Search

The objective of this study was to compare the performance of pharmacy students from a Pharmaceutical Care course, taught in both distance education (DE) and campus-based formats using active methodologies. For two semesters, students (n = 82) taking the course studied half the subject in the distance education format and half in person. Questionnaires were applied at the beginning of the semester aimed to outline the demographic profile of the students. Their grade in the course was evaluated to determine their performance. The Module 1 (Information on Medication) average on the campus-based was 7.1225 and on DE was 7.5519, (p = 0.117). The Module 2 (Pharmaceutical Services) average on the campus-based was 7.1595 and on distance education was 7.7025, (p = 0.027*). There was a difference in learning outcomes in the Pharmaceutical Care Course between face-to-face and distant education. Therefore, the student performance was better in the distance education module, indicating distance education can be satisfactorily used in Pharmacy Programs.

Microsatellites or Single Sequence Repeats (SSRs) are extensively employed in plant genetics studies, using both low and high throughput genotyping approaches. Motivated by the importance of these sequences over the last decades this review aims to address some theoretical aspects of SSRs, including definition, characterization and biological function. The methodologies for the development of SSR loci, genotyping and their applications as molecular markers are also reviewed. Finally, two data surveys are presented. The first was conducted using the main database of Web of Science, prospecting for articles published over the period from 2010 to 2015, resulting in approximately 930 records. The second survey was focused on papers that aimed at SSR marker development, published in the American Journal of Botany's Primer Notes and Protocols in Plant Sciences (over 2013 up to 2015), resulting in a total of 87 publications. This scenario confirms the current relevance of SSRs and indicates their continuous utilization in plant science.

We present the multiplex PCR data for the presence/absence of genes involved in OTA and FB2 biosynthesis in Aspergillus niger/Aspergillus welwitschiae strains isolated from different food substrates in Brazil. Among the 175 strains analyzed, four mPCR profiles were found: Profile 1 (17%) highlights strains harboring in their genome the pks, radH and the fum8 genes. Profile 2 (3.5%) highlights strains harboring genes involved in OTA biosynthesis i.e. radH and pks. Profile 3 (51.5%) highlights strains harboring the fum8 gene. Profile 4 (28%) highlights strains not carrying the genes studied herein. This research content is supplemental to our original research article, "Prospecting for the incidence of genes involved in ochratoxin and fumonisin biosynthesis in Brazilian strains of A. niger and A. welwitschiae" [1].

The root-knot nematode (Meloidogyne incognita) is one of most devastating pathogens that attack the common bean crop. Although there is evidence that some cultivars have race-specific resistance against M. incognita, these resistance sources have not proved effective, and nematodes are able to circumvent the host's defense system. We constructed RNA-seq based libraries and used a high-throughput sequencing platform to analyze the plant responses to M. incognita. Assessments were performed at 4 and 10 days after inoculation corresponding to the stages of nematode penetration and giant cell development, respectively. Large-scale transcript mapping to the common bean reference genome (G19833) resulted in the identification of 27,195 unigenes. Of these, 797 host genes were found to be differentially expressed. The functional annotation results confirm the complex interplay between abiotic and biotic stress signaling pathways. High expression levels of the wounding-responsive genes were observed over the interaction. At early response, an overexpression of the N gene, a TIR-NBS-LRR resistance gene, was understood as a host attempt to overcome the pathogen attack. However, the repression of heat shock proteins resulted in a lack of reactive oxygen species accumulation and absence of a hypersensitive response. Furthermore, the host basal response was broken by the repression of the ethylene/jasmonate pathway later in the response, resulting in a continuous compatible process with consequent plant susceptibility.

Breast cancer is one of the most prevalent cancer types among women. The use of magnetic fluids for specific delivery of drugs represents an attractive platform for chemotherapy. In our previous studies, it was demonstrated that maghemite nanoparticles coated with rhodium (II) citrate (Magh-Rh2Cit) induced in vitro cytotoxicity and in vivo antitumor activity, followed by intratumoral administration in breast carcinoma cells. In this study, our aim was to follow intravenous treatment to evaluate the systemic antitumor activity and toxicity induced by these formulations in Balb/c mice bearing orthotopic 4T1 breast carcinoma. Female Balb/c mice were evaluated with regard to toxicity of intravenous treatments through analyses of hemogram, serum levels of alanine aminotransferase, iron, and creatinine and liver, kidney, and lung histology. The antitumor activity of rhodium (II) citrate (Rh2Cit), Magh-Rh2Cit, and maghemite nanoparticles coated with citrate (Magh-Cit), used as control, was evaluated by tumor volume reduction, histology, and morphometric analysis. Magh-Rh2Cit and Magh-Cit promoted a significant decrease in tumor area, and no experimental groups presented hematotoxic effects or increased levels of serum ALT and creatinine. This observation was corroborated by the histopathological examination of the liver and kidney of mice. Furthermore, the presence of nanoparticles was verified in lung tissue with no morphological changes, supporting the idea that our nanoformulations did not induce toxicity effects. No studies about the systemic action of rhodium (II) citrate-loaded maghemite nanoparticles have been carried out, making this report a suitable starting point for exploring the therapeutic potential of these compounds in treating breast cancer.

Background: The passion fruit (Passiflora edulis) is a tropical crop of economic importance both for juice production and consumption as fresh fruit. The juice is also used in concentrate blends that are consumed worldwide. However, very little is known about the genome of the species. Therefore, improving our understanding of passion fruit genomics is essential and to some degree a pre-requisite if its genetic resources are to be used more efficiently. In this study, we have constructed a large-insert BAC library and provided the first view on the structure and content of the passion fruit genome, using BAC-end sequence (BES) data as a major resource., Results: The library consisted of 82,944 clones and its levels of organellar DNA were very low. The library represents six haploid genome equivalents, and the average insert size was 108 kb. To check its utility for gene isolation, successful macroarray screening experiments were carried out with probes complementary to eight Passiflora gene sequences available in public databases. BACs harbouring those genes were used in fluorescent in situ hybridizations and unique signals were detected for four BACs in three chromosomes (n=9). Then, we explored 10,000 BES and we identified reads likely to contain repetitive mobile elements (19.6% of all BES), simple sequence repeats and putative proteins, and to estimate the GC content (~42%) of the reads. Around 9.6% of all BES were found to have high levels of similarity to plant genes and ontological terms were assigned to more than half of the sequences analysed (940). The vast majority of the top-hits made by our sequences were to Populus trichocarpa (24.8% of the total occurrences), Theobroma cacao (21.6%), Ricinus communis (14.3%), Vitis vinifera (6.5%) and Prunus persica (3.8%)., Conclusions: We generated the first large-insert library for a member of Passifloraceae. This BAC library provides a new resource for genetic and genomic studies, as well as it represents a valuable tool for future whole genome study. Remarkably, a number of BAC-end pair sequences could be mapped to intervals of the sequenced Arabidopsis thaliana, V. vinifera and P. trichocarpa chromosomes, and putative collinear microsyntenic regions were identified.

The exploitation of the Brazil nut is one of the most important activities of the extractive communities of the Amazon rainforest. However, its commercialization can be affected by the presence of aflatoxins produced by fungi, namely Aspergillus section Flavi. In the present study, we investigated a collection of Aspergillus nomius strains isolated from Brazil nuts using different approaches, including morphological characters, RAPD and AFLP profiles, partial β-tubulin and calmodulin nucleotide sequences, aflatoxin patterns, as well as tolerance to low water activity in cultured media. Results showed that most of the isolates do belong to A. nomius species, but a few were re-identified as Aspergillus pseudonomius, a very recently described species. The results of the analyses of molecular variance, as well as the high pairwise FST values between A. nomius and A. pseudonomius suggested the isolation between these two species and the inexistence of gene flow. Fixed interspecific nucleotide polymorphisms at β-tubulin and calmodulin loci are presented. All A. pseudonomius strains analyzed produced aflatoxins AFB1, AFB2, AFG1 and AFG2. This study contains the first-ever report on the occurrence in Brazil nuts of A. pseudonomius. The G-type aflatoxins and the mycotoxin tenuazonic acid are reported here for the first time in A. pseudonomius., (Copyright © 2014 Elsevier B.V. All rights reserved.)

Natural disasters are still insufficiently studied and understood within the scope of public health in this country, with impacts in the short and long term. The scope of this article is to analyze the relationship between disasters and their impact on health based on disaster data recorded in the country. The methodology involved the systematization of data and information contained in the Brazilian Atlas of Natural Disasters 1991-2010 and directly from the National Department of Civil Defense (NSCD). Disasters were organized into four categories of events (meteorological; hydrological; climatological; geophysical/geological) and for each of the latter, the data for morbidity, mortality and exposure of those affected were examined, revealing different types of impacts. Three categories of disasters stood out: the hydrological events showed higher percentages of mortality, morbidity and exposure; climatological events had higher percentages of incidents and people affected; the geophysical/geological events had a higher average of exposure and deaths per event. Lastly, a more active participation of the health sector in the post-2015 global political agenda is proposed, particularly events related to sustainable development, climate change and disaster risk reduction.

Discriminating genotypes within plant collections is imperative, and DNA sequence approaches for detecting single nucleotide polymorphisms (SNPs) have proved essential in any modern analysis of germplasm. By sequencing the α-Phs and PvFRO1 genes that, respectively, encode phaseolin and an iron reductase, we prospected for SNPs in exonic and intronic regions of both genes in a sample of 31 accessions of Phaseolus vulgaris from Mesoamerican and Andean gene pools, and one accession of Phaseolus lunatus, chosen as an outgroup. Sequence alignment showed 95 SNPs in α-Phs and 83 in PvFRO1, but diversity along the nucleotide sequences was not evenly distributed in both genes. Accessions from the same gene pool showed greater similarity than those from different gene pools, and the cluster patterns obtained in this study were consistent with the hierarchical organization into two P. vulgaris gene pools. The polymorphisms detected in the α-Phs gene allowed better discrimination among the accessions within each cluster than the PvFRO1 polymorphisms. Furthermore, some variations within exons changes amino acids in both predicted protein sequences. In an unprecedented result, the phaseolin-predicted amino acid variation allowed most of the accessions to be typified.

Background: Magnetic fluids containing superparamagnetic iron oxide nanoparticles represent an attractive platform as nanocarriers in chemotherapy. Recently, we developed a formulation of maghemite nanoparticles coated with rhodium (II) citrate, which resulted in in vitro cytotoxicity enhanced up to 4.6 times when compared to free rhodium (II) citrate formulation on breast carcinoma cells. In this work, we evaluate the antitumor activity and toxicity induced by these formulations in Balb/c mice bearing orthotopic 4T1 breast carcinoma., Methods: Mice were evaluated with regard to the treatments' toxicity through analyses of hemogram, serum levels of alanine aminotransferase, iron, and creatinine; DNA fragmentation and cell cycle of bone marrow cells; and liver, kidney and lung histology. In addition, the antitumor activity of rhodium (II) citrate and maghemite nanoparticles coated with rhodium (II) citrate was verified by tumor volume reduction, histology and immunohistochemistry., Results: Regarding the treatments' toxicity, no experimental groups had alterations in levels of serum ALT or creatinine, and this suggestion was corroborated by the histopathologic examination of liver and kidney of mice. Moreover, DNA fragmentation frequency of bone marrow cells was lower than 15% in all experimental groups. On the other hand, the complexes rhodium (II) citrate-functionalized maghemite and free rhodium (II) citrate led to a marked growth inhibition of tumor and decrease in CD31 and Ki-67 staining., Conclusions: In summary, we demonstrated that both rhodium (II) citrate and maghemite nanoparticles coated with rhodium (II) citrate formulations exhibited antitumor effects against 4T1 metastatic breast cancer cell line following intratumoral administration. This antitumor effect was followed by inhibition of both cell proliferation and microvascularization and by tumor tissue injury characterized as necrosis and fibrosis. Remarkably, this is the first published report demonstrating the therapeutic efficacy of maghemite nanoparticles coated with rhodium (II) citrate. This treatment prolonged the survival period of treated mice without inducing apparent systemic toxicity, which strengthens its use for future breast cancer therapeutic applications.

Background: The development of sugarcane as a sustainable crop has unlimited applications. The crop is one of the most economically viable for renewable energy production, and CO2 balance. Linkage maps are valuable tools for understanding genetic and genomic organization, particularly in sugarcane due to its complex polyploid genome of multispecific origins. The overall objective of our study was to construct a novel sugarcane linkage map, compiling AFLP and EST-SSR markers, and to generate data on the distribution of markers anchored to sequences of scIvana_1, a complete sugarcane transposable element, and member of the Copia superfamily., Results: The mapping population parents ('IAC66-6' and 'TUC71-7') contributed equally to polymorphisms, independent of marker type, and generated markers that were distributed into nearly the same number of co-segregation groups (or CGs). Bi-parentally inherited alleles provided the integration of 19 CGs. The marker number per CG ranged from two to 39. The total map length was 4,843.19 cM, with a marker density of 8.87 cM. Markers were assembled into 92 CGs that ranged in length from 1.14 to 404.72 cM, with an estimated average length of 52.64 cM. The greatest distance between two adjacent markers was 48.25 cM. The scIvana_1-based markers (56) were positioned on 21 CGs, but were not regularly distributed. Interestingly, the distance between adjacent scIvana_1-based markers was less than 5 cM, and was observed on five CGs, suggesting a clustered organization., Conclusions: Results indicated the use of a NBS-profiling technique was efficient to develop retrotransposon-based markers in sugarcane. The simultaneous maximum-likelihood estimates of linkage and linkage phase based strategies confirmed the suitability of its approach to estimate linkage, and construct the linkage map. Interestingly, using our genetic data it was possible to calculate the number of retrotransposon scIvana_1 (~60) copies in the sugarcane genome, confirming previously reported molecular results. In addition, this research possibly will have indirect implications in crop economics e.g., productivity enhancement via QTL studies, as the mapping population parents differ in response to an important fungal disease.

In silico comparison of 34 putative pks genes in Aspergillus niger strain CBS 513.88 versus A. niger strain ATCC 1015 genome revealed significant nucleotide identity (>95% covering a minimum of 99% of the gene sequence) for 31 of these genes (approximately 91%). A. niger CBS 513.88 harbors three putative pks genes (An01g01130, An11g05940, and An15g07920), for which nucleotide identity was not found in A. niger ATCC 1015. To compare the results of the in silico analysis with the in vivo situation, experimental data were obtained for a large number of A. niger strains obtained from different substrates and geographical regions. Three putative pks genes that were found to be variable between the two A. niger strains using bioinformatics tools were in fact strain-specific genes based on experimental data. The PCR amplification signals for the An01g01130, An11g05940, and An15g07920 pks genes were detected in only 97%, 71%, and 26% of the strains, respectively. Southern blot analyses confirmed the PCR data. Because one of the strain-specific pks genes (An15g07920) is located in a putative ochratoxin cluster, we focused our investigation on that region. We assessed the ochratoxin production capability of the 119 A. niger strains and found a positive association between the presence of this pks gene and the capability of the respective strain to produce ochratoxin., (Copyright © 2012 Elsevier B.V. All rights reserved.)

Background: Rhodium (II) citrate (Rh(2)(H(2)cit)(4)) has significant antitumor, cytotoxic, and cytostatic activity on Ehrlich ascite tumor. Although toxic to normal cells, its lower toxicity when compared to carboxylate analogues of rhodium (II) indicates (Rh(2)(H(2)cit)(4)) as a promising agent for chemotherapy. Nevertheless, few studies have been performed to explore this potential. Superparamagnetic particles of iron oxide (SPIOs) represent an attractive platform as carriers in drug delivery systems (DDS) because they can present greater specificity to tumor cells than normal cells. Thus, the association between Rh(2)(H(2)cit)(4) and SPIOs can represent a strategy to enhance the former's therapeutic action. In this work, we report the cytotoxicity of free rhodium (II) citrate (Rh(2)(H(2)cit)(4)) and rhodium (II) citrate-loaded maghemite nanoparticles or magnetoliposomes, used as drug delivery systems, on both normal and carcinoma breast cell cultures., Results: Treatment with free Rh(2)(H(2)cit)(4) induced cytotoxicity that was dependent on dose, time, and cell line. The IC(50) values showed that this effect was more intense on breast normal cells (MCF-10A) than on breast carcinoma cells (MCF-7 and 4T1). However, the treatment with 50 μM Rh(2)(H(2)cit)(4)-loaded maghemite nanoparticles (Mag(h)-Rh(2)(H(2)cit)(4)) and Rh(2)(H(2)cit)(4)-loaded magnetoliposomes (Lip-Magh-Rh(2)(H(2)cit)(4)) induced a higher cytotoxicity on MCF-7 and 4T1 than on MCF-10A (p < 0.05). These treatments enhanced cytotoxicity up to 4.6 times. These cytotoxic effects, induced by free Rh(2)(H(2)cit)(4), were evidenced by morphological alterations such as nuclear fragmentation, membrane blebbing and phosphatidylserine exposure, reduction of actin filaments, mitochondrial condensation and an increase in number of vacuoles, suggesting that Rh(2)(H(2)cit)(4) induces cell death by apoptosis., Conclusions: The treatment with rhodium (II) citrate-loaded maghemite nanoparticles and magnetoliposomes induced more specific cytotoxicity on breast carcinoma cells than on breast normal cells, which is the opposite of the results observed with free Rh(2)(H(2)cit)(4) treatment. Thus, magnetic nanoparticles represent an attractive platform as carriers in Rh(2)(H(2)cit)(4) delivery systems, since they can act preferentially in tumor cells. Therefore, these nanopaticulate systems may be explored as a potential tool for chemotherapy drug development.

Microsatellites and gene-derived markers are still underrepresented in the core molecular linkage map of common bean compared to other types of markers. In order to increase the density of the core map, a set of new markers were developed and mapped onto the RIL population derived from the 'BAT93' x 'Jalo EEP558' cross. The EST-SSR markers were first characterized using a set of 24 bean inbred lines. On average, the polymorphism information content was 0.40 and the mean number of alleles per locus was 2.7. In addition, AFLP and RGA markers based on the NBS-profiling method were developed and a subset of the mapped RGA was sequenced. With the integration of 282 new markers into the common bean core map, we were able to place markers with putative known function in some existing gaps including regions with QTL for resistance to anthracnose and rust. The distribution of the markers over 11 linkage groups is discussed and a newer version of the common bean core linkage map is proposed.

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.

Atheroembolic disease is a rarely recognized clinical entity. The growing use of antiplatelet and thrombolytic therapy and of invasive cardiovascular procedures in acute coronary syndromes has nevertheless transformed this feared iatrogenic complication into an increasingly frequent diagnosis. The authors review this entity through the case of a 71-year-old man who, fifteen days after undergoing thrombolysis for acute myocardial infarction with ST-segment elevation, followed by elective percutaneous coronary revascularization under triple antiplatelet therapy, came to the emergency department with a clinical setting of mental confusion, gastrointestinal bleeding, oliguria and cutaneous eruptions on the lower limbs; laboratory tests revealed severe azotemia and hyperkalemia. With a diagnostic hypothesis of systemic atheroembolization, a cutaneous lesion biopsy was performed, which confirmed the diagnosis. Supportive treatment led to neurological and cutaneous recovery, but the patient developed chronic renal failure. The pathophysiology, forms of presentation, treatment and prognosis of atheroembolic disease are discussed, highlighting the importance of a high degree of clinical suspicion for diagnosis.

Microsatellites or SSRs (single sequence repeats) have been used to construct and integrate genetic maps in crop species, including Phaseolus vulgaris. In the present study, 3 cDNA libraries generated by the Bean EST project (http://lgm.esalq.usp.br/BEST/), comprising a unigene collection of 3126 sequences and a genomic microsatellite-enriched library, were analyzed for the presence of SSRs. A total of 219 expressed sequence tags (ESTs) were found to carry 240 SSRs (named EST-SSR), whereas 714 genomic sequences contained 471 SSRs (named genomic-SSR). A subset of 80 SSRs, 40 EST-SSRs, and 40 genomic-SSRs were evaluated for molecular polymorphism in 23 genotypes of cultivated beans from the Mesoamerican and Andean genetic pools, including Brazilian cultivars and 2 related species. Of the common bean genotypes, 31 EST-SSR loci were polymorphic, yielding 2-12 alleles as compared with 26 polymorphic genomic-SSRs, accounting for 2-7 alleles. Cluster analysis from data using both genic and genomic-SSR revealed a clear separation between Andean and Mesoamerican beans. The usefulness of these loci for distinguishing bean genotypes and genetic mapping is discussed.

The cultivated passion fruit (Passiflora edulis f. flavicarpa) is a cross-pollinated species native to South America. In the current study, a segregating F1 population derived from a single cross between the clones IAPAR-06 and IAPAR-123 was used to construct AFLP-based linkage maps and to map resistance genes to bacterial spot caused by Xanthomonas axonopodis pv. passiflorae. Linkage analysis was performed by the 2-way pseudo-testcross mapping method using markers that segregated in a 1:1 ratio. The IAPAR-06 linkage map was constructed using 115 markers, 112 of which were allocated to 9 linkage groups (LG) covering 790.2 cM. The map of IAPAR-123 was constructed using 140 markers, 138 of which were allocated to 9 LG covering 488.9 cM. In both maps, clusters of markers were detected, indicating that the AFLP markers were not distributed at random. Bacterial resistance was assessed by measuring the diseased leaf area after wound-inoculating the leaves of F1 plants. Quantitative resistance loci (QRLs) mapping was carried out by composite interval mapping and 1 QRL was detected, which explained 15.8% of the total phenotypic variation. The possibility of considering these data for marker-assisted selection in passion fruit breeding programs is discussed.

Ochratoxin A (OA) is a mycotoxin that has been found in coffee beans and coffee beverages. Its toxicological profile includes carcinogenicity, nephrotoxicity, and immunotoxicity. Aspergillus ochraceus is the major species responsible for OA production in Brazilian coffee beans. The genetic relationships among 25 A. ochraceus strains collected from Brazilian coffee-bean samples were determined based on RAPD and internal transcribed spacer (ITS) sequence data. The isolates were resolved into 2 distinct groups, one with 4 strains (group A) and the other with 21 strains (group B). Specific nucleotide variations characterizing group A and B were found for both ITS1 and ITS2 regions. Group B is a new group proposed here to accommodate the majority of the Brazilian isolates. Each group was found to contain both toxigenic and nontoxigenic strains, indicating that there is no association between molecular genotypes and the ability to produce OA.

A single cross between two clones of passion fruit (Passiflora edulis Sims. f. flavicarpa Deg., 2n = 18) was selected for genetic mapping. The mapping population was composed of 90 F1 plants derived from a cross between 'IAPAR 123' (female parent) and 'IAPAR 06' (male parent). A total of 380 RAPD primers were analyzed according to two-way pseudo-testcross mapping design. The linkage analysis was performed using Mapmaker version 3.0 with LOD 4.0 and a maximum recombination fraction (theta) of 0.30. Map distances were estimated using the Kosambi mapping function. Linkage maps were constructed with 269 loci (2.38 markers/primer), of which 255 segregated 1:1, corresponding to a heterozygous state in one parent and null in the other. The linkage map for 'IAPAR123' consisted of 135 markers. A total of nine linkage groups were assembled covering 727.7 cM, with an average distance of 11.20 cM between framework loci. The sizes of the linkage groups ranged from 56 to 144.6 cM. The linkage map for 'IAPAR 06' consisted of 96 markers, covering 783.5 cM. The average distance between framework loci was 12.2 cM. The length of the nine linkage groups ranged from 20.6 to 144.2 cM. On average, both maps provided 61% genome coverage. Twenty-four loci (8.9%) remained unlinked. Among their many applications, these maps are a starting point for the identification of quantitative trait loci for resistance to the main bacterial disease affecting passion fruit orchards in Brazil, caused by Xanthomonas campestris pv. passiflorae, because parental genotypes exhibit diverse responses to bacterial inoculation.

The present article reports the trajectory of a regional branch of the Brazilian Association of Nursing (ABEn) in Itajubá. It shows the development of this association since its inception until the present days. The study also depicts how the efforts invested and the success obtained helped on the development and strengthening of the nursing work in the south region of Minas Gerais.

This study compare the profile of nursing students from public and private schools located in the State of Minas Gerais, Brazil. It shows the similarities and differences between the two groups. The results show that the most significant differences are related to school life, requisites for learning and the economic situation of the students. The private schools student is in disadvantage, he enters at university later, disposes less time to study, the majority works, his parents have less regular instruction. This results can be used by other professionals to continue this kind of research with a broader scope.