmers and their associations a powerful aid for a more conscious management of goat populations and their biodiversity.

International audience

We investigated the genetic variability within and between cattle breeds. The polymorphisms of 17 microsatellites were studied in 220 unrelated animals belonging to four Italian beef cattle breeds (Chianina, Marchigiana, Romagnola, and Piemontese). Variations of allelic frequencies were examined to characterize the breeds and their relationships. Wahlund coefficients, Polymorphism Information Content values, and Haldane exact test for Hardy-Weinberg proportions were calculated. The results show that the Hardy-Weinberg equilibrium is not always maintained. Moreover, in addition to the classical genetic distances, a new method, based on the consideration of a multilocus genotype of each animal, was set up to measure the genetic similarity between animals or within groups of animals. All the results showed that, whereas Chianina occupies an intermediate position and Piemontese is the most distinct of all four breeds, Marchigiana and Romagnola display the strongest similarity. The new method also provides evidence that average similarities are always higher within breeds than between breeds. By comparing pairwise the multilocus genotypes, it was also possible to discriminate the individuals with higher or lower genetic similarities so that each breed could be subdivided into two groups of animals in relation to their similarity to the average breed multilocus genotype. High similarities between breeds were detected, somewhat surprisingly, when the most homogeneous groups of each breed were compared. The microsatellite multilocus genotype is particularly efficient in evaluating the between- and within-breeds genetic similarities and for subgrouping genetically more homogeneous animals.

International audience

"Chantier qualité spécifique "Auteurs Externes" département de Génétique animale : uniquement liaison auteur au référentiel HR-Access "; International audience

"Chantier qualité spécifique "Auteurs Externes" département de Génétique animale : uniquement liaison auteur au référentiel HR-Access "; International audience

International audience