Search

Device-To-Device (D2D) communication is a new technology that allows the mobile terminals to directly communicate with each other by sharing the resources of the cellular network under the control of a cellular system. D2D communication was introduced into the cellular network in order to improve the efficiency of resource utilization and increase the system throughput. However, there exist interferences between D2D links and cellular links due to the resource reuse. In order to efficiently limit the cases of interference, a joint resource allocation scheme for D2D communication under a cellular network is proposed. The scheme, based on the user’s Quality of Service (QoS), defines a new utility function to balance the increasing system throughput and the interference in the cellular users D2D communication. The optimal D2D transmitting power is obtained through optimizing the utility function by using the convex optimization theory. The simulation shows that the scheme can fulfill the user’s QoS requirements efficiently, improve the system throughput and the reliability of the resources as well.

Abstract Background Mesenchymal stem cells (MSCs) have been considered to be the attractive vehicles for delivering therapeutic agents toward various tumor diseases. This study was to explore the distribution pattern, kinetic delivery of adenovirus, and therapeutic efficacy of the MSC loading of E1A mutant conditionally replicative adenovirus Adv-Stat3(-) which selectively replicated and expressed high levels of anti-sense Stat3 complementary DNA in breast cancer and melanoma cells. Methods We assessed the release ability of conditionally replicative adenovirus (CRAd) from MSC using crystal violet staining, TCID50 assay, and quantitative PCR. In vitro killing competence of MSCs carrying Adv-Stat3(-) toward breast cancer and melanoma was performed using co-culture system of transwell plates. We examined tumor tropism of MSC by Prussian blue staining and immunofluorescence. In vivo killing competence of MSCs carrying Adv-Stat3(-) toward breast tumor was analyzed by comparison of tumor volumes and survival periods. Results Adv-Stat3(-) amplified in MSCs and were released 4 days after infection. MSCs carrying Adv-Stat3(-) caused viral amplification, depletion of Stat3 and its downstream proteins, and led to significant apoptosis in breast cancer and melanoma cell lines. In vivo experiments confirmed the preferential localization of MSCs in the tumor periphery 24 hours after tail vein injection, and this localization was mainly detected in the tumor parenchyma after 72 hours. Intravenous injection of MSCs carrying Adv-Stat3(-) suppressed the Stat3 pathway, down-regulated Ki67 expression, and recruited CD11b-positive cells in the local tumor, inhibiting tumor growth and increasing the survival of tumor-bearing mice. Conclusions These results indicate that MSCs migrate to the tumor site in a time-dependent manner and could be an effective platform for the targeted delivery of CRAd and the amplification of tumor killing effects.

Abstract Background P21(WAF1/Cip1) binds to cyclin-dependent kinase complexes and inhibits their activities. It was originally described as an inhibitor of cancer cell proliferation. However, many recent studies have shown that p21 promotes tumor progression when accumulated in the cell cytoplasm. So far, little is known about the correlation between cytoplasmic p21 and drug resistance. This study was aimed to investigate the role of p21 in the cisplatin resistance of ovarian cancer. Methods RT-PCR, western blot and immunofluorescence were used to detect p21 expression and location in cisplatin-resistant ovarian cancer cell line C13* and its parental line OV2008. Regulation of cytoplasmic p21 was performed through transfection of p21 siRNA, Akt2 shRNA and Akt2 constitutively active vector in the two cell lines; their effects on cisplatin-induced apoptosis were evaluated by flow cytometry. Tumor tissue sections of clinical samples were analyzed by immunohistochemistry. Results p21 predominantly localizes to the cytoplasm in C13* compared to OV2008. Persistent exposure to low dose cisplatin in OV2008 leads to p21 translocation from nuclear to cytoplasm, while it had not impact on p21 localization in C13*. Knockdown of cytoplasmic p21 by p21 siRNA transfection in C13* notably increased cisplatin-induced apoptosis through activation of caspase 3. Inhibition of p21 translocation into the cytoplasm by transfection of Akt2 shRNA into C13* cells significantly increased cisplatin-induced apoptosis, while induction of p21 translocation into the cytoplasm by transfection of constitutively active Akt2 in OV2008 enhanced the resistance to cisplatin. Immunohistochemical analysis of clinical ovarian tumor tissues demonstrated that cytoplasmic p21 was negatively correlated with the response to cisplatin based treatment. Conclusions Cytoplasmic p21 is a novel biomarker of cisplatin resistance and it may represent a potential therapeutic target for ovarian tumors that are refractory to conventional treatment.

Superconducting diode effect (SDE) with nonreciprocal supercurrent transport has attracted intense attention recently, not only for its intriguing physics, but also for its great application potential in superconducting circuits. It is revealed in this work that planar Josephson junctions (JJs) based on type‐II Weyl semimetal (WSM) MoTe2 can exhibit a prominent SDE due to the emergence of asymmetric Josephson effect (AJE) in perpendicular magnetic fields. The AJE manifests itself in a very large asymmetry in the critical supercurrents with respect to the current direction. The sign of this asymmetry can also be effectively modulated by the external magnetic field. Considering the special noncentrosymmetric crystal symmetry of MoTe2, this AJE is understood in terms of the Edelstein effect, which induces a nontrivial phase shift in the current phase relation of the junctions. Besides these, it is further demonstrated that the rectification of supercurrent in such MoTe2 JJs with the rectification efficiency up to 50.4%, unveiling the great application potential of WSMs in superconducting electronics. [ABSTRACT FROM AUTHOR]

Summary: Fractional‐order circuits, which contain fractance devices (Lβ and Cα) described by fractional‐order differential equations, are widely used in interdisciplinary engineering research. The application of time‐domain response (TDR) measurement increases rapidly in analyzing the characteristics of fractance devices and fractional‐order circuits. However, the previous methods are mainly focused on deducing TDR expressions of a single fractance device or series fractional‐order circuits in some specific input signals, while overlook the TDR analysis of series‐parallel fractional‐order circuits (SPFOC) that are commonly applied in modeling electrochemical impedance or electrical bioimpedance. This paper proposes a novel method to derive TDR expressions of SPFOC in an arbitrary periodic signal. First, a discretization method to represent the SPFOC as the sum of first‐order circuits is proposed in Cole distribution function, which could approximate the transfer function of fractional‐order impedance/admittance. Second, the TDR expression of SPFOC in sinusoidal input signals is deduced in inverse Laplace transform, which can be applied as the components of a general TDR expression of SPFOC in an arbitrary periodic signal based on the Fourier series theory. Finally, both TDR simulations and experiments on Cole impedance model (a basic SPFOC) are conducted to verify the proposed method, which shows excellent agreement compared to theorical analysis. This paper presents a TDR solution to SPFOC that consist of a RCα or RLβ element. In future, the theoretical and application extension of the proposed TDR analysis method is still necessary on analysis of more general fractional‐order circuits. [ABSTRACT FROM AUTHOR]

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding. [ABSTRACT FROM AUTHOR]

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics. [ABSTRACT FROM AUTHOR]