Search

Background There is a need to identify patients with haemophilia who have a very low or high risk of developing inhibitors. These patients could be candidates for personalized treatment strategies. Aims The aim of this study was to externally validate a previously published prediction model for inhibitor development and to develop a new prediction model that incorporates novel predictors. Methods The population consisted of 251 previously untreated or minimally treated patients with severe haemophilia A enrolled in the SIPPET study. The outcome was inhibitor formation. Model discrimination was measured using the C-statistic, and model calibration was assessed with a calibration plot. The new model was internally validated using bootstrap resampling. Results Firstly, the previously published prediction model was validated. It consisted of three variables: family history of inhibitor development, F8 gene mutation and intensity of first treatment with factor VIII (FVIII). The C-statistic was 0.53 (95% CI: 0.46-0.60), and calibration was limited. Furthermore, a new prediction model was developed that consisted of four predictors: F8 gene mutation, intensity of first treatment with FVIII, the presence of factor VIII non-neutralizing antibodies before treatment initiation and lastly FVIII product type (recombinant vs. plasma-derived). The C-statistic was 0.66 (95 CI: 0.57-0.75), and calibration was moderate. Using a model cut-off point of 10%, positive- and negative predictive values were 0.22 and 0.95, respectively. Conclusion Performance of all prediction models was limited. However, the new model with all predictors may be useful for identifying a small number of patients with a low risk of inhibitor formation.

Thrombotic thrombocytopenic purpura (TTP) is a rare thrombotic microangiopathy (TMA) characterized by the severe deficiency of a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 (ADAMTS13) activity (< 10%). Rapid ADAMTS13 testing is crucial for an early diagnosis and optimal management of acute TTP. We evaluated the performance of the HemosIL AcuStar ADAMTS13 activity assay (Instrumentation Laboratory, Bedford, Massachusetts, United States), a fully automated chemiluminescent immunoassay with an analytical time of 33 minutes. A method comparison study was performed on 176 samples from 49 healthy donors and 127 TMA patients (109 TTP, 7 atypical hemolytic uremic syndrome, 11 other TMAs), comparing this new assay with an in-house FRETS-VWF73 assay and a commercial enzyme-linked immunosorbent assay (ELISA) (TECHNOZYM ADAMTS-13 Activity, Technoclone GmbH, Vienna, Austria). Agreement between methods was assessed with focus on ADAMTS13 activity less than 10%, the medical decision level relevant for TTP diagnosis. The HemosIL AcuStar ADAMTS13 Activity showed good correlation with both the FRETS-VWF73 (r = 0.96) and ELISA (r = 0.96) methods. Slope of the Passing–Bablok regression was 1.05 for FRETS-VWF73 and 1.02 for ELISA, and absolute bias at the medical decision level was +0.1 and +0.3%, respectively. The study also revealed high agreement with FRETS-VWF73 (kappa 0.97) and ELISA (kappa 0.98) methods in classifying TTP patients with a severe deficiency of ADAMTS13 activity. Because of its short turnaround time and full automation, the HemosIL AcuStar ADAMTS13 activity assay might become the assay of choice to rapidly test ADAMTS13 activity in plasma and thus establish the diagnosis of acute TTP in emergency settings.

Background Recombinant (rec-) coagulation factor VIII concentrates available for hemophilia A (HA) treatment differ in cell line production and structure, which could affect their pharmacodynamics and immunogenicity. Clinical trials showed that previously untreated patients with severe HA present higher rates of inhibitor development if treated with rec-FVIII products and that differences do exist as to inhibitor's formation among different rec-FVIII products. This finding could arise from several causes, such as absence of von Willebrand factor, different glycosylation profiles, or processes of molecular aggregation of the recombinant FVIII molecules. Objectives/Methods In this study, using size exclusion high-performance liquid chromatography (SE-HPLC), dynamic light scattering (DLS) spectroscopy, and functional biochemical assays, we investigated the purity grade, FX activating ability, and aggregation status of three recombinant marketed products (Advate [Baxalta], Refacto AF [Pfizer], and Kogenate [Bayer]). Results The overall analysis of the results obtained with SE-HPLC and DLS spectroscopy showed that the three recombinant FVIII concentrates contain low but significant amounts of molecular aggregates. This phenomenon was less evident for the Advate product. Molecular aggregation negatively affects the in vitro pharmacodynamics of the concentrates with higher aggregates' content. Conclusions This study shows that the three pharmaceutical formulations of recombinant FVIII contain variable amounts of molecular aggregates after their reconstitution at therapeutic concentrations. This phenomenon negatively affects the in vitro potency of the products with higher aggregates' content and might be invoked as a contributing cause of their increased risk to induce the formation of FVIII inhibitors.

We investigated longitudinally the behaviour of anti-factor VIII (anti-FVIII) IgG subclasses for 6 months from inhibitor development in 43 patients from the Survey of Inhibitors in Plasma-Products Exposed Toddlers (SIPPET) trial who developed persistent or transient inhibitors. We first analysed 43 patients within 60 days post inhibitor detection. Then, 14 of these 43 patients were studied at five time points over 6 months. Our study showed that during the first 60 days, the risk of inhibitor persistence increased with the concomitant presence of an increasing number of IgG subclasses. Over the 6-month period post inhibitor detection, only the IgG2 subclass could be considered a hallmark of inhibitor persistence.

BACKGROUND The genetically engineered, humanized, bispecific monoclonal antibody emicizumab (Hemlibra) that mimics the cofactor activity of activated factor VIII (FVIII) has been approved for treatment of hemophilia A patients with and without inhibitor. In the pivotal premarketing clinical trials, emicizumab prophylaxis significantly reduced bleeding rates compared with previous treatments and was well tolerated. However, a consequence of this novel therapy may be the host immune response to a foreign protein. OBJECTIVE Characterization of the neutralizing anti-emicizumab antibody associated with the loss of treatment efficacy. PATIENT A pediatric hemophilia A patient with inhibitor enrolled in the HAVEN2 (Study of Emicizumab Administered Subcutaneously (SC) in Pediatric Participants With Hemophilia A and Factor VIII (FVIII) Inhibitors) clinical trial. METHODS The anti-emicizumab antibody has been characterized with Western blot and enzyme-linked immunosorbent assay (ELISA). The antibody was affinity purified and sequenced. Binding affinity to full-length and papain-digested emicizumab was analyzed using surface plasmon resonance and byo-layer interferometry. RESULTS The neutralizing anti-emicizumab antibody was highly polyclonal with high-affinity binding mainly to the Fab portion of emicizumab with a small amount of binding to the Fc portion. Molecular interaction experiments between emicizumab and the purified antibody indicated the presence of at least two components with similar affinities. CONCLUSIONS Although the incidence of neutralizing anti-emicizumab antibody is rare, this study highlights the importance of a close monitoring and the need of a simple laboratory assay to promptly detect these antibodies in patients with a history of poor drug efficacy.

Background Inflammatory bowel diseases (IBD) are characterized by an increased thrombosis risk of uncertain etiology. Coagulation derangement arising from inflammation may be a triggering factor. We hypothesized that strong inflammation inhibitors (eg, anti-tumor necrosis factor-α drugs) may affect coagulation. Methods Forty patients with IBD were compared with 57 control patients for coagulation factors and endogenous thrombin potential (ETP), the latter being the most sensitive marker of in vivo pro- and anticoagulation balance. We measured ETP in the presence and absence of thrombomodulin (the physiologic protein C [PC] activator). Coagulation at different timepoints was also assessed for 28 of these patients during infliximab treatment. Results The median ETP (nM thrombin × minutes) and range (minimum-maximum) were each higher in patients at baseline than in control patients in both the absence (2120 [1611-3041] vs 1865 [1270-2337]) and the presence (1453 [464-2522] vs 831 [104-1741]) of thrombomodulin. The ETP ratio (with/without thrombomodulin) was high at baseline (0.73 [0.21-0.90] vs 0.45 [0.07-0.85]). The ETP and ETP ratio declined during treatment and were significantly lower at the end than at baseline. Factor (F) VIII and fibrinogen, which were high at baseline, decreased during treatment and at the end were significantly lower than at baseline. The FVIII/PC ratio, which was high in patients at baseline, declined during treatment and at the end was lower than at baseline. C-reactive protein recorded at the end of treatment was lower than at baseline. Conclusions Patients with IBD have a procoagulant imbalance as shown by increased ETP at baseline. The ETP decreases during treatment with infliximab, which is related to decreased FVIII and FVIII/PC ratio. This effect is also related to the improvement of inflammation as shown by decreased fibrinogen and C-reactive protein.

Background Patients with severe hemophilia A may develop inhibitors against factor VIII (FVIII) in around 30% of cases. Recently, the introduction of non-replacement therapies such as emicizumab, a FVIII-mimicking agent administered as a subcutaneous injection, has revolutionized the treatment of patients with inhibitors. However, although rarely, some patients may develop antibodies against this drug. If neutralizing, these antibodies interfere with the activity of the drug, making it ineffective. Mim8 (Novo Nordisk®) is a novel experimental FVIII-mimetic human bispecific antibody that has a similar function as emicizumab, by bridging activated FIX (FIXa) and FX to activate FX, although with a different molecular structure compared to emicizumab. It is currently in phase II clinical trial for subcutaneous treatment of patients with hemophilia A with or without FVIII inhibitors (1, 2). It is currently unknown whether the antibodies developed against emicizumab by patients with hemophilia A could cross-react with Mim8. Aim Our aim was to study the cross-reactivity of anti-emicizumab antibodies developed by patients with hemophilia A against Mim8 with an in-house detection method. Methods We studied the serum of three patients who developed anti-emicizumab antibodies. Plasma from one patient with persistent inhibiting antibodies was collected both during the treatment (thus also containing emicizumab at steady-state levels) and two years after treatment discontinuation due to inefficacy (neutralizing persistent antibodies). Plasma from two patients who developed transient antibodies against emicizumab were also tested in the course of treatment with emicizumab (non-neutralizing transient antibodies). The plate was coated both with emicizumab and with Mim8 provided by the pharmaceutical companies for research purposes. Plasma samples, diluted 1/20, were loaded into the coated wells and incubated 90 min at 37°C. The cross-reactivity to Mim8 was evaluated also by using the affinity purified anti-emicizumab IgG, which was loaded at 5 ug/mL. A properly adapted ELISA method already described (3) was used as reference assay. Then, biotinylated-emicizumab (1.5 ug/mL) or biotinylated-Mim8 (at 2 and 4 ug/mL) were added and the plate incubated 1 hour at 37°C. Moreover, a competition test was performed by using a mixture of biotinylated-emicizumab (1.5 ug/mL) and an excess of Mim8 (at 4, 8 and 40 ug/mL) in the detection phase. Results The Mim8 molecule - either alone, or matched with emicizumab - used both in the capture phase and in the detection phase did not bind to neither patient's plasma antibodies nor to anti-emicizumab purified IgG, which were instead revealed with the reference assay. The binding of the anti-emicizumab antibodies to biotinylated-emicizumab was not inhibited by the addition of Mim8, even at 40 ug/mL. Conclusions Our in-house method showed that anti-emicizumab antibodies do not react with Mim8 in vitro. Observational studies to test whether Mim8 can be used safely in patients with anti-emicizumab antibodies are needed to confirm our findings in vivo as well. References 1. Østergaard et al. A FVIIIa-mimetic bispecific antibody (Mim8) ameliorates bleeding upon severe vascular challenge in hemophilia A mice. Blood. 2021;blood.2020010331. doi:10.1182/blood.2020010331. 2. Valsecchi C et al. J Thromb Haemost. 2021;19(3):711-718. Disclosures Peyvandi: Roche: Consultancy, Honoraria; Sanofi: Consultancy, Honoraria; Sobi: Consultancy, Honoraria; Takeda: Consultancy, Honoraria.

INTRODUCTION: Emicizumab is a humanised bispecific monoclonal antibody, which replaces the function of factor VIII (FVIII) by bridging activated factor IX and factor X. Emicizumab is approved for prophylaxis of patients with Hemophilia A (HA), both with and without inhibitors. Real-world data on the efficacy and safety of emicizumab were recently reported from a few hemophilia treatment centers, but more data are needed to assess the efficacy and safety of emicizumab in comparison to standard prophylactic treatment. OBJECTIVE: To evaluate the safety and efficacy of emicizumab prophylaxis in a single cohort of patients with HA, with and without inhibitors. METHODS: We performed an observational prospective study including patients affected with HA, with and without inhibitors, switched to emicizumab prophylaxis in the post-marketing era. Data regarding inhibitor status, Annualized Bleeding Rate (ABR), cause of bleeding, type and location of bleeds, Emicizumab Plasmatic Concentration [Emi] and activated partial thromboplastin time (aPTT) were collected for each patient. Hemophilia Joint Health Scores (HJHS) and General Health Visual Analogue Scale (GH-VAS) were collected by trained physiotherapists before switching to emicizumab and 12 months after treatment start. RESULTS: A total of 22 patients, 21 with severe and 1 with moderate HA, were enrolled. Twenty patients were without inhibitor against FVIII and 2 adults with inhibitor were previously treated with bypassing agents. All patients started emicizumab prophylaxis with a loading dose of 3 mg/kg once weekly for 4 weeks, followed by a maintenance dosage of 1.5 mg/kg weekly. Within the children cohort, 3 were Previously Untreated Patients (PUPs) and 2 were previously treated with FVIII without developing inhibitor. The ABR showed a reduction of 74% in the entire cohort, as reported in Table 1. When stratifying for age groups, the ABR reduction was 70% for adults and 100% for children. Within the adults, the zero-bleeding patients increased from 2 to 11 patients (from 12 to 64%, respectively). In the adult cohort, 6 patients experienced 11 bleeding events over a mean follow-up of 300 days. Five out of 11 events were experienced in 6 months by a single patient who developed anti-drug antibodies (ADA) against emicizumab around the 5 th week ([Emi] 31.7 ug/ml). The prophylaxis with emicizumab was interrupted due to the treatment failure, which occurred despite spontaneous ADA clearance. Another patient developed ADA around the 9 th week ([Emi] 28.3 ug/ml), but without associated bleedings in up to 14 weeks of follow-up (minimum [Emi] 17 ug/ml). Of the remaining 5 adults who experienced bleedings during emicizumab prophylaxis, one patient developed spontaneous soft tissue bleeding, another one developed a spontaneous hemarthrosis in his target joint and the remaining 3 patients experienced post-traumatic joint bleedings, 2 out of 3 bleedings were in target joints. The analysis of the number of total joint bleedings before and after switching stratified for spontaneous and post-traumatic, revealed a reduction in target joint bleedings of 73% and a reduction of spontaneous and post-traumatic bleeding of 80% and 43%, respectively. All events were managed in outpatient clinic and required only a single infusion of FVIII concentrate. The plasmatic concentrations of emicizumab at steady state were within previous reported normal range for all patients, with exception of the two patients who developed ADA. Interestingly, steady state concentration was higher in children than in adults (median [Emi] 64.9 ug/ml and 49.85, respectively). The HJHS and GH-VAS scores at baseline and after 12 months of emicizumab prophylaxis available in 6 adults showed improvement in joint health and self-perceived global health, as shown in Figures 2 and 3. No thrombotic events were reported in the entire cohort. DISCUSSION: We report our Milan single center experience on the use of emicizumab prophylaxis in children and adults with HA, with and without inhibitors. Our experience shows a good efficacy of emicizumab both in children and adults, with few post-traumatic bleedings occurring mainly in target joints of adult patients. In addition, physician's and self-assessed scores revealed an improvement of patient's joint health after 12 months of emicizumab prophylaxis. Figure 1 Figure 1. Disclosures Peyvandi: Roche: Consultancy, Honoraria; Takeda: Consultancy, Honoraria; Sobi: Consultancy, Honoraria; Sanofi: Consultancy, Honoraria.

Introduction Emicizumab is a recombinant, humanized, bispecific antibody restoring the function of missing activated factor VIII (FVIII) by bridging activated FIX (FIXa) and zymogen factor X (FX), medicating the activation of FX. Emicizumab is approved in several countries, at the doses of 1.5 mg/kg once weekly, 3 mg/kg every 2 weeks or 6 mg/kg every 4 weeks, for the prophylaxis of bleeding episodes in patients with hemophilia A with and without inhibitors. The drug has shown a good efficacy either during registration studies as well as in real-world experiences and was well tolerated without significant side effects. The development of neutralizing anti-emicizumab antibodies has been reported in very few cases which frequently required the switch to other products due to inefficacy of the prophylaxis. Patients maintaining a plasma concentration range of the drug within 30-80 ug/ml did not show significant bleeds. However, real life experiences bring the need of personalization of the drug dose. A recent case series presented at ISTH 2021 from Malaysian authors evaluated the efficacy of a dose of emicizumab between 1.7 and 1.9 mg/kg every 4 weeks, showing that even at a lower dose than that approved could be effective for the prevention of bleeding events. Here we report the case of an adult patient with moderate hemophilia A with inhibitor who developed an anti-emicizumab antibody which reduced the concentration of the drug by 50%. Despite that the patient did not report bleeding events in a follow-up period of 18 weeks. Treatment with emicizumab requires further evaluation to understand the best dose for the prevention of bleeding. Case report A 74 years old patient with moderate hemophilia A (FVIII 1-3%) followed at our Center had history of high-titer inhibitor (maximum titer 20 BU). The patient was treated on-demand with plasma-derived FVIII concentrates, when, in Jul 2000, he developed a neutralizing anti-FVIII antibody requiring treatment with activated prothrombin complex concentrates (Feiba). In Nov 2020 the patient was hospitalized for traumatic brain hemorrhage treated with plasma-derived FVIII (inhibitor titer < 5 BU) and subsequently, for the recurrence of inhibitor, with activated prothrombin complex concentrates. In Feb 2021 the patient started prophylaxis with emicizumab at the initial dose of 3 mg/kg once weekly (loading dose), followed by a maintenance dose of 1.5 mg/kg. The patient underwent periodic blood withdrawal for monitoring drug plasma concentration. In Apr 2021 (week 10) drug concentration showed a slight decrease from initial levels, from 39.1 ug/ml (week 5) to 28.3 (week 10) and a weak positivity for an anti-emicizumab antibody was detected. At the following test (week 15) positivity for the anti-emicizumab antibody was confirmed, witnessed by the consistent reduction in drug plasma concentration up to 20.9 ug/ml. During the following weeks, until week 22, drug plasma concentrations were stable (range 17.0-19.4 ug/ml) and positivity for anti-emicizumab antibody remained, as shown in the table. The results of partial Thromboplastin Time (PTT) were consistent with the drug plasma concentrations during the observation period, in which the patient did not developed any bleeding event. Conclusion This case report may corroborate the hypothesis of the efficacy of a reduced dose of emicizumab in patients with hemophilia A. Close laboratory monitoring in patients in prophylaxis with emicizumab is warranted for the evaluation of drug plasma concentration and the prompt detection of anti-drug antibodies, particularly if patient show a reduced therapeutic efficacy. However, in the absence of bleeding events, positivity for anti-emicizumab antibodies should not bring to sudden drug discontinuation. Indeed, in the view of the above, a lower drug plasma concentration than standard might be effective in the prevention of bleeding. 1. Tang ASO et al. July 2021. Efficacy of Reduced-dose Emicizumab in Haemophilia A with Inhibitors: Real World Experience in East Malaysia. ISTH 2021. Figure 1 Figure 1. Disclosures Peyvandi: Takeda: Consultancy, Honoraria; Sobi: Consultancy, Honoraria; Sanofi: Consultancy, Honoraria; Roche: Consultancy, Honoraria.

Acquired thrombotic thrombocytopenic purpura (TTP) is a rare thrombotic microangiopathy caused by the immune-mediated severe deficiency of ADAMTS13. We hereby report the demographic and disease-related data of acquired TTP patients recorded in the Milan TTP Registry (www.ttpdatabase.org). We performed a cross-sectional study of 302 individuals enrolled in our registry for an acute episode of acquired TTP occurred between 2002 and 2015 (female 77%; median age at onset 40 years, interquartile range: 30–50). Twenty per cent of patients had concomitant autoimmune disorders. Among potential triggers of acute episodes, infections were the most prevalent (27%), followed by estroprogestinics use and pregnancy (5 and 4% of women, respectively). At presentation, systemic (72%), bleeding (68%) and neurological (43%) symptoms were the most frequent, whereas a lower prevalence of renal (18%) and cardiovascular (10%) signs and symptoms was observed. Almost all acute events were treated by plasma exchange and steroids, and 15% by rituximab. Exacerbation of acute TTP occurred in 15% of events. The TTP-related mortality was 5%. In survivors, the median number of plasma exchange procedures to remission was 9 (interquartile range: 6–14), longer for first events than relapses (median difference 3, 95% confidence interval: 2–4). Of 251 survivors of the first TTP episode with at least a 6-month follow-up, 55% had a relapse. In conclusion, acquired TTP is a severe disease with highly variable clinical presentation, usually requiring a long hospitalization. The Milan TTP Registry represents a powerful tool to improve our knowledge and management of acquired TTP.

The development of anti-factor VIII (FVIII) neutralizing antibodies (inhibitors) is the major complication in hemophilia A. Nonneutralizing antibodies (NNAs) have been detected in hemophilia patients and also in unaffected individuals. The aim of this study was to assess the prevalence of NNAs and to evaluate whether their presence is associated with the development of inhibitors in a cohort of previously untreated or minimally treated patients with hemophilia A; plasma samples of 237 patients with severe hemophilia A enrolled in the SIPPET trial were collected before any exposure to FVIII concentrates and analyzed for the presence of anti-FVIII NNAs. Patients were observed for the development of neutralizing antibodies. NNAs were found in 18 (7.6%) of 237 patients at screening, and there was a clear age gradient. Of those with NNAs, 7 patients subsequently developed an inhibitor for a cumulative incidence of 45.4% (95% confidence interval [CI], 19.5% to 71.3%); among the 219 patients without NNAs, 64 (29%) developed an inhibitor (cumulative incidence, 34.0%; 95% CI, 27.1%-40.9%). In Cox regression analyses, patients with NNAs at screening had an 83% higher incidence of inhibitor development than patients without NNAs (hazard ratio [HR], 1.83; 95% CI, 0.84-3.99). For high-titer inhibitors, the incidence rate had an almost threefold increase (HR, 2.74; 95% CI, 1.23-6.12). These associations did not materially change after adjustment. The presence of anti-FVIII NNAs in patients with severe hemophilia A who were not previously exposed to FVIII concentrates is associated with an increased incidence of inhibitors.

Background Acquired thrombotic thrombocytopenic purpura (TTP) is a rare thrombotic microangiopathy due to the development of autoantibodies against the VWF-cleaving protease ADAMTS13. ADAMTS13-specific circulating immune complexes (CICs) have been described in patients with acquired TTP, but their clinical relevance remained to be established. The aim of this study was to assess the association between ADAMTS13-specific CICs and ADAMTS13-related measurements, clinical and laboratory markers of disease severity, and occurrence of TTP relapse, in autoimmune TTP patients. Material and methods We measured ADAMTS13-specific CICs in 51 patients with severe ADAMTS13 deficiency and anti-ADAMTS13 autoantibodies, at the first episode of acquired TTP. The associations between ADAMTS13-specific CICs and the variables of interest were assessed by linear, logistic and Cox proportional hazard regression models, where appropriate. Results The prevalence of ADAMTS13-specific CICs in patients experiencing the first TTP episode was 39% (95% confidence intervals [CI]: 26–52%). ADAMTS13-specific CICs were not associated neither with laboratory markers of disease severity, nor with patterns of clinical presentation. Conversely, among 45 survivors, a positive association was found between the presence of ADAMTS13-specific CICs and the risk of recurrence within 2 years after the first TTP episode (adjusted hazard ratio, 3.4 [95% CI: 0.9 to 13.5]). Conclusions ADAMTS13-specific CICs seem to be able to predict the recurrence of acute TTP episodes in the first 2 years after disease onset. Therefore, their measurement might be used as a tool to stratify the risk of disease relapse, with potential influence on surveillance and therapeutic choices during remission phase.

SummaryCollagen-binding activity (CBA) and FRETS-VWF73 assays are widely adopted methods for the measurement of the plasmatic activity of ADAMTS13, the von Willebrand factor (VWF) cleaving-protease. Accurately assessing the severe deficiency of ADAMTS13 is important in the management of thrombotic thrombocytopenic purpura (TTP). However, non-concordant results between the two assays have been reported in a small but relevant percentage of TTP cases. We investigated whether CBA or FRETS-VWF73 assay reflects ADAMTS13 proteolytic activity in acquired TTP patients with non-concordant measurements. Twenty plasma samples with non-concordant ADAMTS13 activity results

Thrombotic thrombocytopenic purpura (TTP) is a microangiopathy syndrome caused by a congenital or acquired deficiency of ADAMTS13, a plasma metalloprotease that cleaves von Willebrand factor (VWF) and thus prevents the formation of platelet-rich thrombi in the microcirculation. TTP can be fatal if not appropriately and timely treated with the infusion of fresh frozen plasma (FFP) or exchange plasmapheresis, that reverse the process of microangiopathy by removing anti-ADAMTS13 autoantibodies and replacing functional ADAMTS13. The treatment of TTP with FFP is not free from risks and must be administered in hospitals or clinics, owing to the substantial amount of plasma volume infused or exchanged and the frequent need of catheter application. Moreover, most FFPs are not subjected to treatments to remove or inactivate blood-borne infectious agents. A number of recent reports indicate that certain plasma-derived VWF-factor VIII (FVIII) concentrates are clinically effective in the treatment of congenital TTP. In this study, we measured ADAMTS13 levels in various plasma-derived VWF-FVIII concentrates, showing that Koate(®) -DVI (Grifols), contained relatively high amounts of ADAMTS13 and that Alphanate(®) (Grifols) was the closest other product in terms of protease content. Koate(®) -DVI contains, on average (five lots tested), 0.091 ± 0.007 Units of ADAMTS13 activity per IU of FVIII. On the basis of this analysis and other reports of VWF-FVIII concentrate utilization in congenital TTP, potential dosing, and future clinical developments are discussed.

To cite this article: Mancini I, Valsecchi C, Palla R, Lotta LA, Peyvandi F. Measurement of anti-ADAMTS13 neutralizing autoantibodies: a comparison between CBA and FRET assays. J Thromb Haemost 2012; 10: 1439–42.

Background: A major complication in severe hemophilia A is the formation of persistent neutralizing antibodies against factor(F) VIII, inhibitors, which render subsequent treatment ineffective. The presence of non-neutralizing anti-FVIII IgG antibodies (NNAs) before FVIII treatment initiation has been associated with subsequent development of inhibitors in previously untreated patients (PUPs) with severe hemophilia A in the frame of the SIPPET cohort (Cannavò A et al, Blood 2017). Up to 30% of PUPs develop neutralizing antibodies (inhibitors) within the first 20-30 exposure days (Eds) to FVIII concentrates, of which one third disappear spontaneously over a course of six months due to endogenous immune tolerance, and two thirds progress into persistent inhibitors that require immunotolerance therapy. The role of each anti-FVIII IgG subclasses (e.g., IgG1, IgG2, IgG3 and IgG4) and their possible prediction of persistent anti-FVIII inhibitors is not known yet. Aims: To investigate the predictive value of anti-FVIII IgG subclasses on persistence of the anti-FVIII inhibitor in PUPs with severe hemophilia A within 60 days from the first development of anti-FVIII inhibitor. Methods: From the 76 patients who developed inhibitors in the SIPPET cohort (Peyvandi et al., N Eng J Med 2016), anti-FVIII IgG subclasses were measured by an ELISA assay in 43 patients according to plasma availability (median age 18 months [IQR: 12-29]), median inhibitor titer: 16 Bethesda IU [IQR: 5-135]). For each IgG subclass, a cutoff of positivity was defined as the mean OD absorbance value + 5 SD, obtained by analyzing the plasma of 150 normal individuals. The association of number of anti-FVIII IgG subclasses and other possible risk factors (age at first treatment, type of FVIII product, number of EDs and type of F8 gene variation) with inhibitor persistence was first estimated by univariate analysis. Predictive associations were assessed by logistic regression, in which inhibitor persistence was the outcome, and number of anti-FVIII IgG subclasses (1= only one [always IgG1], 2 subclasses, 3 subclasses or all 4 subclasses) and age at first treatment with FVIII concentrates were the putative predictors that showed an association with inhibitor persistence. Other risk factors, such as type of FVIII product, number of EDs and type of F8 gene variation, were not associated with inhibitor persistence at univariate analysis. Relative risks (RR) and 95% confidence intervals (95% CI) were recalculated from odds ratios according to Zhang (JAMA, 1998). The predictive capacity was expressed as the area under the receiving operative characteristic (ROC) curve (AUC). Results: Of the 43 patients who developed an inhibitor (31 persistent, 12 transient), 3 had only one IgG subclass (IgG1), 15 two subclasses, 13 three subclasses and 12 were positive for all the four IgG subclasses. The presence of each subclass was associated with an increased risk of inhibitor persistence, both in univariate and multivariate analysis, with relative risks ranging from 1.3 to 1.8. The risk of inhibitor persistence progressively increased with the number of concomitant IgG subclasses. In the model containing also age at first treatment and taking the category with only IgG1 positivity as reference, the RR (95% CI) was 1.7 (0.2 to 2.9) for patients with two IgG subclasses, 2.6 (0.7 to 3.0) for those with three subclasses and 2.8 (1.2 to 3.0) for those with all the four subclasses. The odds of inhibitor persistence increased by 8% for every 1-month increase of age at first treatment (OR 1.08 [0.99 to 1.22]). The AUC of the predictive model was 0.82 (95% CI: 0.68 to 0.96) (Fig 1). Conclusions: The concomitant presence of more than one anti-FVIII IgG subclass within 60 days from the first development of anti-FVIII inhibitor in patients with severe hemophilia A was associated with an increased risk of persistence of the inhibitor. Age at first treatment also predicted inhibitor persistence. In conclusion, this predictive analysis showed a promising discriminative capability for clinicians to select patients with the highest risk of inhibitor persistence who could benefit from immunotolerance therapy. These results need to be confirmed in other cohorts of PUPs with severe hemophilia A. Figure 1. Figure 1. Disclosures Peyvandi: Novo Nordisk: Speakers Bureau; Octapharma US: Honoraria; Novo Nordisk: Speakers Bureau; Shire: Speakers Bureau; Ablynx: Other: Member of Advisory Board, Speakers Bureau; Roche: Speakers Bureau; Grifols: Speakers Bureau; Sobi: Speakers Bureau; Kedrion: Consultancy; Grifols: Speakers Bureau; Octapharma US: Honoraria; Sobi: Speakers Bureau; Grifols: Speakers Bureau; Grifols: Speakers Bureau; Kedrion: Consultancy; Octapharma US: Honoraria; Octapharma US: Honoraria; Kedrion: Consultancy; Ablynx: Other: Member of Advisory Board, Speakers Bureau; Ablynx: Other: Member of Advisory Board, Speakers Bureau; Novo Nordisk: Speakers Bureau; Sobi: Speakers Bureau; Roche: Speakers Bureau; Shire: Speakers Bureau; Sobi: Speakers Bureau; Kedrion: Consultancy; Ablynx: Other: Member of Advisory Board, Speakers Bureau; Shire: Speakers Bureau; Novo Nordisk: Speakers Bureau; Roche: Speakers Bureau; Shire: Speakers Bureau; Grifols: Speakers Bureau; Kedrion: Consultancy; Ablynx: Other: Member of Advisory Board, Speakers Bureau; Shire: Speakers Bureau; Octapharma US: Honoraria; Sobi: Speakers Bureau; Roche: Speakers Bureau; Roche: Speakers Bureau; Novo Nordisk: Speakers Bureau. Palla:Grifols: Other: travel support; Pfizer: Other: travel support. Santagostino:Grifols: Membership on an entity's Board of Directors or advisory committees; Roche: Membership on an entity's Board of Directors or advisory committees; CSL Behring: Membership on an entity's Board of Directors or advisory committees; Octapharma: Membership on an entity's Board of Directors or advisory committees; Novo Nordisk: Membership on an entity's Board of Directors or advisory committees; Bayer: Membership on an entity's Board of Directors or advisory committees; Shire: Membership on an entity's Board of Directors or advisory committees; Kedrion: Membership on an entity's Board of Directors or advisory committees; Bioverativ: Membership on an entity's Board of Directors or advisory committees; Sobi: Membership on an entity's Board of Directors or advisory committees; Pfizer: Membership on an entity's Board of Directors or advisory committees. Young:Novo Nordisk: Consultancy, Honoraria; Bioverativ: Consultancy, Honoraria; Bayer: Consultancy; CSL Behring: Consultancy, Honoraria; Kedrion: Consultancy; Genentech/Roche: Consultancy, Honoraria; Shire: Consultancy, Honoraria. Seth:Shire: Honoraria. Mancuso:Bayer: Consultancy, Membership on an entity's Board of Directors or advisory committees; Novo Nordisk: Consultancy, Membership on an entity's Board of Directors or advisory committees; Shire: Consultancy, Membership on an entity's Board of Directors or advisory committees; Roche: Consultancy, Membership on an entity's Board of Directors or advisory committees; CSL Behring: Consultancy, Membership on an entity's Board of Directors or advisory committees; Kedrion: Consultancy; Pfizer: Consultancy, Membership on an entity's Board of Directors or advisory committees; Biotest: Membership on an entity's Board of Directors or advisory committees; Octapharma: Membership on an entity's Board of Directors or advisory committees. Mahlangu:Sanofi: Research Funding, Speakers Bureau; Roche: Consultancy, Research Funding, Speakers Bureau; LFB: Consultancy; NovoNordisk: Consultancy, Research Funding, Speakers Bureau; CSL Behring: Consultancy, Research Funding, Speakers Bureau; Chugai: Consultancy; Catalyst Biosciences: Consultancy, Research Funding; Biomarin: Research Funding, Speakers Bureau; Biogen: Research Funding, Speakers Bureau; Bayer: Research Funding; Amgen: Consultancy; Alnylam: Consultancy, Research Funding, Speakers Bureau; Shire: Consultancy, Research Funding, Speakers Bureau; Sobi: Research Funding, Speakers Bureau; Spark: Consultancy, Research Funding. Ewing:Hema Biologics: Honoraria; Novo Nordisk: Honoraria; CSL Behring: Honoraria; Grifols: Honoraria; Bayer: Honoraria; Shire: Honoraria; Genentech: Honoraria; Biogen: Research Funding. Male:Bayer: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Octapharma: Speakers Bureau; Novo Nordisk: Speakers Bureau; Biotest: Speakers Bureau; Roche: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Shire: Speakers Bureau; SOBI: Speakers Bureau; CSL Behring: Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau. Majumdar:NIMHD: Research Funding. Manco-Johnson:CSL Behring: Honoraria; Biogentek: Honoraria; Novo Nordisk: Honoraria; Bayer AG: Honoraria, Research Funding; Baxalta, now part of Shire: Honoraria. Mazzucconi:Baxalta-Shire: Consultancy, Speakers Bureau; Bayer: Consultancy, Speakers Bureau; Novartis,: Consultancy, Speakers Bureau; Amgen: Consultancy, Speakers Bureau; Novo Nordisk: Consultancy, Speakers Bureau; CSL Behring: Consultancy, Speakers Bureau. Neme:Shire: Consultancy, Honoraria; Novonordisk: Consultancy, Honoraria; Pfizer: Consultancy, Honoraria; Grifols: Consultancy, Honoraria; CSL Behring: Consultancy, Honoraria. Prezotti:Bayer: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Bioverative: Membership on an entity's Board of Directors or advisory committees; Roche: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Pfizer: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Novo Nordisk: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Shire: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Mannucci:Kedrion: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Grifols: Speakers Bureau; Bayer: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Baxalta/Shire: Speakers Bureau; Alexion: Speakers Bureau; Novo Nordisk: Speakers Bureau.

Background In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. Design and Methods In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291\_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143\_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. Results In vitro -expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. Conclusions In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.

We investigated 42 plasmas prepared at different centrifugation speeds with three activated protein C (APC) resistance methods. The APC ratio for fresh platelet-poor plasma declined significantly after freezing and thawing. This effect was more evident with the original method (average reduction 11.3%) than with either the home-made (3.8%) or the modified method (3.2%). No significant decrease in the APC ratio was observed after freezing and thawing of platelet-free plasmas from the same patients. When frozen platelet-poor plasma was centrifuged at high speed after thawing and before testing, there was no significant decrease in the APC ratio, in comparison with fresh platelet-poor plasma using the home-made and modified methods.

We evaluated free plasma levels of protein S, a natural anticoagulant factor, the prevalence of anti-protein S antibodies, a possible cause of protein S deficiency, and their correlation with anti-phospholipid antibodies in 53 patients with inflammatory bowel disease (IBD) and 53 age- and sex-matched controls. Mean free plasma protein S levels (± sd) were significantly lower in IBD patients (0.98 ± 0.32 IU/ml) than in controls (1.06 ± 0.28 IU/ml) (P < 0.05); only one patient showed protein S deficiency. Specific antibodies to protein S were found in four IBD patients (7.5%) and in one control (1.9%) (P = NS). Five IBD patients (9.4%) and none of the controls showed anti-phospholipid antibodies (P < 0.06). No correlation was found between free protein S levels and anti-protein S antibodies or between anti-protein S and anti-phospholipid antibodies. In conclusion, free plasma protein S levels are slightly but significantly decreased in IBD patients. The prevalence of anti-protein S and anti-phospholipid antibodies is increased in IBD patients. Anti-protein S antibodies do not appear to determine low protein S levels or to overlap with or belong to anti-phospholipid antibodies.

Summary Background The formation of ADAMTS13-specific circulating immune complexes (CICs) may be a pathophysiologic mechanism in autoimmune thrombotic thrombocytopenic purpura (TTP), but has not been systematically investigated. Objectives (a) To develop an assay for ADAMTS13-specific CICs; (b) to evaluate their prevalence in autoimmune TTP; and (c) to assess their association with ADAMTS13-related measurements and clinical features in autoimmune TTP patients. Patients/Methods We developed and validated an ELISA method for ADAMTS13-specific CICs. ADAMTS13-specific CICs were searched for in 55 patients with autoimmune TTP from the Milan TTP Registry (URL:http://www.ttpdatabase.org/) and 28 controls. The associations between ADAMTS13-specific CIC levels and ADAMTS13 activity, antigen, anti-ADAMTS13 IgGs and acute TTP clinical features were assessed by multivariate linear regression. Results Intra- and inter-assay coefficients of variation of the new test were 5.3 and 9.6%. In 36 patients with severe ADAMTS13 deficiency and anti-ADAMTS13 autoantibodies, the prevalence of ADAMTS13-specific CICs was 47% (n = 17; 95% confidence interval [CI], 32–63%). ADAMTS13-specific CICs were detected also in seven of 19 (37%; 95% CI, 19–59%) patients with reduced ADAMTS13 activity, but apparently negative anti-ADAMTS13 autoantibodies. ADAMTS13-specific CICs were not associated with ADAMTS13 activity, antigen or anti-ADAMTS13 IgGs. In patients with acute TTP, increasing levels of ADAMTS13-specific CICs were associated with a higher number of plasma-exchange procedures required to attain remission (per 0.1 increase in normalized OD values, beta, 2.9; 95% CI, −0.7 to 6.5). Conclusions Approximately one to two-thirds of patients with autoimmune TTP display ADAMTS13-specific CICs. A thorough investigation of the prognostic relevance of ADAMTS13-specific CIC levels in autoimmune TTP is warranted.

Summary Background The considerable genetic predisposition to deep vein thrombosis (DVT) is only partially accounted for by known genetic risk variants. Rare single-nucleotide variants (SNVs) of the coding areas of hemostatic genes may explain part of this missing heritability. The ADAMTS13 and VWF genes encode two interconnected proteins with fundamental hemostatic functions, the disruption of which may result in thrombosis. Objectives To study the distribution and burden of rare coding SNVs of ADAMTS13 and VWF found by sequencing in cases and controls of DVT. Patients/Methods The protein-coding areas of 186 hemostatic/proinflammatory genes were sequenced by next-generation technology in 94 thrombophilia-negative patients with DVT and 98 controls. Gene-specific information on ADAMTS13 and VWF was used to study the association between DVT and rare coding SNVs of the two genes. Results More than 70 billion base pairs of raw sequence data were produced to sequence the 700-kb target area with a median redundancy of × 45 in 192 individuals. Most of the 4366 SNVs identified were rare and non-synonymous, indicating pathogenetic potential. Rare (frequency of

Background Deep vein thrombosis (DVT) genetic predisposition is partially known. Objectives This study aimed at assessing the functional impact of nine ADAMTS13 single nucleotide variants (SNVs) previously reported to be associated as a group with DVT in a burden test and the individual association of selected variants with DVT risk in two replication studies. Methods Wild-type and mutant recombinant ADAMTS13 were transiently expressed in HEK293 cells. Antigen and activity of recombinant ADAMTS13 were measured by ELISA and FRETS-VWF73 assays, respectively. The replication studies were performed in an Italian case-control study (Milan study; 298/298 patients/controls) using a next-generation sequencing approach and in a Dutch case-control study (MEGA study; 4306/4887 patients/controls) by TaqMan assays. Results In vitro results showed reduced ADAMTS13 activity for three SNVs (p.Val154Ile [15%; 95% confidence interval [CI] 14–16], p.Asp187His [19%; 95%[CI] 17–21], p.Arg421Cys [24%; 95%[CI] 22–26]) similar to reduced plasma ADAMTS13 levels of patients carriers for these SNVs. Therefore these three SNVs were interrogated for risk association. The first replication study identified 3 heterozygous carriers (2 cases, 1 control) of p.Arg421Cys (odds ratio [OR] 2, 95%[CI] 0.18–22.25). The second replication study identified 2 heterozygous carriers (1 case, 1 control) of p.Asp187His ([OR] 1.14, 95%[CI] 0.07–18.15) and 10 heterozygous carriers (4 cases, 6 controls) of p.Arg421Cys ([OR] 0.76, 95%[CI] 0.21–2.68). Conclusions Three SNVs (p.Val154Ile, p.Asp187His and p.Arg421Cys) showed reduced ex vivo and in vitro ADAMTS13 levels. However, the low frequency of these variants makes it difficult to confirm their association with DVT.

Summary. Background: Thrombotic thrombocytopenic purpura (TTP) is a rare life-threatening disease. Of surviving patients, 45% develops an exacerbation or a late recurrence. Severe ADAMTS-13 deficiency, both during the acute episode and remission, is a well-established predictor of recurrence. The predictive value of anti-ADAMTS-13 antibodies, their inhibitory activity and Ig class subtype for disease recurrence is still to be established. Objectives: To analyze ADAMTS-13-related biomarkers (ADAMTS-13 and anti-ADAMTS-13 immunoglobulins, classes and subclasses) and their potential relationship with prognosis. Patients/Methods: In 115 patients with TTP, we assessed the association between levels of these biomarkers and the severity of acute episodes; we analysed also the hazard ratio (HR) and 95% confidence interval (CI) of recurrence in association with biomarkers levels retrieved at the previous acute episode or during remission, using Cox regression models. Results: During the acute phase, higher IgA, IgG1 and IgG3 titers showed the strongest association with acute episode severity. In the survival analyzes, the only biomarker significantly associated with a high hazard of recurrence after an acute episode was the presence of IgG. Conversly, low ADAMTS-13 activity or antigen levels (

Evaluation of assay methods to measure plasma ADAMTS13 activity in thrombotic microangiopathies

SummaryTwenty-nine of 54 uremic patients had low levels of protein C measured as anticoagulant activity, contrasting with normal levels measured as amidolytic activity or antigenic concentration. We demonstrate that this discrepancy is due to the presence of a soluble plasma inhibitor that interferes specifically with the anticoagulant activity of activated protein C. The inhibitor does not interfere with other coagulation assays. It is resistent to diisopropylfluorophosphate, high temperatures and repeated freezing and thawing. It can be dissociated from protein C by anti-protein C antibodies or by dialysis in vitro and in vivo. It binds to positively charged resins and can be eluted with high salt concentrations without losing its inhibitory capacity. The inhibitory effect is correlated with plasma creatinine levels and fluctuates with time.

Background From 20 to 50% of patients who survive an acute episode of the acquired form of thrombotic thrombocytopenic purpura relapse but clinical and laboratory markers of recurrence are not well established.Design and Methods In 109 patients enrolled in an international registry we evaluated, in the frame of a retrospective cohort study, the predictive role of the metalloprotease ADAMTS13 as measured in plasma during remission. Anti-ADAMTS13 antibodies and von Willebrand factor were also evaluated in a smaller number of the same patients.Results Median values of ADAMTS13 activity and antigen were significantly lower in patients with recurrent thrombotic thrombocytopenic purpura than in those with no recurrence (activity: 12% vs. 41%; p=0.007; antigen: 36% vs. 58%; p=0.003). A severe deficiency of ADAMTS13 activity (10% or less) was associated with a higher likelihood of recurrence (odds ratio 2.9; 95% confidence interval 1.3 to 6.8; p=0.01). Anti-ADAMTS13 antibodies were also more prevalent in patients with recurrent thrombotic thrombocytopenic purpura (odds ratio 3.1; 95% confidence interval 1.4 to 7.3; p=0.006). The presence during remission of both severe ADAMTS13 deficiency and anti-ADAMTS13 antibodies increased the likelihood of recurrence 3.6 times (95% confidence interval 1.4 to 9.0; p=0.006). The presence of ultralarge von Willebrand factor multimers and of associated diseases or conditions did not increase recurrence.Conclusions Survivors of an acute episode of acquired thrombotic thrombocytopenic purpura with severely reduced levels of ADAMTS13 and/or with anti-ADAMTS13 antibodies during remission have an approximately three-fold greater likelihood of developing another episode of thrombotic thrombocytopenic purpura than patients with higher protease activity and no antibody.

The inherited deficiency of the von Willebrand factor-cleaving protease ADAMTS13 is associated with rare forms of thrombotic thrombocytopenic purpura (TTP). We investigated a woman with a family history of chronic recurrent TTP and undetectable plasma levels of ADAMTS13 activity. Genetic analysis revealed two missense mutations in the heterozygous state: p.Val88Met substitution in the metalloprotease domain and p.Gly1239Val substitution in the first CUB domain of ADAMTS13. To explore the mechanism of ADAMTS13 deficiency in this patient, the wild type (WT; ADAMT13WT) and each mutant construct (ADAMTS13Val88Met, ADAMTS13Gly1239Val) were transiently expressed in HEK 293 and COS-7 cells. To recapitulate the compound heterozygous state of the patient, both mutant ADAMTS13 proteins were also expressed together. The p.Val88Met mutation led to a defect of secretion of the protease associated with a reduction of enzymatic activity, the p.Gly1239Val mutation led to a secretion defect causing intracellular accumulation of the protease. The mechanistic effects of the mutations were further explored by means of differential immunofluorescence, that demonstrated an homogeneous distribution of ADAMTS13WT in the Cis-Golgi and endoplasmic reticulum (ER) compartments, a reduction of ADAMTS13Val88Met in both compartments, while ADAMTS13Gly1239Val failed to reach the Cis-Golgi compartment and remained in the ER. Hum Mutat 27(4), 330–336, 2006. © 2006 Wiley-Liss, Inc.

Introduction. Acquired thrombotic thrombocytopenic purpura (TTP) is a rare thrombotic microangiopathy due to the development of autoantibodies against the VWF-cleaving protease ADAMTS13. We recently developed and validated a new ELISA method for the detection of ADAMTS13-specific circulating immune complexes (CICs) in acquired TTP patients. This study aims at investigating the clinical relevance of ADAMTS13-specific CICs at disease presentation in a large cohort of acquired TTP patients. Methods. We measured ADAMTS13-specific CICs by ELISA in 51 patients from the Milan TTP Registry, at the first episode of acquired TTP. All patients presented anti-ADAMTS13 autoantibodies by western blotting and severe ADAMTS13 deficiency (i.e., Results. The prevalence of ADAMTS13-specific CICs in patients experiencing a first episode of acquired TTP was 39% (95% confidence intervals [CI]: 26-52%). ADAMTS13-specific CICs were only associated with ADAMTS13 antigen levels at regression analyses (beta per 10% increase in ADAMTS13 antigen, 95% CI: 0.05, 0.02-0.08). The presence of ADAMTS13-specific CICs was associated with more than a four-fold increase in the risk of recurrence at 2 years after the first TTP episode (hazard ratio, 95%CI: 4.2, 1.1-16.4). Conclusions. ADAMTS13-specific CICs are neither a biomarker of disease severity, nor a predictor of clinical outcome during acute phase. Conversely, ADAMTS13-specific CICs seem to have relevance in predicting the recurrence of acute TTP episodes. Disclosures Peyvandi: NovoNordisk: Research Funding; Kedrion : Research Funding; NovoNordisk: Speakers Bureau; CSL Behring : Speakers Bureau; Baxter: Speakers Bureau; Bayer: Speakers Bureau.

SummaryA recent study suggests that protein S deficiency is not a risk factor for venous thrombosis. Since this unexpected finding would have important clinical implications if confirmed, we performed a case-control study with the aim to determine the prevalence of protein S deficiency in patients with thrombosis and in healthy individuals taken from the general population and the relative risk of thrombosis in protein S-deficient patients. Free protein S concentration was measured in 327 consecutive patients with at least one venous thrombotic episode and in 317 age- and sex-matched control individuals. Different normal reference ranges were obtained and adopted for men and women. Protein S deficiency was found in 3.1% (95% Cl: 1.5-5.2) of patients and in 1.3% of controls (95% Cl: 0.3-2.8). Ten patients and 4 control subjects had protein S deficiency, which determined a relative risk of thrombosis (sex- and age-adjusted odds ratio) of 2.4 (95% Cl: 0.8-7.9). When men and women were analyzed separately, the risk was 5.0 (95% CI: 0.6-43.6) and 1.6 (95% Cl: 0.4-6.7) respectively. PS-deficient men had more thrombotic episodes than women and later in life. Multivariate analysis established that sex was an independent determinant of the number of episodes, as was age, while PS deficiency was not. However sex and PS deficiency status were both determinants of age at first thrombotic episode.

Abstract 3383 Introduction: Anecdotal and published reports on the use of specific plasma-derived Factor VIII (FVIII)-von Willebrand Factor (vWF) concentrates in the treatment of congenital thrombotic thrombocytopenic purpura (TTP) led to the determination of the functional and antigenic content of ADAMTS13 in a number such concentrates commercially available in the US and/or the EU. Deficiency or inhibition of ADAMTS13 is the putative cause of TTP. TTP is a rare disorder causing microvascular thrombosis resulting in low platelet counts. It affects 1 –5 patients per 1,000,000 population. The current treatment of this disorder consists of regular infusions of fresh frozen plasma (FFP) for inherited TTP and exchange plasmapheresis for the acquired version of the disorder. The possibility of utilizing FVIII-vWF concentrates that incorporate robust virucidal treatments in their manufacturing and the possible utilization of lower infusion volumes prompted the evaluation of these concentrates for ADAMTS13 content. Methods: For this analysis, we obtained 5 lots of Koate®-DVI, 2 lots of Human Bioplasma, and 1 lot of each of the following concentrates: Humate® P, Wilate®, Alphanate®, Emoclot® and Fractogel.® Following reconstitution of these concentrates in 10 mL of water for injection, we determined the concentration of ADAMTS13 antigen by an ELISA method previously described by Feys et al. (J Thromb Haemost. 2006; 4: 955–62) with minor modifications (Peyvandi et al. Haematologica 2008; 93: 232–239). The lower limit of detection was 1% while the lower value of the normal range was 45%. The ADAMTS13 activity was measured using collagen binding (CBA) and FRET assays with minor modifications (Peyvandi et al. Haematologica 2008; 93: 232–239); in both assays, serially diluted normal human plasma (NHP) and plasma samples were diluted 1:10 in assay buffer and incubated 1:1 with vWF substrate in a final volume of 100 μl. In addition to the determination of ADAMTS13, we evaluated the amount of vWF antigen (vWF:Ag) using a commercial kit (Instrumentation Laboratory, IL US, Bedford, Massachusetts, USA) in these concentrates and the multimeric composition of this protein. Utilizing densitometry, we determined the percentage of ultra-large vWF multimers in each of these concentrate. Results: The analysis showed that among the tested concentrates, Koate®-DVI had the highest ratio of ADAMTS13/FVIII. This concentrated presented ratios of 9.1 ± 0.7% (Mean ± SD) and 8.4 ± 1.1% (Mean ± SD) per IU FVIII for ADAMTS13 activity and antigen respectively. The remainder of the concentrates contained only nominal amounts of ADAMTS13; only Alphanate® reached a ratio of 0.23% ADAMTS13 activity/IU FVIII. These data are in agreement with previous reports (Qorraj et al. Blood 2001, 116: 3677). A summary analysis data are shown in Table 1. Koate®-DVI displayed a ratio of vWF:Ag/FVIII of approximately 2.81, very similar to the ratio of 2.77 included in the single lot of Humate®-P. The ratio of ultra-large multimers to total multimers in Humate® P was higher, at 0.66 vs. 0.39 for Koate-DVI. However, the lower content of ultra-large multimers in Koate®-DVI may be advantageous in its possible utilization in the treatment of TTP. Conclusion: On the basis of these results, Koate-DVI may have a role to play in the management of congenital and, possibly, idiopathic TTP, especially on the basis of observations that FVIII accelerates the breakdown of vWF (Cao et al. PNAS 2008, 105: 7416–7421). Additional characterization, testing in pertinent animal models and pilot studies in humans would be required to determine the extent to which this concentrate can assist in the treatment of TTP. Disclosures: Guazzini: Kedrion S.p.A: Consultancy. Retzios:Kedrion Biopharma, Inc.: Consultancy.

Abstract 2532 Background: Thrombotic thrombocytopenic purpura (TTP) is a rare, life-threatening disease characterized by acute episodes of thrombocytopenia and microangiopathic hemolytic anemia due to disseminated microvascular thrombosis. Up to 40% of patients with TTP who survive the first acute disease episode develop one or more recurrent episodes. The severe deficiency of the von Willebrand factor (VWF) cleaving protease ADAMTS13 in plasma and the presence of anti-ADAMTS13 autoantibodies during both acute presentation and disease remission are associated with increased risk for recurrence. However, additional markers are needed for an accurate prediction of the risk for recurrent disease. Anti-ADAMTS13 autoantibodies of different immunoglobulin (Ig) subclass, specificity and mechanisms of action have been described in patients with the autoimmune form of TTP. We sought to determine the relationships between anti-ADAMTS13 Ig subclasses and risk for recurrence in a large cohort of TTP patients. Patients and methods: TTP was defined using commonly accepted criteria (microangiopathic hemolytic anemia, thrombocytopenia and exclusion of alternative explanation for the disease symptoms). Anti-ADAMTS13 IgM, IgA, IgG and IgG1, IgG2, IgG3 and IgG4 subclasses were measured by ELISA in plasma samples obtained from a total of 115 patients with TTP referred to the Milan TTP registry. Plasma samples had been collected during acute disease presentation (n=60), disease remission (n=92) or both (n=37). ADAMTS13 activity and inhibitor were also measured. The levels of different Ig subclasses were compared between two groups of patients with or without recurrence during follow-up. Patients with a follow-up Results: TTP patients had a median follow-up of 64 months (range 0–399). A total of 11 patients (9.5% of all patients) were followed-up for less than 24 months and excluded from further analysis. Of patients with a follow-up >24 months, 53 (50%) developed recurrences, whereas 51 did not. Recurrences occurred at a median of 24 months (45 days to 11 years) after the first episode and were more common in the first three years (n=35, 67%). Comparison of anti-ADAMTS13 Ig subclasses measured during acute disease presentation in TTP patients with recurrence and in patients without recurrence revealed lower levels of IgA (0.017 vs 0.243, p=0.05), IgG1 (0.076 vs 0.234, p=0.01) and IgG3 (0.126 vs 0.385, p=0.002) in recurrent patients, whereas IgG4 were higher in recurrent TTP (0.712 vs 0.289, p Notably, levels of IgA (random effect, p=0.018), IgG1 (random effect, p=0.005) and IgG3 (random effect, p=0.006) were also associated with lower platelet counts at presentation of acute TTP and IgG3 levels were associated with the number of plasma exchange procedures performed until remission/death. In TTP patients during remission lower levels of ADAMTS13 antigen (49.3 vs 69.5 p The logistic analysis showed an odds of relapse of 4.2 (range 1.5–12 p=0.008) at remission in patients with reduced ADAMTS13 and of 4.4 (range 1.7–11.3; p=0.002) in patients with high levels of IgG, but not in the acute phase. Conclusions: Low values of ADAMTS13 and anti-ADAMTS13 autoantibodies showed and association with a fourfold increase of recurrency risk, while the same result is not confirmed for the acute phase. Anti-ADAMTS13 IgA, IgG1, 3 and 4 subclasses, measured at acute TTP presentation, showed association with recurrent disease in a retrospective cohort study of TTP patients. Ig subclass measurement might be useful to improve recurrence risk prediction in patients with TTP. Disclosures: No relevant conflicts of interest to declare.

Protein S activity was measured as the degree of prolongation of a prothrombin time-based clotting assay in which diluted test sample, protein S-depleted plasma previously incubated with Protac to fully activate protein C, bovine thromboplastin and calcium ions are mixed. Assay specificity was first demonstrated by observing that the prolongation of the clotting time was dependent on protein S and was subsequently confirmed by testing plasma samples from patients with conditions known to affect protein S activity. High sensitivity, reproducibility (interassay coefficient of variation lower than 5%) and easy handling of samples and reagents make this assay suitable for screening of congenital and acquired protein S deficiency.

The introduction of plasma exchange therapy in early 1970s significantly reduced the rate of mortality in patients affected by thrombotic thrombocytopenic purpura (TTP), a disease characterized by thrombocytopenia and microangiopathic hemolytic anemia. A similar improvement was never achieved in the prevention of the disease recurrence. Still, 20–50% of patients, who survived the fatal disease, experience a relapse one month or even years after the acute episode of TTP. There is no pathognomic marker or laboratory test that can be used for the surveillance of TTP during remission and predict which patients will relapse. We have retrospectively analyzed for the first time at remission the role of ADAMTS13, anti-ADAMTS13 autoantibodies and von Willebrand Factor (VWF) in 109 patients who survived the acute episode of TTP. ADAMTS13 activity and ADAMTS13 antigen levels were measured as described by Gerritsen et al (TH 1999) and Feys HB et al. (JTH 2006), respectively. The total anti-ADAMTS13 autoantibodies (with and without neutralizing activity) were measured by western blot analysis and the presence of neutralizing anti-ADAMTS13 autoantibodies was checked according to Gerritsen et al (TH 1999). VWF antigen was measured using an ELISA assay and VWF multimers analysis was carried out using low-resolution SDS-agarose gel electrophoresis and exposing gels to human anti-VWF antibodies labeled with I125 for autoradiography (Ruggeri & Zimmerman, Blood 1981). All variables have been statistically analyzed in 2 subgroups of patients with or without TTP recurrence, in order to understand the role of each variable as a potential predictor marker for recurrence. Univariate and multivariate analysis were carried out to evaluate adjusted and unadjusted odds ratios (Ors) with 95% confidence intervals (CI) as a measure of the relative risk of relapse associated with the risk factors under investigation. Our data showed that the median value of ADAMTS13 activity and antigen levels at remission were significantly lower in patients with recurrent TTP than in patients with no relapse (ADAMTS13 activity: 12% vs. 41%; p=0.007; ADAMTS13 antigen: 36% vs 58%; p=0.003). Furthermore, the prevalence of patients with severe ADAMTS13 deficiency (≤10%) was significantly higher in the group of patients who relapsed (OR=2.9 CI95% 1.3–6.8, p=0.01). The prevalence of anti-ADAMTS13 autoantibodies (with or without neutralizing activity) resulted to be significantly higher in patients with recurrent TTP (OR= 3.1 CI 95% 1.4–7.3, p=0.006). A higher VWF antigen levels or the presence of ultralarge VWF (ULVWF) multimers at remission did not increase the risk of recurrence (p=0.4 for VWF:Ag and p=0.7 for ULVWF multimers). In conclusion, our data showed that the association of severe ADAMTS13 deficiency and the presence of anti-ADAMTS13 autoantibodies is a negative prognostic marker at remission and increases the relative risk of TTP recurrence by 3.6 times (OR=3.6 CI95% 1.4–9). Therefore our results would suggest that our efforts should go in the direction of maintenance therapy which aims at reducing or abolishing the presence of antibodies during remission and increasing the level of ADAMTS13 in plasma in order to prevent the recurrence of TTP.

The inherited deficiency of the von Willebrand factor-cleaving protease, ADAMTS13, is usually associated with severe forms of thrombotic thrombocytopenic purpura (TTP). Among the reported 53 mutations on ADAMTS13 gene, none has been described on TSP1-6 repeat domain. We investigated an Iranian man with history of chronic recurrent TTP and very low plasma levels of ADAMTS13 activity (2.3%). He had his first TTP episode at the age of 21 years and 6 subsequent episodes occurred without precipitating events. Genetic analysis revealed a homozygous deletion of nucleotides 2930–2935 (GTGCCC), in exon 23 of ADAMTS13 gene, leading to the replacement of Cys977 residue by a Trp and the deletion of Ala978 and Arg979, in the TSP1-6 repeat domain. The patient’s brother, homozygous for the same mutation, has no clinical manifestation of TTP so far, despite the same degree of ADAMTS13 deficiency. The patient’s parents resulted to be heterozygous. To explore the mechanism of ADAMTS13 deficiency, wild type (ADAMT13WT) and mutant (ADAMTS13del6bp) expression vectors were transiently transfected in HEK293 and COS-7 cells. The enzymatic activity of the expressed rADAMTS13 proteins was evaluated by measuring the extent of VWF multimer degradation, using a quantitative immunoblotting assay. rADAMT13WT was able to degrade multimers completely (100% of activity), whereas rADAMTS13del6bp had enzymatic activity reduced to ~10% of WT. Both WT and mutant proteases present in conditioned media and cell lysates, were analyzed by Western blot analysis, using anti-V5 monoclonal antibody against the C-terminal tag of rADAMTS13. Blots showed a dense band of ~190 KDa in the medium, corresponding to the secreted rADAMT13WT protein. Cells transfected with ADAMTS13del6bp showed a fainter band roughly estimated to be 5% of the WT obtained by densiometric analysis. Therefore, pulse-chase labelling experiments were performed to evaluate the presence of a secretion pathway alteration. After 60 min pulse with [35S] methionine the maximum level of rADAMT13WT in conditioned media was found at 24 hours. rADAMTS13del6bp was minimally present after 3 hours only, no band being detected after 7 hours of chase. Differential immunofluorescence studies were performed using an anti-V5 monoclonal antibody against ADAMTS13 proteins and monoclonal antibodies recognizing markers of Cis-Golgi and ER. The merging studies in WT and mutant transfected cells showed that rADAMTS13WT was mostly localized in the perinuclear area, suggesting a primary localization in the Golgi apparatus, whereas rADAMTS13del6bp showed less intense staining diffusely throughout the cytoplasm, only a minimal amount of the mutant protein being localized in the Cis-Golgi and ER. The structural consequences of the deletion mutation in the TSP1-6 domain may cause a loss of the known antiparallel, three-stranded fold characterizing the architecture of the TSP-like domains. In these domains, each strand is capped by disulfide bonds on each end. This study suggests that the residue Cys977 could be involved in the formation of disulphide bonds responsible for a correct folding of one of the TSP1-like domains of ADAMTS13. Therefore the deletion could lead to uncorrected folding which reflects an intracellular degradation and secretion defect of the mutant protease without any intracellular accumulation. These results reflect the severe deficiency of ADAMTS13 in the patient’s plasma.

Thrombotic thrombocytopenic purpura (TTP) is associated with a severe deficiency of ADAMTS-13, a metalloprotease that processes physiologically the hyperactive ultralarge multimers of von Willebrand factor (VWF). We report the molecular characterization of a congenital case of TTP with < 6% ADAMTS-13 activity and no ADAMTS-13 inhibitor in plasma. Mutational analysis showed heterozygosity for 2 missense mutations: a G to A substitution at nucleotide 262 in exon 3 (Val88Met), in the metalloprotease domain of ADAMTS-13 and a substitution of G to T at nucleotide 3707 in exon 27 (Gly1239Val), in the first CUB domain. To explore the mechanism of the defect, the wild type protease (ADAMTS-13-WT) and each mutant (ADAMTS-13-Val88Met, ADAMTS-13-Gly1239Val) were transiently expressed in HEK 293 and COS-7 cells. WT and mutant recombinant proteins (rADAMTS-13) was analysed in conditioned medium and cell lysates by western blot analysis using anti-ADAMTS-13 monoclonal and polyclonal antibodies. The enzymatic activity of the expressed rADAMTS-13 forms was evaluated by measuring the extent of VWF multimer degradation with a quantitative immunoblot assay. Immunohistochemistry experiments were performed to study the transport of the recombinant protein between the ER and the Golgi complex. A secondary structure prediction (SSP) was also carried out to predict the effect of these mutations on the ADAMTS-13 structure. Western blots showed a dense band in the medium with a molecular weight of ~190 Kda, corresponding to the secreted rADAMTS-13-WT protein. The medium of the cells transfected with ADAMTS-13-Val88Met showed a fainter band roughly estimated to be 40–50% of the WT band. rADAMTS-13-Gly1239Val was not detectable in the medium. Both mutants were detected in cell lysates in amounts similar to ADAMTS-13-WT. rADAMTS-13 WT was able to degrade of HMW multimers, whereas rADAMTS-13 Val88Met as the well as media of cells cotrasfected by both mutant constructs lacked enzymatic activity, recapitulating the patient’s plasma pattern. By immunohistochemistry rADAMTS-13-WT was mainly localized in the perinuclear area, whereas rADAMTS-13-Gly1239Val was diffused throughout the cytoplasm with no perinuclear enhancement. rADAMTS-13-Val88Met showed increased staining in the cytoplasm but also a perinuclear enhancement. SSP analysis showed no change in the helical region including Gly1239 following replacement with Val. We hypothesize that Gly1239Val may directly alter molecular recognition, leading to a secretion pathway alteration and to retention of the mutant protein in the ER compartment. SSP analysis also showed that the Val88Met mutation, located in the metalloprotease domain, may enhance the conformational instability of the 80–87 region containing Glu83 involved in a Ca++ ion coordination. This effect may be responsible for both the observed partial secretion alteration and enzymatic activity defect of the mutant. These expression studies explain how these two gene mutations together lead to the absence of ADAMTS-13 enzymatic activity in patient’s plasma.

SummaryFour mouse hybridomas secreting monoclonal antibodies specific for human protein S (PS) have been generated. The antibodies, all of the IgG1 subclass, were designated S2, S3, S8, and S10. In a fluid phase radioimmunoassay, the binding of monoclonal antibodies to PS was about 30% greater in the presence of EDTA and totally inhibited in presence of Ca2+. Using the same technique, we performed displacement curves of 125I-labeled PS by purified PS, thrombin-cleaved PS, normal plasma, plasma from a patient on warfarin therapy, and plasma from a patient with no free PS and only PS bound to C4b-binding protein. The slopes of the curves show that the monoclonal antibodies reacted equally with all the tested forms of PS indicating that the antigenic site(s) to which the monoclonal antibodies are directed are present and exposed in free and bound PS, in thrombin-cleaved PS, and in the coumarin form of the protein. Each EDTA-dependent antibody, immobilized on Sepharose 4B-CNBr was used to purify PS from the barium citrate-absorbed, ammonium sulphate-soluble fraction of plasma. The fraction eluted from the immunoabsorbent with a buffer containing 4 mmol/1 CaCl2 and analysed by SDS-PAGE, contained two bands, one migrating with conventionally purified PS and the other with purified C4b-binding protein. Homogeneous PS was obtained by chromatography of the barium citrate absorbate on a DEAE-Sephadex column. The protein peak containing the bulk of PS was subsequently applied to the immunoadsorbent and eluted with 4 mmol/1 CaCl2. These studies demonstrate that EDTA-dependent monoclonal antibodies can simplify the isolation of PS from human plasma.

The abnormal multimeric composition of plasma von Willebrand factor in type IIB von Willebrand's disease is transiently corrected after infusion of 1-deamino-[8-D-arginine]-vasopressin. However, the larger multimers released into the circulation disappear more rapidly in these patients than in type I von Willebrand's disease or normals. We demonstrate that the larger multimers of normal von Willebrand factor transfused into a type IIB patient are cleared from the circulation more slowly than multimers of similar size endogenously released from tissue stores. The rate of disappearance of large von Willebrand factor multimers after infusion of cryoprecipitate is similar in IIB, IIA, and severe homozygous-like von Willebrand's disease. Platelets from the IIB patient exhibited normal ristocetin-induced binding of normal von Willebrand factor. However, like normal platelets, they bound IIB von Willebrand factor at lower ristocetin concentrations than required for normal von Willebrand factor. These findings provide evidence that absence of the larger multimers from IIB plasma is related to a molecular abnormality of von Willebrand factor rather than to enhanced affinity of abnormal tissue or cellular binding sites, as is the case in the recently described “pseud” von Willebrand's disease and “platelet-type” von Willebrand's disease.

In a randomized double-blind cross-over trial we gave either 1-deamino-8-D-arginine vasopressin or placebo to 12 patients with uremia, hemorrhagic tendencies, and prolonged bleeding times. After vasopressin infusion, all patients had shortened bleeding times, with the effect lasting for at least four hours in most cases. Platelet count, platelet cyclic AMP levels, platelet retention on glass beads, plasma fibronectin, serum thromboxane B2 and residual prothrombin, hematocrit, and plasma osmolarity were unchanged after vasopressin. A consistent post-infusion increase in factor VIII coagulant activity and, to a lesser extent, in factor VIII-related antigen and ristocetin cofactor accompanied the shortening of bleeding time. In addition, vasopressin induced the appearance in plasma of larger von Willebrand-factor multimers than those present in the resting state. The compound was given to nine additional patients with acute or chronic renal failure and prolonged bleeding times, before major surgery or renal biopsy. In these patients, shortening of the bleeding time was associated with normal hemostasis. Our findings indicate that 1-deamino-8-D-arginine vasopressin can be used for temporary correction of bleeding time and may prevent surgical bleeding in patients with uremia.