Search

The virome of babaco (Vasconcellea x heilbornii) —a non-traditional fruit crop native to Ecuador— was investigated by high-throughput sequencing (HTS) on plants obtained from a commercial nursery. Six virus-like sequences were detected, including the full length of papaya ringspot virus (PRSV) and an RNA-dependent-RNA-polymerase (RdRp) sequence with homology to papaya virus Q. Three RNA sequences were found with homology, respectively, to apple latent spherical virus (genus Cheravirus, 71% nt identity), cherry leaf roll virus (genus Nepovirus, 54% nt identity) and Citrullus lanatus cryptic virus (genus Deltapartitivirus, 66% nt identity); whereas a DNA pararetrovirus-like sequence with homology to citrus endogenous pararetrovirus (58% nt identity) was also detected. RT-PCR-based virus surveys on a total of 284 samples collected from three provinces revealed that the partitivirus- and pararetrovirus-like sequences were present in 100% of tested plants; whereas the other virus sequences were detected in up to 68% of plants and were associated with different symptoms. This work provides information on the occurrence and prevalence of PRSV and five additional virus-like sequences in babaco, a vegetatively propagated crop, supporting the need for a virus-free certification program.

To investigate the virus infections of sour and sweet cherries, various locations of Niğde province were examined during 2017. Ninety sweet and sour cherry leaf samples showing suspicious virus symptoms were collected and screened with virus-specific primers: Little cherry virus 1 (LChV1), Cherry necrotic rusty mottle virus (CNRMV), Prune dwarf virus (PDV), Prune necrotic ring spot virus (PNRSV), Apple mosaic virus (ApMV), Cherry green ring mottle virus (CGRMV), Cherry leaf roll virus (CLRV), Cherry mottle leaf virus (CMLV), Plum bark necrotic stem pitting associated virus (PBNSPaV), Cherry twisted leaf virus (CTLV), Apple stem grooving virus (ASGV), Little cherry virus 2 (LChV2), Cherry rusty leaf virus (CRLV), Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV). Based on RT-PCR analysis, no amplification was observed except LChV1 amplifications, dsRNA analysis resulted in one suspicious profile. To validate those results, more sensitive TaqMan Real-Time PCR analysis and sequence analysis were conducted and LChV1 was detected on 7 samples. It can be concluded that only a low quantity of LChV1 infections was observed on some of the screened cherry samples.

Field surveys were conducted in Greek olive orchards from 2017 to 2020 to collect information on the sanitary status of the trees. Using a high-throughput sequencing approach, viral sequences were identified in total RNA extracts from several trees and assembled to reconstruct the complete genomes of two isolates of a new viral species of the genus Tepovirus (Betaflexiviridae), for which the name olive virus T (OlVT) is proposed. A reverse transcription–polymerase chain reaction assay was developed which detected OlVT in samples collected in olive growing regions in Central and Northern Greece, showing a virus prevalence of 4.4% in the olive trees screened. Sequences of amplified fragments from the movement–coat protein region of OlVT isolates varied from 75.64% to 99.35%. Three olive varieties (Koroneiki, Arbequina and Frantoio) were infected with OlVT via grafting to confirm a graft-transmissible agent, but virus infections remained latent. In addition, cucumber mosaic virus, olive leaf yellowing-associated virus and cherry leaf roll virus were identified.

Prunus necrotic ring spot virus (PNRSV), Cherry leaf roll virus (CLRV) and Apple chlorotic leaf spot virus (ACLSV) indexed tree of Japanese plum Santa Rosa was used as the source of explants in our studies. Shoot buds were collected and cultured on Murashige and Skoog (MS) medium with different concentrations of benzyl adenine (BA) and gibberellic acid (GA3) for in vitro culture establishment. Maximum per cent establishment (75.92%) was achieved on MS medium supplemented with 2.0 mg L−1 BA and 0.5 mg L−1 GA3. Maximum shoot multiplication was achieved on MS medium fortified with 0.5 mg L−1 BA, 0.1 mg L−1 GA3, 0.05 mg L−1 IBA and 10 mg L−1 casein hydrolysate. For in vitro rooting shoots were pretreated on half strength liquid MS medium containing 5.0 mg L−1 IBA for 24 h followed by transfer to MS basal medium resulting in 79.80% rooting. In vitro raised plantlets were hardened with 80–85% survival after 1 month and were successfully transferred to the field after 1 year with 100% survival. On RAPD analysis, all the amplified products were monomorphic in micropropagated plants and were similar to the mother plant. The micropropagation protocol developed is appropriate for mass clonal propagation of Santa Rosa.

The genome sequence of a new subgroup C nepovirus from Stenotaphrum secundatum in Australia is described. This virus, tentatively named Stenotaphrum nepovirus (SteNV), was present in separate plants as a mixed infection with either sugarcane mosaic virus or Panicum mosaic virus. The virus genome was divided between two RNA segments, 7,824 and 7,104 nucleotides (nt) in length, which each encode a single long polyprotein with putative 3C-like cysteine protease sites of the type H/G, H/S or L/S. The 3' untranslated region of RNA2, at 2,155 nt, is the longest observed for any subgroup C nepovirus. Phylogenetic analyses using protease-polymerase and coat protein amino acid alignments suggest that SteNV is most closely related to cherry leaf roll virus. Using a newly developed RT-PCR assay, this virus was detected at multiple localities in New South Wales, Queensland and Western Australia, and in a second host species, Digitaria didactyla. No consistent association between virus infection and symptoms could be established. The economic importance, pathogenicity and transmission of this novel virus species warrant further investigation.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Pollen transmitted viruses require accurate detection and identification to minimize the risk of spread through the global import and export of pollen. Therefore in this study we developed RT-qPCR assays for the detection of Cherry leaf roll virus (CLRV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), and Cherry virus A (CVA), four viruses that infect pollen of Prunus species. Assays were designed against alignments of extant sequences, optimized, and specificity was tested against known positive, negative, and non-target controls. An examination of assay sensitivity showed that detection of virus at concentrations as low as 101 copies was possible, although 102 copies was more consistent. Furthermore, comparison against extant assays showed that in both pollen and plant samples, the newly developed RT-qPCR assays were more sensitive and could detect a greater range of isolates than extant endpoint RT-PCR and ELISA assays. Use of updated assays will improve biosecurity protocols as well as the study of viruses infecting pollen.

Hydrangea is a popular, summer flowering, ornamental shrub that is native to south and east Asia and North and South America, which is now cultivated throughout the world. Currently, 13 viruses belonging to eight genera have been reported in Hydrangea spp. (1). In April 2011, virus-like disease symptoms, including severe leaf deformation and chlorosis, were observed on two Hydrangea macrophylla ‘Sumiko’ plants from Australia being held in quarantine in New Zealand. Systemic symptoms of veinal necrosis, necrotic halo spots, and severe leaf deformation were observed on Nicotiana occidentalis ‘37B’ 7 days after inoculation with sap from the symptomatic hydrangea plants. Upon reinoculation with sap of symptomatic leaves from N. occidentalis, necrotic ringspots and tip necrosis, typical of nepovirus infection, were observed on leaves of N. tobacum and Chenopodium quinoa, respectively. Transmission electron microscopy of negatively stained sap from symptomatic leaves of N. occidentalis revealed the presence of isometric particles ~28 nm in diameter. Total nucleic acid was extracted from the symptomatic leaves of N. occidentalis with an InviMag Plant DNA Mini Kit (Invitek GmbH, Berlin, Germany) and a KingFisher mL workstation (Thermo Scientific, Waltham, MA). Reverse transcription (RT)-PCR using the reverse primer of Werner et al. (2) and a forward primer, 5′-CGGTGGAGATGCCGGTCCTA-3′ (this study), specific to the 3′-untranslated region (3′-UTR) of Cherry leaf roll virus(CLRV) produced an amplicon of ~1,150 bp from N. occidentalis. A consensus sequence of 1,140 bp generated from four clones of the PCR product (GenBank Accession No. JN418885) was 99 and 98% identical at the nucleotide level to a CLRV isolate from Rumex AGBC (GenBank No. AB168099) and Chinese chives (GenBank No. AB168098), respectively. N. occidentalis also tested positive for CLRV using polyclonal antiserum in a double antibody sandwich-ELISA (BIOREBA, Reinach, Switzerland). The presence of CLRV in the original samples and N. occidentalis was confirmed by direct sequencing of the 380-bp amplicons obtained by immunocapture RT-PCR using CLRV-specific primers (2) and the same antiserum. BLASTn analysis of these amplicons (data not submitted to GenBank) also showed 99% nucleotide identity to a New Zealand isolate from a Rubus sp. (GenBank No. AJ877162). The hydrangea plants were released from quarantine because the same strain of CLRV had previously been reported in New Zealand. To our knowledge, this is the first report of CLRV in hydrangea. CLRV is a seed and pollenborne nepovirus and can be transmitted mechanically and by grafting. Since hydrangeas are mainly vegetatively propagated and are less commonly grown from seeds, the natural spread of CLRV will depend on the movement of infected propagation material. It is unknown whether this virus causes reduction in flower quality in hydrangea as reported in other hosts but any impact on flower quality may be of economic significance in commercial nurseries. References: (1) M. Caballero et al. Plant Dis. 93:891, 2009. (2) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Summary Cherry leaf roll virus (CLRV) infection is common in Betula pendula and B. pubescens in Middle and North Europe, easily observable by chlorotic leaf vein banding, mottling and leaf roll, partially adherent with progressive loss of vitality or death of twigs and branches. In Fennoscandia, a severe viral epidemic in various birch species in forest stands, public greens and roadsides is associated with CLRV. In Corsica, CLRV-typical symptoms were observed on birch trees (Betula sp.) in a montane stand (1470 m) at Col de Vergio. CLRV was detected by RT-nested PCR in all leaf samples from 11 randomly selected birch trees exhibiting characteristic symptoms. Along with the fact that this is the first report of CLRV in Betula sp. of both montane and Mediterranean origins, remarkably high genetic variation and a new distinct phylogenetic cluster are comprised by a small randomly sampled CLRV population that has evolved in one of the few scattered birch stands in Corsica.

A viral epidemic associated with the Cherry leaf roll virus (CLRV) has emerged in Betula species in Fennoscandia, exhibiting quick and effective spread during the last 15 years. A population genetics approach is chosen in order to characterise the virus diversity and the sources of genetic variation aiming to investigate the epidemiology of the pathogen. In a CLRV population from Rovaniemi urban parks and a population that occurred after infecting young Betula seedlings with scions from the original Finnish trees, the genetic diversity is found to be remarkably high, mixed infections by CLRV variants from different phylogenetic groups are detected in single trees, while recombination is evidenced to occur. The estimated genetic variability is high and the CLRV haplotypes detected exhibit clear clustering and belong to different phylogenetic groups. The structure of the viral population reveals a pathogen with high evolutionary potential assumed to carry on its effective spread.

Walnut orchards in main production areas of Poland were surveyed in spring-early summer 2009–2018 to determine the incidence of Cherry leaf roll virus (CLRV). The virus was detected by DAS-ELISA in 46 out of 348 samples. One-step RT-PCR confirmed the positive results of DAS-ELISA. Primer pair CLRV62-F/CLRV1482-R designed during this study based on RNA2 complete sequence of the CLRV strain 739 from Actinidia chinensis (accession number: KC937026), was used to amplify ~1.4 kb fragment of 3′ untranslated region (3′ UTR) of ten isolates (O1, 8.1, 9.10, GP, O2, O6, O14, O15, 4.8, and 10.1). The RFLP and sequence analyses of this region showed the significant variability of the walnut isolates which were clustered into D1 and D2 phylogenetic groups. O2, O15 and GP isolates distinguished among the other classified to D2 group by possessing of the 8-nucleotide (nt) insert which was also present in nucleotide positions 6102–6109 of RNA2 sequence of the 739 strain. However, this mutation and another 5-nt insertion not present in nucleotide position 6067–6072 of RNA2 sequence of the 739 strain, did not significantly affect the phylogenetic position of walnut isolates. The reaction of Chenopodium quinoa, C. amaranticolor, Cucumis sativus, Nicotiana tabacum ‘Samsun’, and N. benthamiana on sap inoculation with CLRV varied dependently on host species and virus isolate.

Data from next generation sequencing indicate the complexity of the birch virome in the urban landscape of Berlin. It is well known that plant viruses are widespread and contribute to the decline of birch trees. A mixed infection by Cherry leaf roll virus (CLRV), Apple mosaic virus (ApMV) and two newly discovered viruses from the genus Badna- and Carlavirus were investigated in southern Berlin (Steglitz-Zehlendorf) in 2015 and 2016. To gain a more detailed view on epidemiology of this viral complex in birch, the study was enlarged in 2017 including eight districts all over Berlin. Birch trees with symptoms like defoliation and degeneration were selected for determination of viral pathogens by molecular biological methods. Within the complex occurring symptoms in birch trees, new types of symptoms have been identified. Different combinations of plant viruses in single and mixed infection were detected by Reverse Transcription- Polymerase Chain Reaction (RT-PCR.) CLRV and Badnavirus combinations have shown to be distinct and widely distributed. Heterogeneity is also known from the symptomatology of virus containing birch leaves. As the correlation of symptoms and viral infection is not shown yet for the mixed infections, it is unknown if the complexity of the virome is the cause of the variability of symptoms. Epidemiology and pathogenicity of the newly discovered viruses as well as species specificity, life cycle, mode of transmission, host plant range and phylogeny are totally unknown and have to be investigated within the next years.

Eleven of the 15 Vitis-infecting nepoviruses are thought to have an Old World origin, either Eurasian, i.e., Grapevine fanleaf virus (GFLV); European, i.e., Arabis mosaic virus (ArMV), tomato black ring virus (TBRV), Grapevine chrome mosaic virus (GCMV), Grapevine Bulgarian latent virus (GBLV), raspberry ringspot virus (RpRSV), artichoke Italian latent virus (AILV), and cherry leaf roll virus (CLRV); north African (Tunisia), i.e., Grapevine Tunisian ringspot virus (GTRSV); and Asiatic (Turkey and Iran), i.e., Grapevine deformation virus (GDeV) and Grapevine Anatolian ringspot virus (GARSV). Only four of these viruses (GFLV, ArMV, RpRSV, and TBRV) have ectoparasitic longidorid nematodes belonging to the genera Xiphinema, Longidorus, and Paralongidorus as recognized vectors. Whereas mechanical transfer to herbaceous indicators is readily achieved with all these viruses, their transmission through pollen and seeds is rare and does not seem to occur in grapevines. Some of these viruses (GFLV, GBLV, GCMV, GTRSV, GDeV, and GARSV) are apparently restricted to Vitis, while AILV, CLRV, RpRSV, and TBRV have a host range that includes woody and herbaceous crops, as well as weed species. All these viruses cause systemic, symptomatic infections in grapevines. Depending on the strains involved, infection with these viruses induces either chlorotic mottling and deformation of leaves and canes (by the distorting strains) or bright yellow discolorations of the leaves (by the chromogenic strains). Like all known nepoviruses, the grapevine-infecting ones from the Old World have a bipartite genome and require both genomic RNAs for infection. Planting selected stocks that have undergone sanitation and certification procedures in soils free of the nematode vectors should guarantee the sanitary conditions of new plantings for the lifespan of the vineyards. This is not the case for plantings in nematode-infested soils because removal of the roots from the previous stand and prolonged fallow period do not prevent the resurgence of the infection.

The goals of the University of California-Davis Walnut Improvement Program are to develop improved scion and rootstock cultivars for the California walnut industry and to utilize emerging genomic tools to increase breeding efficiency. Scion breeding objectives include new cultivars with early harvest dates, light kernel color, and resistance to blight and the development of scions with resistance to Cherry leaf roll virus. Rootstock development is directed at genetic resistance to soil-borne pathogens including Phytophthora, nematodes, and crown gall. Advances in clonal propagation methods, particularly micropropagation, have allowed replicated testing of genotypes of interest and have facilitated an expanding commercial production of improved clonal rootstocks. RX1, a Juglans microcarpa × Juglans regia hybrid with resistance to Phytophthora, and VX211, a very vigorous Juglans hindsii × J. regia hybrid exhibiting nematode tolerance, have been released for commercial use. Phenotyping, DNA mapping, and bioinformatic analyses are being combined to generate markers for traits of interest, including lateral bearing, kernel color, and harvest date, and will be used to improve selection efficiency. The Walnut Improvement Program is an integrated effort that depends on research cooperation with pathologists, molecular biologists, and UC Extension farm advisors, and relies on the assistance of commercial nurseries and walnut growers for planting and evaluation of statewide trials.

Cherry leaf roll virus (CLRV) isolates from Malus domestica, Ribes rubrum, Rubus idaeus, Rumex obtusifolius and Vaccinium darrowii were characterized based on nucleotide sequences of a 371 bp fragment of the 3′ untranslated region (UTR) of their genomic RNAs, symptoms in the herbaceous hosts, Chenopodium amaranticolor, Chenopodium quinoa, Nicotiana benthamiana, Nicotiana occidentalis and Nicotiana tabacum, and seed transmission in N. occidentalis. The different isolates induced a range of localized and systemic disease symptoms, of varying severity, in the herbaceous hosts. The isolates from M. domestica, R. rubrum, R. obtusifolius and V. darrowii all showed greater than 80% seed transmission in N. occidentalis, but no seed transmission was observed for the R. idaeus isolate. Based on symptoms and seed transmission, the isolates appear to be biologically distinct strains of CLRV. Phylogenetic analysis of the nucleotide sequences from the 3′ UTR, commonly used to detect CLRV, showed that four isolates from M. domestica, R. rubrum, R. idaeus and V. darrowii were almost identical but an isolate from R. obtusifolius exhibited a pairwise nucleotide difference of up to 5·4% when compared to these isolates. There was no obvious correlation between sequence differences and symptomatology.

During 2006 and 2007, a survey on the incidence and distribution of fourteen grapevine viruses was carried out in the Skadar Lake basin, one of the two main grapevine-growing areas of Montenegro. In total 165 samples were collected from four red (‘Vranac’, ‘Kratosija’, ‘Merlot’ and ‘Cardinal’), two white (‘Chardonnay’ and ‘Rkaciteli’) and a few unknown grapevine varieties in the vicinity of Podgorica and Bar. The phytosanitary status of the collected samples was analysed by DAS-ELISA and the presence of Grapevine fanleaf virus (GFLV), Grapevine leafroll-associated virus 1 (GLRaV-1), Grapevine leafroll-associated virus 2 (GLRaV-2) and Grapevine leafroll-associated virus 3 (GLRaV-3) was confirmed in some of them. The most frequently found virus in assayed samples was GLRaV-3 (54.5%), followed by GFLV (23%), GLRaV-1 (20%) and GLRaV-2 (0.6%). These serological analyses showed the absence of Grapevine leafroll-associated virus 6 (GLRaV-6), Grapevine leafroll-associated virus 7 (GLRaV-7), Raspberry bushy dwarf virus (RBDV), Strawberry latent ringspot virus (SLRSV), Tomato ringspot virus (ToRSV), Raspberry ringspot virus (RpRSV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV), Tomato black ring virus (TBRV) and Cherry leaf roll virus (CLRV) from all tested samples.

Cherry leaf roll virus (CLRV) was detected in apple (Malus sp.), a host not previously reported for CLRV in New Zealand. A total of 72 leaf samples were obtained from two orchards in the Waikato region of the North Island of New Zealand and tested by reverse transcription-polymerase chain reaction (RT-PCR). Virus-specific RT-PCR, sequencing and mechanical inoculation on herbaceous host plants detected the presence of CLRV in three samples. This is the first report of CLRV on apple in New Zealand. Based on a thorough review of literature, results obtained in this study may likely represent the first case of CLRV in apple.

The complete nucleotide sequence of cherry leaf roll virus (CLRV, genus Nepovirus) from a naturally infected cherry tree (Prunus avium cv. Bing) in North America was determined. RNA1 and RNA2 consist of 7,893 and 6,492 nucleotides, respectively, plus a poly-(A) tail. Each RNA encodes a single potential open reading frame. The first 657 nucleotides of RNA1 and RNA2 are 99% identical and include the 5′-UTR and the first 214 deduced amino acids of the polyproteins following the first of two in-frame start codons. Phylogenetic analysis reveals close relationships between CLRV and members of subgroup C of the genus Nepovirus. Electronic supplementary material The online version of this article (doi:10.1007/s00705-011-1208-4) contains supplementary material, which is available to authorized users.

There is a growing need for virus sensors with improved sensitivity and dynamic range for disease diagnosis, pharmaceutical research, agriculture and homeland security. Membrane-engineered animal cells bearing antibodies against viral antigens have been previously used for biorecognition biosensors for the ultrarapid (3 min), sensitive (1 ng/ml) detection of plant viruses, such as the cucumber mosaic virus. We here report a new approach for the construction of cell-based sensors for virus detection, based on membrane (antibody)-engineered bacteria. The novel method was applied for the detection of tobacco mosaic virus (TMV) and cherry leaf roll virus (CLRV) using sensors containing modified Escherichia coli XL-1Blue MRF’ bacteria. E. coli membranes have been engineered with electro-inserted, virus-homologous antibodies. The detection principle was based on the measurement of changes in the bacterial membrane potential as a result of virus–antibody binding. After optimization of the membrane-engineering process, the virus detection limit for TMV and CLRV with the bacteria-based biosensor system was 1 pg/ml, representing a 1000-fold improvement over currently available methods. Although the novel biosensor is still in its proof-of-concept stage of development, its sensitivity and speed (assay time: 60–100 s) could make it a very promising tool for high throughput, field-based virus screening.