Search

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

Watermelon mosaic virus (WMV) is an economically important virus of cucurbit crops in Argentina. The available information on genetic variability must be continuously updated. In this study, we assessed the molecular variability of WMV isolates in Argentina based on the partial sequences of the NIb-CP region and compared them with isolates previously reported from around the world. Forty-six WMV isolates were obtained from naturally infected cucurbit crops collected from 10 provinces between 2011 and 2018. At the molecular level, WMV isolates were grouped into three distinct major phylogenetic groups based on genetic distance. Majority of the Argentine isolates belonged to the emerging group (G3), whereas one isolate was included in G1 and another cluster in G2. G3 was further divided into 5 subgroups, named EM1, EM2, EM3, EM4, and a new group “EMArg”, composed exclusively of Argentine isolates with high bootstrap support and high level of significance. Tajima’s D and Fu were significantly negative for G3 and EMArg, indicating that the population of this subgroup has recently expanded. AMOVA analysis showed that the isolates was not well correlated with their geographic origin. The fixation index (FST) value between the WMV isolates from the different provinces in Argentina was lower than 0.33, indicating a relatively frequent gene flow between provinces. In every group, the predominant evolutionary pressure was negative with a mean dN/dS

Environmental heterogeneity can shape the plant-virus relationship, furthering the appearance of new diseases in crops, or altering disease incidence and severity. In this work, we studied the virus association with environmental heterogeneity taking into account bio-meteorological variables and virus distribution. In Argentina, three potyviruses, Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), and Papaya ringspot virus (PRSV), and a cucumovirus, Cucumber mosaic virus (CMV), are the most common viruses infecting cucurbits. We identified the bio-meteorological variables that had the greatest impact on disease incidence. All the crops were infected with more than one virus in all the studied environments. Molecular and serological analyses showed the highest relative incidence for WMV (46%), the lowest for CMV (9%), and intermediate values for PRSV and ZYMV (20% and 24%, respectively). Infected plants had a random distribution. Viruses and bio-meteorological variables were highly correlated, with high support (Pearson’s r = 0.96, P

Los orthotospovirus causan graves daños económicos, siendo una limitación importante para la producción y la calidad en distintos cultivos. Los objetivos de este trabajo fueron identificar el agente causal de los síntomas observados en sandía en lotes de producción de Santiago de Estero y analizar su filogenia. Se realizaron muestreos en lotes de producción de sandía (Citrullus lanatus) durante la campaña 2017/2018 en la provincia de Santiago del Estero. Los resultados de este trabajo mostraron en las muestras de sandía la presencia de viriones característicos del género Orthotospovirus, además fueron positivas a pruebas serológicas y moleculares con reactivos específicos (DAS-ELISA y RTPCR) confirmando la presencia del Groundnut ringspot orthotospovirus (GRSV). Los fragmentos genómicos fueron amplificados, secuenciados y depositados en GenBank, acceso Nº MK680832 y MK680833. El análisis filogenético de las secuencias parciales de nucleótidos de la proteína N mostró que los aislamientos de GRSV provenientes de Argentina (hospedante sandía) fueron agrupados con alto valor de confianza. Estas secuencias se ubicaron en un clúster formado por secuencias del continente americano que se separaron de las de origen africano. Este trabajo constituye el primer reporte de la presencia del GRSV en cultivo de sandía (Citrullus lanatus) en Argentina. Orthotospoviruses cause serious economic damage, being a major limitation for production and quality in different crops. The objectives of this work were to detect the presence of orthotospovirus that are infecting cucurbit crops in the country and analyze its phylogeny. Samples were taken in watermelon (Citrullus lanatus) production lots during 2017/2018 in Santiago del Estero province. The results of this work showed in the watermelon samples showed the presence of characteristic virions of the Orthotospovirus genus, and were positive to serological and molecular tests with specific reagents (DAS-ELISA and RT-PCR) confirming the presence of groundnut ringspot orthotospovirus (GRSV). Genomic fragments were amplified, sequenced and deposited in GenBank, access nº MK680832 and MK680833. Phylogenetic analysis of N-protein nucleotide partial sequences showed that GRSV isolates from Argentina (watermelon host) were grouped into a new group with high bootstrap value. These sequences were placed in a cluster formed by sequences from the American continent that were separated from those that conformed the group of sequences of African origin. This work is the first report of the presence of the GRSV in watermelon (Citrullus lanatus) cultivation in Argentina. Fil: Pozzi, Elizabeth Alicia. Universidad Nacional de Córdoba. Facultad de Ciencias Agropecuarias; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatología y Modelización Agrícola - Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba. Unidad de Fitopatología y Modelización Agrícola; Argentina Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatología y Modelización Agrícola - Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba. Unidad de Fitopatología y Modelización Agrícola; Argentina Fil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatología y Modelización Agrícola - Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba. Unidad de Fitopatología y Modelización Agrícola; Argentina Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatología y Modelización Agrícola - Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba. Unidad de Fitopatología y Modelización Agrícola; Argentina Fil: Perotto, Maria Cecilia. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatología y Modelización Agrícola - Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba. Unidad de Fitopatología y Modelización Agrícola; Argentina

Molecular characterization is important for differentiating allexiviruses species, since detection by serological methods may be uncertain. Eight different species have been reported as infecting garlic: Garlic virus A, B, C, D, E, X (GarV-A, B, C, D, E, X), Shallot virus X (ShVX) and Garlic mite-borne filamentous virus (GarMbFV), and the complete genome is known for six of these. This work reports for the first time the complete sequence of GarV-B and makes a phylogenetic and recombination analysis between the different allexivirus species. Total RNA was obtained of a GarV-B positive garlic plant by ISEM-D using anti-GarV-B antiserum and this was sent for mass sequencing. Deep sequencing revealed the first complete GarV-B genome, consisting of 8327 nucleotides (nt). The genome contained six open reading frames (ORFs) with the typical genome organization which encodes putative proteins of 168 kDa (ORF1), 27 kDa (ORF2), 12 kDa (ORF3), 39 kDa (ORF4), 27 kDa (ORF5) and 14 kDa (ORF6). The comparison of the gene coding for the coat protein of the virus showed a greater identity of nt with other isolates of GarV-B (88.4 to 99.7%) and of GarV-X (75.4 to 78.3%) published in GenBank. The GarV-B replicase gene has not been previously reported in GenBank, so the sequence was compared with GarV-A, -C, −D, −E, −X and ShVX. The highest nt identity values were detected with isolates of GarV-X (73.5 to 74.1%) and GarV-C (71.9 to 72.8%). These results suggest that GarV-X and GarV-B may be different strains of the same virus. A genetic recombination analysis was also performed between the complete sequences of allexiviruses published and obtained in this work and it was detected that the species GarV-D and GarV-E may have arisen from the recombination of the N-terminal portion of GarV-B with the C-terminal portion of GarV-A.

The incidence and prevalence of strawberry viruses were determined in surveys of randomly selected strawberry plants grown in different regions of Argentina. In 2009 and 2010, 1034 plants from 28 fields and 1060 plants from 33 fields, respectively, were collected from Lules and Coronda. The samples were analysed by double‐antibody sandwich enzyme‐linked immunosorbent assay to detect Strawberry mild yellow edge virus (SMYEV). In 2014, 606 plants from 43 fields in Lules, Coronda and Mar del Plata were analysed by reverse transcription polymerase chain reaction with primers specific for SMYEV, Strawberry crinkle virus (SCV), Strawberry mottle virus (SMoV) and Strawberry polerovirus 1 (SPV1). The SMYEV incidence was 4–35%, while prevalence was 60–100%, depending on the year and region sampled. Meanwhile, SMoV and SPV1 incidences were 8–17%, and prevalences were 46–62%, depending on the virus and region sampled. SCV was observed relatively low (incidence was 0.5–8% and prevalence was 8–50%), although it was more abundant in Mar del Plata than in the other analysed regions. Spearman's correlation analysis indicated that SCV and SMYEV were correlated with disease symptoms (P < 0.005). A principal component analysis revealed a close relationship between SMYEV and SCV in Mar del Plata, in which the lowest temperatures were recorded. Interactions among viruses, regions and climatic conditions will need to be studied in greater detail. Accurately determining the incidence and prevalence of viruses in different regions will improve estimations of possible damages or yield decreases caused by viral infections during strawberry production.

More than 50 viruses have been reported in cucurbit crops worldwide. In Argentina, cucurbit viruses have been associated with important yield losses. The most prevalent and widespread potyvirus is Watermelon mosaic virus (WMV). WMV was detected in Argentina in all cucurbit species with high incidence. In this study, a WMV isolate (WMV 1 SDE FF) was obtained from a naturally infected squash associated with a severe outbreak on melon and squash crops in an important cucurbit growing area in Santiago del Estero province (Argentina), during a survey conducted in November 2012. The fully sequenced WMV 1 SDE FF genome consists of 10,027 nucleotides and shares 96 % nt identity and 98 % aa identity with the French isolates JF273464.1|C07–014 and EU660581.1|FMF00-LL1 of the WMV molecular group 3. Using the recombination detection program RDP4, two statistically significant recombination events were identified: event 1, an 830-nt long recombinant fragment in the putative P1 coding region, and event 2, a 4071-nt recombinant fragment detected across the HC Pro, P3 and CI coding regions. The putative parental sequences detected for event 1 were the EU660586.1| FBR04–37 (major parent) and JF273468.1|C07–284 (minor parent), both from France. Putative parental sequences for event 2 were JX079685.1| WMV-ShanXi (major parent) and HQ384216.1|Dendrobium (minor parent), from China and USA, respectively. To our knowledge, this is the first complete genome of an Argentine WMV isolate. Our results provide evidence that WMV 1 SDE FF is the causal agent of the strong outbreak reported in melon and squash fields in recent years. Inst. Patología Vegetal Fil: Perotto, Maria Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Pozzi, Elizabeth Alicia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Luciani, Cecilia E. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina

Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina. Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina. Instituto Nacional de Tecnologia Agropecuaria. Centro Regional Cordoba. Estacion Experimental Agropecuaria Marcos Juarez. Agencia de Extension Rural Bell Ville.; Argentina Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina

A new potyvirus, tentatively named cucurbit vein banding virus (CVBV), was identified in crops of cucurbits in San Pedro (Buenos Aires, Argentina). The complete genome sequences of two isolates of CVBV were obtained by next-generation sequencing (Illumina). The genomic RNA consisted of 9968 and 9813 nucleotides, respectively, and displayed typical potyvirus organization. The percentage identity for these two genome sequences, using BLASTn, was 77% to sweet potato virus c and 73% to tomato necrotic stunt virus. BLASTx analysis of the complete polyprotein showed that the most closely related virus is plum pox virus, with 48% amino acid sequence identity for both isolates. Sequence comparisons and phylogenetic analyses indicate that CVBV belongs to a previously undescribed species in genus Potyvirus. Fil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina Fil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina Fil: Mitidieri, Mariel Silvina. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina