Search

Objective: Small cell carcinoma of the ovary, hypercalcemic-type (SCCOHT) is a rare, extremely aggressive neoplasm that usually occurs in young women and is characterized by deleterious germline or somatic SMARCA4 mutations. We performed comprehensive genomic profiling (CGP) to potentially identify additional clinically and pathophysiologically relevant genomic alterations in SCCOHT., Methods: CGP assessment of all classes of coding alterations in up to 406 genes commonly altered in cancer and intronic regions for up to 31 genes commonly rearranged in cancer was performed on 18 SCCOHT cases (16 exhibiting classic morphology and 2 cases exhibiting exclusive a large cell variant morphology). In addition, a retrospective database search for clinically advanced ovarian tumors with genomic profiles similar to SCCOHT yielded 3 additional cases originally diagnosed as non-SCCOHT., Results: CGP revealed inactivating SMARCA4 alterations and low tumor mutational burden (TMB) (<6mutations/Mb) in 94% (15/16) of SCCOHT with classic morphology. In contrast, both (2/2) cases exhibiting only large cell variant morphology were hypermutated (TMB scores of 90 and 360mut/Mb) and were wildtype for SMARCA4. In our retrospective search, an index ovarian cancer patient harboring inactivating SMARCA4 alterations, initially diagnosed as endometrioid carcinoma, was re-classified as SCCOHT and responded to an SCCOHT chemotherapy regimen., Conclusion: The vast majority of SCCOHT demonstrate genomic SMARCA4 loss with only rare co-occurring alterations. Our data support a role for CGP in the diagnosis and management of SCCOHT and of other lesions with overlapping histological and clinical features, since identifying the former by genomic profile suggests benefit from an appropriate regimen and treatment decisions, as illustrated by an index patient., (Copyright © 2017 Elsevier Inc. All rights reserved.)

Purpose Histologic transformation of EGFR mutant lung adenocarcinoma (LADC) into small-cell lung cancer (SCLC) has been described as one of the major resistant mechanisms for epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs). However, the molecular pathogenesis is still unclear. Methods We investigated 21 patients with advanced EGFR-mutant LADCs that were transformed into EGFR TKI-resistant SCLCs. Among them, whole genome sequencing was applied for nine tumors acquired at various time points from four patients to reconstruct their clonal evolutionary history and to detect genetic predictors for small-cell transformation. The findings were validated by immunohistochemistry in 210 lung cancer tissues. Results We identified that EGFR TKI-resistant LADCs and SCLCs share a common clonal origin and undergo branched evolutionary trajectories. The clonal divergence of SCLC ancestors from the LADC cells occurred before the first EGFR TKI treatments, and the complete inactivation of both RB1 and TP53 were observed from the early LADC stages in sequenced tumors. We extended the findings by immunohistochemistry in the early-stage LADC tissues of 75 patients treated with EGFR TKIs; inactivation of both Rb and p53 was strikingly more frequent in the small-cell-transformed group than in the nontransformed group (82% v 3%; odds ratio, 131; 95% CI, 19.9 to 859). Among patients registered in a predefined cohort (n = 65), an EGFR mutant LADC that harbored completely inactivated Rb and p53 had a 43× greater risk of small-cell transformation (relative risk, 42.8; 95% CI, 5.88 to 311). Branch-specific mutational signature analysis revealed that apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC)-induced hypermutation was frequent in the branches toward small-cell transformation. Conclusion EGFR TKI-resistant SCLCs are branched out early from the LADC clones that harbor completely inactivated RB1 and TP53. The evaluation of RB1 and TP53 status in EGFR TKI-treated LADCs is informative in predicting small-cell transformation.

Small cell carcinoma of the ovary, hypercalcaemic type (SCCOHT) is a rare but aggressive and untreatable malignancy affecting young women. We and others recently discovered that SMARCA4, a gene encoding the ATPase of the SWI/SNF chromatin-remodelling complex, is the only gene recurrently mutated in the majority of SCCOHT. The low somatic complexity of SCCOHT genomes and the prominent role of the SWI/SNF chromatin-remodelling complex in transcriptional control of genes suggest that SCCOHT cells may rely on epigenetic rewiring for oncogenic transformation. Herein, we report that approximately 80% (19/24) of SCCOHT tumour samples have strong expression of the histone methyltransferase EZH2 by immunohistochemistry, with the rest expressing variable amounts of EZH2. Re-expression of SMARCA4 suppressed the expression of EZH2 in SCCOHT cells. In comparison to other ovarian cell lines, SCCOHT cells displayed hypersensitivity to EZH2 shRNAs and two selective EZH2 inhibitors, GSK126 and EPZ-6438. EZH2 inhibitors induced cell cycle arrest, apoptosis, and cell differentiation in SCCOHT cells, along with the induction of genes involved in cell cycle regulation, apoptosis, and neuron-like differentiation. EZH2 inhibitors suppressed tumour growth and improved the survival of mice bearing SCCOHT xenografts. Therefore, our data suggest that loss of SMARCA4 creates a dependency on the catalytic activity of EZH2 in SCCOHT cells and that pharmacological inhibition of EZH2 is a promising therapeutic strategy for treating this disease. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd., (Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.)

Purpose Tumor overexpression of cyclooxygenase-2 (COX-2) has been associated with worse outcome in non-small-cell lung cancer (NSCLC). In Cancer and Leukemia Group B (CALGB) 30203, we found that the selective COX-2 inhibitor celecoxib in addition to chemotherapy in advanced NSCLC improved progression-free and overall survival in patients with moderate to high COX-2 expression by immunohistochemistry (IHC). CALGB 30801 (Alliance) was designed to prospectively confirm that finding. Patients and Methods Patients with NSCLC (stage IIIB with pleural effusion or stage IV according to American Joint Committee on Cancer [sixth edition] criteria) were preregistered, and biopsy specimens were analyzed for COX-2 by IHC. Patients with COX-2 expression ≥ 2, performance status of 0 to 2, and normal organ function were eligible. Chemotherapy was determined by histology: carboplatin plus pemetrexed for nonsquamous NSCLC and carboplatin plus gemcitabine for squamous histology. Patients were randomly assigned to celecoxib (400 mg twice per day; arm A) or placebo (arm B). The primary objective was to demonstrate improvement in progression-free survival in patients with COX-2 index ≥ 4 with hazard ratio of 0.645 with approximately 85% power at two-sided significance level of .05. Results The study was halted for futility after 312 of the planned 322 patients with COX-2 index ≥ 2 were randomly assigned. There were no significant differences between the groups (hazard ratio, 1.046 for COX-2 ≥ 4). Subset analyses evaluating histology, chemotherapy regimen, and incremental COX-2 expression did not demonstrate any advantage for COX-2 inhibition. Elevation of baseline urinary metabolite of prostaglandin E2, indicating activation of the COX-2 pathway, was a negative prognostic factor. Values above the third quartile may have been a predictive factor. Conclusion COX-2 expression by IHC failed to select patients who could benefit from selective COX-2 inhibition. Urinary metabolite of prostaglandin E2 may be able to identify patients who could benefit from COX-2 inhibition.

Small cell carcinoma of the ovary, hypercalcemic type (SCCOHT) is a rare ovarian neoplasm that occurs in young women and has a poor prognosis. The histologic diagnosis of SCCOHT can be challenging due to its rarity and relatively nonspecific histologic features, which range from the classic, first-described small cell morphology to a pattern in which there are large cells with abundant eosinophilic cytoplasm. Many entities can be in the differential diagnosis and to date, immunohistochemical stains have shown no distinctive profile and have been of limited aid. SMARCA4 (also known as BRG1) mutations have recently been reported at high frequency in these tumors. SMARCA4 is an important component of the SWI/SNF complex that regulates gene expression through alteration of nucleosome conformation. Studies to date have suggested that immunohistochemical loss of expression of SMARCA4 is associated with the presence of a SMARCA4 mutation in most cases. In this study, the sensitivity and specificity of the immunohistochemical loss of SMARCA4 expression for the diagnosis of SCCOHT is examined in the context of the differential diagnosis with other primary or metastatic ovarian tumors. All but one of the SCCOHT showed loss of SMARCA4 expression (16/17; 94%), while of 279 other tumors tested, only two tumors (one clear cell carcinoma and one ovarian melanoma) showed loss of SMARCA4 expression. We conclude that SMARCA4 immunohistochemistry is highly sensitive and specific for a diagnosis of SCCOHT and is of clinical utility in the differential diagnosis of poorly differentiated ovarian tumors.

SQAP is a novel and promising anticancer agent that was obtained by structural modifications from a natural compound. SQAP inhibits angiogenesis in vivo resulting in increased hypoxia and reduced tumor volume. In this study, the mechanism by which SQAP modifies the tumor microenvironment was revealed through the application of a T7 phage display screening. This approach identified five SQAP-binding proteins including sterol carrier protein 2, multifunctional enzyme type 2, proteasomal ubiquitin receptor, UV excision repair protein and focal adhesion kinase (FAK). All the interactions were confirmed by surface plasmon resonance analysis. Since FAK plays an important role in cell turnover and angiogenesis, the influence of SQAP on FAK was the principal goal of this study. SQAP decreased FAK phosphorylation and cell migration in human umbilical vein endothelial cells and A549 cancer cells. These findings suggest that inhibition of FAK phosphorylation works as the mechanism for the anti-angiogenesis activity of SQAP.

Recent efforts to sequence human cancer genomes have highlighted that point mutations in genes involved in the epigenetic setting occur in tumor cells. Small cell lung cancer (SCLC) is an aggressive tumor with poor prognosis, where little is known about the genetic events related to its development. Herein, we have identified the presence of homozygous deletions of the candidate histone acetyltransferase KAT6B, and the loss of the corresponding transcript, in SCLC cell lines and primary tumors. Furthermore, we show, in vitro and in vivo, that the depletion of KAT6B expression enhances cancer growth, while its restoration induces tumor suppressor-like features. Most importantly, we demonstrate that KAT6B exerts its tumor-inhibitory role through a newly defined type of histone H3 Lys23 acetyltransferase activity., (©2015 American Association for Cancer Research.)

The focus of this study was to investigate anaplastic lymphoma kinase (ALK) expression by immunohistochemistry using a highly specific antibody. Distribution and frequency of ALK expression may provide a clue for ALK inhibitor use in small round cell tumors of childhood. The study group involved 76 small round cell tumors of childhood, which composed of 11 rhabdomyosarcomas, 13 Wilms tumors, 7 Ewing sarcoma/primitive neuroectodermal tumors, 34 peripheral neuroblastic tumors, and 11 acute lymphoblastic lymphoma. Anaplastic lymphoma kinase protein expression in small round cell tumors of childhood is poorly described in the literature. The findings of our study highlight a potential and possible role of targeting ALK in pediatric solid tumors by using ALK immunohistochemistry. Anaplastic lymphoma kinase may also have an oncogenic role in rhabdomyosarcomas and peripheral neuroblastic tumors, and they may possibly be treated with ALK inhibitors. Anaplastic lymphoma kinase expression in Wilms tumors is not reported in the literature, previously. Our study evaluated ALK expression in Wilms tumor samples., (Copyright © 2015 Elsevier Inc. All rights reserved.)

Interaction between multi-functional mesenchymal stroma/stem cells (MSC) and human tumor cells involves the exchange of biological material via extracellular vesicles including exosomes. Protein analysis of MSC-derived exosomes demonstrated the presence of MMP-2 and MSC-specific markers including CD90 and ecto-5'-nucleotidase (CD73). Incubation of tumor cells with these membranous particles revealed a rapid uptake of MSC-released microvesicles whereby breast cancer cells incorporated ~19% and SCCOHT-1 cells representing a rare type of small cell ovarian cancer assimilated ~28% of available exosomes within 24 h. This interaction was accompanied by functional alterations of tumor cell properties during integration of exosomal content from MSC. Indeed, exosome-associated MMP-2 exhibited functional enzyme activity and MCF-7 breast cancer cells with undetectable MMP-2 protein acquired expression of this enzyme and corresponding gelatinase functionality after stimulation with MSC-derived exosomes. Similar effects were observed in SCCOHT-1 cells during culture in the presence of MSC-derived exosomes which enabled new metabolic activities in this tumor cell type. Together, these findings demonstrated that the internalization of MSC-derived exosomes was associated with the acquisition of new tumor cell properties by altering cellular functionalities and providing the capability to re-organize the tumor microenvironment.

Introduction: The excision repair cross-complementing 1 (ERCC1) protein is an extensively investigated molecular marker because it may decrease sensitivity to platinum-based chemotherapy. Low ERCC1 expression has already been correlated with better treatment efficacy in non-small-cell lung cancer patients treated with platinum-based chemotherapy. However, the data on a prognostic and/or predictive value of ERCC1 in small-cell lung cancer (SCLC) are still very limited., Methods: This retrospective pilot study evaluated the impact of ERCC1 expression levels on response to first-line platinum-based chemotherapy with or without radiotherapy and survival outcomes of 77 SCLC patients. ERCC1 protein expression was determined immunohistochemically in primary tumour tissue., Results: ERCC1 protein expression was positive in 40/77 (51.9%) of our patients. No significant association was found between ERCC1 protein expression and response rate to first-line platinum-based chemotherapy, progression-free survival (PFS), or overall survival (OS), either in the overall population or in patients stratified by disease stage., Conclusions: In our limited group of 77 SCLC patients, ERCC1 protein expression was not found to correlate with either response rate to platinum-based chemotherapy or survival outcomes. Multi-centric prospective trials using a validated method of ERCC1 determination are mandatory in order to obtain a definitive answer on the predictive value of ERCC1 in SCLC., (Copyright © 2012 Elsevier Ltd. All rights reserved.)

The small cell ovarian carcinoma of the hypercalcemic type (SCCOHT) represents an aggressive tumor with poor prognosis predominantly affecting young women and so far, no cell line or animal model is available to investigate this devastating disease. Biopsy material from a recurrent SCCOHT was subjected to an explant culture to obtain an adherent and continuously proliferating cell population. Morphological and functional characterization revealed a heterogeneous population (SCCOHT-1) of about 13 µm in diameter and approximately 36 h of doubling time. Flow cytometric analysis of surface markers demonstrated the expression of CD15, CD29, CD44 and CD90 paralleled by the presence of cytokeratins and vimentin. Cytogenetic analysis and high-resolution oligo-array comparative genomic hybridization (aCGH) demonstrated a stable karyotype including deletions of the PARK2, CSMD1, GRIN2B and ATF7IP genes. Following lentiviral transduction with a GFP vector, the labeled SCCOHT-derived cells were subjected to CCE to separate distinct subpopulations as evidenced by cell cycle analysis. Subcutaneous injection of these subpopulations into NOD/SCID mice exhibited hypercalcemia and a tumor development in 100% of the mice. Re-cultivation of the mouse tumors revealed an outgrowth of SCCOHT-derived phenotypes and all cell populations expressed high telomerase activity. Moreover, histopathological evaluation demonstrated close similarities between the mouse tumors and the original patient tumor. In conclusion, SCCOHT-1 cells provide a study platform to investigate this rare disease and to examine effective and sufficient therapeutic strategies for this rather unknown type of cancer.

The ubiquitin-conjugating enzyme (UbcH10) plays important roles in the regulation of cell cycle progression. Recently, UbcH10 expression has been demonstrated in several human and experimental tumors, and proteasome inhibitors have been tested in trials for pulmonary neoplasms; however, the underlying mechanisms as well as the clinicopathological relevance of UbcH10 in the genesis and progression of lung cancer remain largely unknown. Therefore, the authors evaluated the expression of UbcH10 in human lung cancer and evaluated its possible diagnostic and prognostic use. They found that most cases of lung adenocarcinoma, squamous cell carcinoma, and large cell and small cell carcinoma were positive for UbcH10. The expression levels of UbcH10 progressively increased with decreasing degree of tumor differentiation. There was a statistically significant difference of UbcH10 positivity between grade I/III of lung adenocarcinoma (p=0.013) and squamous cell carcinoma (p=0.002). No significant differences were found between histological types (p=0.072). In the case of cell blocks prepared from pleural effusions, inflammatory and reactive mesothelial elements did not show appreciable UbcH10 expression, whereas neoplastic cells exhibited clear UbcH10 positivity. The results suggest that UbcH10 might represent a new and promising diagnostic and prognostic marker in both histologic and cytologic specimens of lung cancer.

Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCTɛAGCGGGTACCGAGCTCGAAT; ɛA=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67 fmol/μg DNA/h vs 3.47±1.35 fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway., (Copyright © 2012 Elsevier B.V. All rights reserved.)

To develop sero-diagnostic markers for lung cancer, we generated monoclonal antibodies using pulmonary adenocarcinoma (AD)-derived A549 cells as antigens by employing the random immunization method. Hybridoma supernatants were immunohistochemically screened for antibodies with AMeX-fixed and paraffin-embedded A549 cell preparations. Positive clones were monocloned twice through limiting dilutions. From the obtained monoclonal antibodies, we selected an antibody designated as KU-Lu-5 which showed intense membrane staining of A549 cells. Based on immunoprecipitation and MADLI TOF/TOF-MS analysis, this antibody was recognized as carbonic anhydrase XII (CAXII). To evaluate the utility of this antibody as a sero-diagnostic marker for lung cancer, we performed dot blot analysis with a training set consisting of sera from 70 lung cancer patients and 30 healthy controls. The CAXII expression levels were significantly higher in lung cancer patients than in healthy controls in the training set (P<0.0001), and the area under the curve of ROC was 0.794, with 70.0% specificity and 82.9% sensitivity. In lung cancers, expression levels of CAXII were significantly higher in patients with squamous cell carcinoma (SCC) than with AD (P = 0.035). Furthermore, CAXII was significantly higher in well- and moderately differentiated SCCs than in poorly differentiated ones (P = 0.027). To further confirm the utility of serum CAXII levels as a sero-diagnostic marker, an additional set consisting of sera from 26 lung cancer patients and 30 healthy controls was also investigated by dot blot analysis as a validation study. Serum CAXII levels were also significantly higher in lung cancer patients than in healthy controls in the validation set (P = 0.030). Thus, the serum CAXII levels should be applicable markers discriminating lung cancer patients from healthy controls. To our knowledge, this is the first report providing evidence that CAXII may be a novel sero-diagnostic marker for lung cancer.

KIT and PDGFRA in small cell lung carcinoma (SCLC) have been rarely examined in Japanese. The author investigated protein expression of KIT and PDGFRA in 54 Japanese cases of small cell lung carcinoma by immunohistochemistry, and gene mutations of KIT and PDGFRA in 20 Japanese cases of small cell lung carcinoma by the PCR-direct sequencing method. The molecular genetic analysis showed no mutations of KIT (exons 9, 11, 13, and 17) and PDGFRA (exons 12 and 18) genes in all 20 cases. KIT protein expression was recognized in all cases (100%). Membranous KIT expression was strong in 35 cases, moderate in 7 cases and weak in 12 cases. PDGFRA protein expression was noted in 35 cases (65%); the membranous expression was strong in 2 cases, moderate in 16 cases, and weak in 17 cases. The overall median survival was 13 months. There was no significant difference in the survival between KIT strongly positive cases (median, 12 months) and KIT moderately or weakly positive cases (median, 11 months). Likewise, there was no significant difference in the survival between PDGFRA-positive cases (median, 11 months) and PDGFRA-negative cases (median, 12 months). The protein expressions of KIT and PDGFRA did not correlate with gender, smoking, and disease stage. These findings suggest, in Japanese population, that mutations of KIT and PDGFRA were absent in small cell lung carcinoma of Japan, that KIT protein expression is present in 100%, that PDGFRA expression is present in 65%, and that KIT and PDGFRA protein expressions do not correlate with survival, gender, smoking, and disease stage.

Acquired chemoresistance is a major obstacle in successful treatment of small cell lung cancer (SCLC). DNA damage responses can potentially contribute to resistance by halting the cell cycle following exposure to therapeutic agents, thereby facilitating repair of drug-induced lesions and protecting tumour cells from death. The Chk1 protein kinase is a key regulator in this response. We analysed the status of cell cycle checkpoint proteins and the effects of the Chk1 inhibitor Gö6976 on cisplatin toxicity in SCLC cell lines. IC50s for cisplatin were determined using the MTT assay in six SCLC cell lines. Effects on cell cycle distribution and apoptosis were determined by flow cytometry and caspase 3 activation in the presence or absence of the Chk1 inhibitor Gö6976. The activation of checkpoint proteins was determined by Western blotting. Cell lines were divided into chemosensitive and chemoresistant groups on the basis of our results. While checkpoint responses were detected in these cell lines through Western blotting, some of these responses were delayed or weaker than those seen in other cell types in response to DNA damage and replication stress. Gö6976 significantly (p<0.05) enhanced the levels of apoptosis seen in response to a clinically relevant dose of cisplatin (<6 µM) and decreased drug-induced G2 arrest in chemosensitive cells. Our data suggest a role for Chk1 in chemoresistance of SCLC cells and a potential approach to improve initial response of SCLC to cisplatin therapy.

High immunohistochemical expression of carbonic anhydrase IX (CAIX) is found in clear cell renal cell carcinoma (ccRCC), but no studies have assessed CAIX in metastatic ccRCC (mccRCC) of the lung. As 75% of patients with mccRCC show lung involvement, characterization of protein expression in these lesions is warranted. This investigation analyzed CAIX immunohistochemical expression in pulmonary/pleural tumors including mccRCC (n = 22), mesothelioma (n = 19), squamous cell carcinoma (n = 27), small cell carcinoma (n = 9), and adenocarcinoma (n = 49), as well as other mesothelial lesions (n = 4). Membranous immunoreactivity was semiquantitatively evaluated for percent of cells stained and intensity. All cases of mccRCC (1+, 4.5%; 3+, 95.5%) and mesothelioma (2+, 10.5%; 3+, 89.5%) expressed CAIX. Most cases of lung squamous cell carcinoma (0, 11.1%; 1+, 25.9%; 2+, 22.2%; 3+, 40.7%) and small cell carcinoma were reactive (0, 11.1%; 1+, 22.2%; 2+, 33.3%; 3+, 33.3%), while CAIX was detected less frequently in pulmonary adenocarcinoma (0, 61.2%; 1+, 16.3%; 2+, 12.2%; 3+, 10.2%). In addition, CAIX was positive in adenomatoid tumor (3+, 100%) and mesothelial hyperplasia (3+, 100%). We demonstrate that CAIX is sensitive for mccRCC within the lung and a novel immunohistochemical marker for mesothelial proliferations, notably mesothelioma. Variable immunoreactivity is present among primary pulmonary epithelial tumors. Knowledge of expression overlap between these entities may prevent an incorrect interpretation of immunohistochemical results, particularly when limited tissue is available. As new carbonic anhydrase inhibitors are being evaluated, testing additional tumors for CAIX may lead to novel treatment options.

Folate hydrolase (prostate-specific antigen) 1 (FH(PSA)1), also known as prostate-specific membrane antigen (PSMA), is a transmembrane receptor expressed on prostate cancer cells that correlates with a more aggressive phenotype. Recent studies have demonstrated FH(PSA)1 expression in numerous benign and malignant tissue types, as well as the malignant neovasculature. As FH(PSA)1 represents a diagnostic immunomarker for prostate cancer, we explored its expression pattern in various subtypes of bladder cancer. Immunohistochemical analysis (IHC) of FH(PSA)1 was performed using tissue microarrays constructed from 167 bladder cancers, including 96 urothelial carcinomas (UCCs), 37 squamous cell carcinomas, 17 adenocarcinomas and 17 small cell carcinomas. We used a FH(PSA)1 monoclonal antibody obtained from Dako (clone 3E6, dilution 1:100), which recognizes the epitope present in the 57-134 amino acid region of the extracellular portion of the PSMA molecule. Intensity of IHC staining was scored as 0 (no expression) to 3+ (strong expression), with 2-3+ IHC considered a positive result. FH(PSA)1 demonstrated expression in a subset of bladder cancers and was most common in small cell carcinoma (3/17; 18%), with concurrent expression in non-small cell components in a subset of cases (2/6). FH(PSA)1 expression was less frequent in UCC (3/96; 3%) and adenocarcinoma (2/17; 12%). None of the squamous cell carcinomas demonstrated tumor cell expression of FH(PSA)1. However, all bladder cancers examined expressed FH(PSA)1 in the tumor vasculature, suggesting a potential role for this molecule in mediating new vessel ingrowth. FH(PSA)1 may occasionally be expressed in various subtypes of bladder cancer. These findings suggest cautious use of FH(PSA)1 as a diagnostic marker for prostatic tissue invading the bladder. The finding of FH(PSA)1 in the bladder cancer neovasculature suggests that this molecule may promote tumor growth and may represent a potential new vascular target in this disease.

Thymidylate synthase (TS) is an enzyme, which catalyzes the methylation of deoxyuridylate to deoxythymidylate using 5.10-methylenetetrahydrofolate as a cofactor. For this reason, TS has been widely investigated and is one of the best-known drug targets in the anticancer area. Antimetabolites have been developed to target TS and among them, pemetrexed is now considered as part of the standard treatment for lung cancer and mesothelioma. Intratumoral expression of TS mRNA has been shown to be associated with prognosis and with the response to 5-FU therapy in patients with breast, colorectal, head and neck cancer types. Recent findings suggest that TS might be a biomarker for NSCLC treated with pemetrexed, as lower response rates in squamous cell carcinoma and small cell carcinoma may be due to a higher expression of TS. Specific validation for this use as a biomarker is awaited. All these recent findings suggest that TS could be a useful predictive marker of the treatment efficacy of antifolate drugs and indicate that both Real-Time PCR and immuno-histochemistry might be used to assess TS expression levels. This may help in defining the best therapeutic strategy., (Copyright © 2011 SPLF. Published by Elsevier Masson SAS. All rights reserved.)

Background: Dihydropyrimidine dehydrogenase (DPD), orotate phosphoribosyl transferase (OPRT), and thymidylate synthase (TS) levels correlate with sensitivity and resistance to 5-fluorouracil (5-FU). Few data are available on these enzymes in pulmonary neuroendocrine carcinoma, because 5-FU appears to have minimal effect on such carcinomas., Patients and Methods: This study investigated 5-FU-related enzymes in large-cell neuroendocrine carcinoma (LCNEC; n = 31) and small-cell lung carcinoma (SCLC; n = 15), comparing expression levels with epithelial carcinomas including adenocarcinoma (ADC; n = 34) and squamous cell carcinoma (SCC; n = 13) obtained from 93 patients with primary lung tumors. Levels of 5-FU-related enzyme mRNA were analyzed by laser capture microdissection, compared with immunohistochemical findings and correlated with clinicopathologic factors., Results: LCNEC and SCLC showed significantly higher TS and OPRT mRNA levels than ADC. SCLC exhibited significantly higher TS mRNA levels than LCNEC (P = .002). LCNEC displayed significantly lower DPD mRNA levels than ADC (P < .001), with a similar tendency in SCLC. SCC showed significantly lower DPD (P < .01) and higher OPRT (P < .001) mRNA levels than ADC. When we divide the data by pathology into epithelial carcinoma and neuroendocrine carcinoma, malignant potentials and prognoses correlated with mRNA levels in epithelial carcinoma, but not in neuroendocrine carcinoma. Immunohistochemically, neuroendocrine carcinomas were immunonegative for DPD. A significant correlation was found between enzymatic mRNA and protein expression for DPD (R = .500) and a weak correlation was observed for TS (R = .294)., Conclusion: Neuroendocrine carcinomas show characteristic patterns of expression for 5-FU-related enzymes, including low DPD mRNA and protein level and high TS mRNA level compared with adenocarcinomas. These results partially explain why 5-FU-based chemotherapy shows minimal efficacy against SCLC. Conversely, clinicopathological data and survival analysis indicates that 5-FU-related enzymes themselves might not affect the malignant potential of neuroendocrine carcinoma. Expressional differences in 5-FU-related enzymes among pathologies may provide valuable information for tailor-made chemotherapy.

Background: Thymidylate synthase (TS), a key enzyme in the de novo synthesis of thymidine, is an important chemotherapeutic target for malignant tumours including lung cancer. Although inhibition of TS has an antiproliferative effect in cancer cells, the precise mechanism of this effect has remained unclear., Methods: We examined the effects of TS inhibition with an RNA interference-based approach. The effect of TS depletion on the growth of lung cancer cells was examined using colorimetric assay and flow cytometry., Results: Measurement of the enzymatic activity of TS in 30 human lung cancer cell lines revealed that such activity differs among tumour histotypes. Almost complete elimination of TS activity by RNA interference resulted in inhibition of cell proliferation in all tested cell lines, suggestive of a pivotal role for TS in cell proliferation independent of the original level of enzyme activity. The antiproliferative effect of TS depletion was accompanied by arrest of cells in S phase of the cell cycle and the induction of caspase-dependent apoptosis as well as by changes in the expression levels of cyclin E and c-Myc. Moreover, TS depletion induced downregulation of the antiapoptotic protein X-linked inhibitor of apoptosis (XIAP), and it seemed to activate the mitochondrial pathway of apoptosis., Conclusion: Our data provide insight into the biological relevance of TS as well as a basis for clinical development of TS-targeted therapy for lung cancer.

Background: Neuron-specific enolase (NSE) is the most sensitive tumor marker for small-cell lung carcinoma (SCLC) at the time of diagnosis. The main purpose of this study was to review the usefulness of serum NSE level as a prognostic factor in patients with SCLC and to determine the correlation between the NSE level and the stage of disease and response to chemotherapy., Methods: In this prospective study, patients with SCLC were evaluated for response to chemotherapy, survival without disease progression, and overall survival. The end point was designated at patient death due to SCLC. NSE assays were performed before and after completion of chemotherapy., Results: Sixty-five patients were included in study. NSE levels were significantly higher in patients who died of SCLC. The pre-treatment NSE levels in patients who responded to treatment were significantly lower. The post-treatment NSE levels were not significantly correlated with response to chemotherapy, progression-free survival, overall survival, and prognosis of patients. Change in the NSE level between the pre- and post-treatment periods was not significantly correlated with response to treatment, progression-free survival, and overall survival., Conclusions: NSE levels might not be related with the stage of the disease. However, a low pre-treatment NSE level might be used in predicting good response to chemotherapy in patients with SCLC. The post-treatment serum NSE levels and the rate of change between pre- and post-treatment serum levels of NSE were not related with response to chemotherapy, progression-free survival, and overall survival., (Copyright 2009 SEPAR. Published by Elsevier Espana. All rights reserved.)

Epithelial and endothelial tyrosine kinase (Etk), also known as Bmx (bone marrow X kinase) plays an important role in apoptosis of epithelial cells. The goal of this study was to investigate whether Etk is involved in apoptosis of small cell lung cancer (SCLC) cells and correlated with the expression levels of apoptosis-associated proteins such as Bcl-2, Bcl-X(L) and p53. One hundred and seventy-one cases of lung cancer specimens including seventy-one SCLCs and one hundred NSCLCs were immunostained for Etk, Bcl-2, Bcl-X(L) and p53. Parental SCLC H446 cell line, and its subline (H446-Etk) that overexpresses Etk, were used to study the role of Etk in apoptosis induced by doxorubicin. It was found that high expression of Etk occurs in 74.6% of SCLC cases, but only in 40% of NSCLC cases, and there is marked difference in the expression levels of Bcl-2, Bcl-X(L) and p53 between Etk-positive and Etk-negative SCLC cases. Furthermore, the levels of Bcl-2 and Bcl-X(L) significantly increased in H446-Etk cells than that in H446 cells after doxorubicin treatment, and were positively associated with Etk expression. However, p53 did not correspond with Etk expression although its expression decreased greatly with apoptosis both in H446-Etk and H446 cells. After doxorubicin treatment, the cell viability was significantly higher in H446-Etk cells than in parental H446 cells. Downregulation of Etk by Etk siRNA sensitized H446 cells to doxorubicin. Our results indicate that upregulation of tyrosine kinase Etk may be a new mechanism involved in protection of SCLC cells from apoptosis. Bcl-2 and Bcl-X(L) but not p53 may contribute to doxorubicin-induced apoptosis through Etk pathway., (Copyright 2010. Published by Elsevier Inc.)

Background: GD2/GM2 synthase is a key enzyme in the synthesis of GD2 and GM2 gangliosides found on the surface of neuroblastoma and small cell lung carcinoma (SCLC) cells. In neuroblastoma, persistent levels of GD2/GM2 synthase RNA in bone marrow (BM) following therapy portend poorer progression-free and overall survival. We conducted this study to determine if GD2/GM2 synthase RNA could be detected in SCLC cell lines and human tissues, and whether mRNA transcript levels corresponded with disease status., Experimental Design: Initially, a pilot study enrolled patients with SCLC to determine the rate of GD2 expression at various points in the patients' disease course. Peripheral blood (PB), bone marrow and tumor tissues were used to measure GD2/GM2 synthase levels. In addition, SCLC cell lines were analyzed for GD2/GM2 synthase expression. Based on data from that initial analysis, a prospective trial was developed enrolling patients with newly diagnosed SCLC and following them serially. GD2/GM2 synthase transcript was determined by a sensitive quantitative reverse transcription-PCR (qRT-PCR) assay and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH)., Results: Six SCLC cell lines were assayed for expression of GD2/GM2 synthase, and high expression was detected in all. GD2/GM2 synthase transcript levels were obtained from tumor tissue, BM, or PB of 29 patients in the pilot study. 6/10 (60%) tumor tissues or BM samples were positive (median 332.7 units; range 13-2323 units); 8/19 (42%) untreated patients were GD2/GM2 synthase positive in their PB prior to beginning therapy (median 10.2; range 5.1-32.2); 3/4 (75%) patients who were first tested when they developed recurrent disease were positive in their PB (median 16.1; range 8.5-19.9). The fourth patient had an initial value of 2.0 (negative), which increased to 8.4 (positive) within 1 month without treatment. Seven of 12 patients with baseline positive GD2/GM2 synthase values had post-treatment levels measured, all of which were 50% decrease following successful treatment. Patients in the prospective trial demonstrated lower rates of positivity, with only 3/26 (12%) patients exhibiting detectable transcript levels in the peripheral blood prior to treatment. All 3 of these patients had their transcript levels fall below 5 after treatment. 11/26 patients had baseline levels of zero. Bone marrow was drawn at baseline on 7 patients in the prospective trial and 3 (43%) had transcript levels above 5 (range 0.65-27.43 units). There was no correlation between elevated levels in the BM and elevated levels in the PB., Conclusions: Although initial studies demonstrated that GD2/GM2 synthase transcripts were measurable in the peripheral blood of SCLC patients at diagnosis and declined with successful treatment, in a separate prospective study, these results could not be confirmed. Thus, GD2/GM2 is not a reliable biomarker in SCLC., (Copyright 2009 Elsevier Ireland Ltd. All rights reserved.)

Lung cancer is the leading cause of cancer deaths in the United States. Current therapies are inadequate. Histone deacetylase inhibitors (HDACi) are a recently developed class of anticancer agents that cause increased acetylation of core histones and nonhistone proteins leading to modulation of gene expression and protein activity involved in cancer cell growth and survival pathways. We examined the efficacy of the HDACi panobinostat (LBH589) in a wide range of lung cancers and mesotheliomas. Panobinostat was cytotoxic in almost all 37 cancer cell lines tested. IC(50) and LD(50) values were in the low nmol/L range (4-470 nmol/L; median, 20 nmol/L). Small cell lung cancer (SCLC) cell lines were among the most sensitive lines, with LD(50) values consistently <25 nmol/L. In lung cancer and mesothelioma animal models, panobinostat significantly decreased tumor growth by an average of 62% when compared with vehicle control. Panobinostat was equally effective in immunocompetent and severe combined immunodeficiency mice, indicating that the inhibition of tumor growth by panobinostat was not due to direct immunologic effects. Panobinostat was, however, particularly effective in SCLC xenografts, and the addition of the chemotherapy agent etoposide augmented antitumor effects. Protein analysis of treated tumor biopsies revealed elevated amounts of cell cycle regulators such as p21 and proapoptosis factors, such as caspase 3 and 7 and cleaved poly[ADP-ribose] polymerase, coupled with decreased levels of antiapoptotic factors such as Bcl-2 and Bcl-X(L). These studies together suggest that panobinostat may be a useful adjunct in the treatment of thoracic malignancies, especially SCLC.

Small cell lung cancer (SCLC) is one of the intractable malignancies. The goal of this study was to clarify whether Akt activity is involved with chemo-resistance and to improve the sensitivity of SCLC cells to the current standard chemotherapeutic drugs with agents that are expected to suppress Akt activity through tyrosine kinase inhibition. Although Akt activity seemed to be involved with the sensitivity of SCLC cells to chemotherapeutic agents (cisplatin, etoposide, SN38 and amrubicin), in Akt-activated N417 cells, only amrubicin exerted synergistic cell growth inhibition when combined with an Akt inhibitor, LY294002. A non-specific tyrosine kinase inhibitor, genistein, suppressed Akt and showed synergistic interaction in combination with amrubicin in N417 cells. Among tyrosine kinases (insulin-like growth factor I receptor, c-Kit and c-Src), only c-Src was activated in N417 cells compared with Akt-inactive H209 cells. A c-Src-specific inhibitor, PP2, and a clinically available multi-tyrosine kinase inhibitor, dasatinib, suppressed Akt activity in parallel with c-Src inhibition. Both PP2 and dasatinib exerted synergistic growth inhibition of N417 cells in the combination with amrubicin. In immunohistochemical analysis, c-Src was expressed in 17 of 19 of the SCLC tumor tissues. These observations suggested that Akt suppression enhances the cytotoxicity of amrubicin, and for the purpose of Akt suppression, c-Src is a promising target in SCLC.

In human prostate cancer, Arginase 2 (ARG2) and nitric oxide synthase (NOS) are concomitantly expressed by tumor cells, and induce tumor immune escape via peroxynitrite-dependent Tyrosine nitrosylation. Since there were no data regarding this immune suppressive mechanism in other tumor types, and an evaluation of its clinical relevance in human tumors had still to be provided, we have investigated presence and clinical relevance of ARG2 and NOS expression in lung cancer. No evidence of NOS expression was found, no significant NOS enzymatic activity was detected. Instead, ARG2 protein was expressed by tumor cells. In a cohort of 120 patients, the amount of ARG2-positive tumor cells was significantly higher in small cell lung cancers (SCLC) than in non-small cell lung cancers (NSCLC). Large cell undifferentiated carcinomas had twice ARG2 than the other NSCLC subtypes. ARG2 expression was increased in Grade 3 tumors, as compared to Grades 1 and 2. However, no relationship was found with tumor size and stage, and with patient survival. Indeed, the enzyme was active, since the Arginine catabolite Ornithine was produced, but Arginine depletion was not attained. In addition, nitrotyrosine was not found in tumor tissue. Accordingly, when tumor cells isolated from lung cancer were incubated with activated autologous T cells, no inhibition of proliferation was detected. Our results indicate that ARG2 is expressed in lung cancer, but it does not induce tumor immune escape and does not affect disease progression, most probably due to the lack of concomitant NOS expression.

Cisplatin is widely used for the treatment of solid tumors, including small cell lung cancers, but its success is often compromised due to relapse and resistance to further treatment. p70 ribosomal S6 kinase (p70S6K) has been shown to be upregulated in lung cancer cells. In the present study, we investigated whether the p70S6K pathway contributes to cisplatin resistance in human small cell lung cancer H69 cells. The levels of phosphorylated p70S6K and its downstream target S6 but not total p70S6K or S6 were elevated in the H69 cells that acquired resistance to cisplatin (H69/CP) compared to parental H69 cells. Cisplatin treatment resulted in the activation of p70S6K and downregulation of p70S6K was associated with cisplatin-induced PARP cleavage. While the ability of cisplatin to induce apoptosis was attenuated in H69/CP cells, inhibition of p70S6K by rapamycin enhanced cisplatin-induced apoptosis in these cells as evident by the increase in cisplatin-induced poly(ADP-ribose) polymerase (PARP) cleavage. The phosphoinositide 3-kinase (PI3K) inhibitor Ly294002 alone induced PARP cleavage and further augmented cisplatin-induced PARP cleavage. In contrast, inhibition of extracellular signal-regulated kinase (ERK) by U0126 attenuated cisplatin-induced PARP cleavage. Both rapamycin and Ly294002 enhanced cisplatin-induced acti-vation of ERK1/2. Taken together, these results suggest that activation of p70S6K contributes to cisplatin resistance in small cell lung cancer H69 cells, and inhibition/downregulation of p70S6K as well as activation of ERK1/2 could circumvent cisplatin resistance.

Neuropeptide hormones like bombesin/gastrin-releasing peptide, galanin or bradykinin, acting via auto and paracrine growth loops, represent the principal mitogens of small cell lung cancer (SCLC). These mitogenic neuropeptides activate G(q/11)-coupled receptors which stimulate phospholipase Cbeta activity, followed by rises of the intracellular calcium concentration ([Ca2+](i)) and activation of protein kinase C (PKC). We report here that proline-rich tyrosine kinase Pyk2 is highly expressed in SCLC cells and provides a functional link between neuropeptide-induced increases in [Ca2+](i) and tumor cell proliferation. Activation of Pyk2 and its association with Src kinases critically depends on the elevation of [Ca2+](i), but is independent of PKC. Src kinase activities are crucial for neuropeptide-mediated GTP-loading of Ras and activation of extracellular signal-regulated kinases in SCLC cells. Pyk2 and Src kinases essentially contribute to anchorage-independent proliferation of SCLC cells. Inhibition of either Pyk2 or Src kinases by lentiviral RNAi or pharmacological inhibition with PP2, respectively, attenuated basal and neuropeptide-elicited survival and proliferation of SCLC cells in liquid culture and in soft agar. Thus, neuropeptides stimulate anchorage-independent survival and proliferation of SCLC cells via pathways involving Pyk2 and Src kinases. Therefore, Ca2+-induced Pyk2/Src complex formation may be a rewarding molecular target for novel therapeutic strategies in SCLC cells.

Purpose: Carbonic anhydrase 9 (CA9) is over-expressed in many human solid tumors under conditions of low oxygen concentration and can be associated with a low probability of survival. In this study, stable CA9-expressing cell lines were established using the CA9 gene-defective human C33a cell line and the HeLa cell line to investigate the role of CA9 in response to ionizing radiation and hypoxia-selective cytotoxin, Tirapazamine (TPZ)., Methods and Materials: Human CA9 cDNA or an empty vector was transfected into the C33a and HeLa cell lines and C33a-vector, C33a-CA9, HeLa-vector, and HeLa-CA9 cell lines were produced accordingly. Sensitivity of the C33a-vector/C33a-CA9 cells to ionizing radiation and TPZ was measured using clonogenic assays. The alkaline comet assay was used to measure single strand DNA breaks caused by TPZ in the C33a-vector, C33a-CA9, HeLa-vector, and HeLa-CA9 cell lines., Results: Radiation sensitivity, as determined with clonogenic survival assays, of C33a-vector/C33a-CA9 cells did not differ under either normoxic or hypoxic conditions. However, increased clonogenic sensitivity to TPZ was observed in C33a-CA9 cells under the hypoxic condition by 26% (95% CI 14-39%, P = 0.02 in comparison to the C33a-vector cells). The comet assay showed significantly greater DNA damage in the C33a-CA9 cells compared with that of the C33a-vector cells with the same treatment under hypoxic conditions, supporting the results of the clonogenic survival data. Because this difference in the amount of DNA damage was not observed for the hypoxic HeLa-CA9/HeLa-vector cell lines, both of which have induced CA9 expression by hypoxia, the enhanced sensitivity of C33a-CA9 cells to TPZ is considered to be due to the specific condition of CA9 over-expression., Conclusion: Our results suggest the possibility that CA9 over-expression in tumors might be exploited to increase the treatment effects of TPZ.

The association between lung cancer risk and 2 polymorphisms, rs12268840 and rs2308327 (codon K178R), in the DNA repair protein, O(6)-alkylguanine-DNA alkyltransferase, which are associated with interindividual differences in activity, have been investigated in 3 hospital-based case-control studies. Genotyping was carried out on 617 subjects of whom 255 had lung cancer. In 2 of the 3 series, there was a significant inverse association between the 178R allele and case status (p < 0.05). In a meta-analysis, the odds ratio (95% CI) associated with the 178R allele relative to the 178K allele was 0.64 (0.45-0.92, p = 0.01) and 0.51 (0.24-1.11, p = 0.09) in fixed effects and random effects models, respectively. In a pooled analysis, after adjustment for sex, age, pack years and series, the OR (95% CI) for a heterozygote was 0.67 (0.45-1.01) and for a 178R homozygote was 0.10 (0.01-0.94); the trend for a decreased risk with the number of R alleles was significant (p = 0.008). This trend was particularly pronounced in heavy smokers (trend test p = 0.003), but not significant in light smokers (p = 0.73). There was no evidence of an association between rs12268840 and lung cancer risk. These results suggest that the R allele may protect against lung cancer, specifically in heavy smokers, an effect that may result from this polymorphism affecting the function of the MGMT protein and/or levels in MGMT activity., ((c) 2007 Wiley-Liss, Inc.)

In the present work, we have investigated the antitumor activity of 6-(7-nitro-2,1,3-benzoxadiazol-4-ylthio)hexanol (NBDHEX) on aggressive small cell lung cancer. NBDHEX not only is cytotoxic toward the parental small cell lung cancer H69 cell line (LC(50) of 2.3 +/- 0.6 micromol/L) but also overcomes the multidrug resistance of its variant, H69AR, which overexpresses the ATP-binding cassette transporter multidrug resistance-associated protein 1 (MRP1; LC(50) of 4.5 +/- 0.9 micromol/L). Drug efflux experiments, done in the presence of a specific inhibitor of MRP1, confirmed that NBDHEX is not a substrate for this export pump. Interestingly, NBDHEX triggers two different types of cell death: a caspase-dependent apoptosis in the H69AR cells and a necrotic phenotype in the parental H69 cells. The apoptotic pathway triggered by NBDHEX in H69AR cells is associated with c-Jun NH(2)-terminal kinase and c-Jun activation, whereas glutathione oxidation and activation of p38(MAPK) is observed in the NBDHEX-treated H69 cells. In contrast to the parental cells, the higher propensity to die through apoptosis of the H69AR cell line may be related to the lower expression of the antiapoptotic protein Bcl-2. Therefore, down-regulation of a factor crucial for cell survival makes H69AR cells more sensitive to the cytotoxic action of NBDHEX, which is not a MRP1 substrate. We have previously shown that NBDHEX is cytotoxic toward P-glycoprotein-overexpressing tumor cell lines. Therefore, NBDHEX seems a very promising compound in the search for new molecules able to overcome the ATP-binding cassette family of proteins, one of the major mechanisms of multidrug resistance in cancer cells.

Background: Tryptophan hydroxylase 2 (TPH2) is the rate-limiting enzyme in brain serotonin (5-HT) biosynthesis. Although dysfunction of 5-HT neurotransmission has been implicated in a variety of neuropsychiatric conditions, the human TPH2 promoter has not been characterized in vitro., Methods: The functional relevance of TPH2 promoter polymorphisms was determined with luciferase assays in primary serotonergic neurons from rat raphe nuclei and in human small cell lung carcinoma cells (SHP-77 cells). We also investigated transcription factor binding to the variant promoter sequence with electrophoretic mobility shift assay (EMSA)., Results: The polymorphism rs11178997 of the human TPH2 promoter significantly reduced TPH2 transcriptional activity by 22% and 7% in primary serotonergic neurons and in SHP-77 cells, respectively. In contrast, no significant differences in promoter activity were observed for the G- and T-alleles of rs4570625. The EMSA revealed reduced binding of the transcription factor POU3F2 (also known as Brn-2, N-Oct-3) to the A-allele of the polymorphism rs11178997. Overexpression of POU3F2 resulted in a robust activation of the TPH2 promoter (2.7-fold)., Conclusions: Our data suggest that the human TPH2 promoter polymorphism rs11178997 impacts on gene expression, which might have implications for the development and function of the serotonergic system in the brain.

Lung cancer is a leading cause of cancer death. Systemic therapies with cytotoxic chemotherapies remain ineffective. Current research efforts in lung cancer have focused on developing novel agents to target cellular pathways that are altered in lung cancer. Protein tyrosine kinases are a family of oncogenes that regulate important cellular processes such as differentiation, proliferation, cell cycle, motility, and apoptosis. In this article, we review non receptor tyrosine kinases' role in lung cancer and the development of agents that target these proteins.

Cyclophilin A (CypA), a peptidyl-prolyl cis-trans isomerase (PPIase), was originally identified as the intracellular receptor for cyclosporin A (CsA). Recently, correlations of CypA with tumor pathogenesis have been studied. Here, we studied the expression of CypA and its receptor CD147 in several kinds of lung cancer cells as well as a normal lung cell and found that in H446 cell, a kind of small cell lung cancer cell, the expression are the highest. The exogeneous CypA protein can substantially stimulate H446 cell growth in dependence on its PPIase activity. We also showed that CypA protein can stimulate ERK1/2 signal in dose and time dependent manners and almost has no effect to p38 and JNK signals. Elucidation of the precise role of CypA in these pathways may lead to new targeted therapies for small cell lung cancer.

Background: Cyclooxygenase-2 enzyme (COX-2) is overexpressed in human non-small cell lung cancer (NSCLC) but is not expressed in small cell lung cancer. Selective COX-2 inhibitors have been shown to induce apoptosis in NSCLC cells, an effect which is associated with the regulation of intracellular MAP kinase (MAPK) signal pathways. Our aims were to characterize the effects of COX-2 inhibition by rofecoxib on apoptosis in human NSCLC and small cell lung cancer cell lines., Methods: The human NSCLC cell line NCI-H2126 and small cell lung cancer cell line DMS-79 were used. Constitutive COX-2 protein levels were first determined by Western blot test. Levels of apoptosis were evaluated by using propidium iodide staining on FACScan analysis after incubation of NCI-H2126 and DMS-79 with p38 MAPK inhibitor SB202190 (25 ?microM), NF-kappaB inhibitor SN50 (75 microg/mL), and rofecoxib at 100 and 250 microM. All statistical analysis was performed by analysis of variance., Results: Western blot test confirmed the presence of COX-2 enzyme in NCI-H2126 and absence in DMS-79. Interestingly, rofecoxib treatment demonstrated a dose-dependent increase in apoptosis in both cell lines. Given this finding, the effect of rofecoxib on NF-kappaB and p38 MAPK pathways was also examined. Apoptosis in both cell lines was unaltered by SN50, either alone or in combination with rofecoxib. A similar phenomenon was observed in NCI-H2126 cells treated with SB202190, either alone or in combination with rofecoxib. In contrast, p38 MAPK inhibition greatly upregulated DMS-79 apoptosis in a manner that was unaltered by the addition of rofecoxib., Conclusions: Rofecoxib led to a dose-dependent increase in apoptosis in both tumor cell lines. This effect occurred independently of COX-2, NF-kappaB, and p38 MAPK pathways in DMS-79 cells. As such, rofecoxib must act on alternative pathways to regulate apoptosis in human small cell lung cancer cells.

CYP2A6 is a major phase I enzyme metabolizing tobacco-specific nitrosamines, implicated as risk factors for lung cancer. In this study, immunohistochemistry and in situ hybridization (ISH) for CYP2A6 with human lung cancer tissues (n=31) obtained by surgical resection showed significantly higher immunoreactivity in the cases with lymph node metastasis. The adenocarcinoma cases (n=23) with lymph node metastasis or large tumor size showed a high immunoreactivity for CYP2A6. The squamous cell carcinoma cases (n=6) with large tumor size showed a tendency for low CYP2A6 immunoreactivity. ISH for CYP2A6 revealed mRNA expression in both adenocarcinoma and squamous cell carcinoma cells. The data suggest that CYP2A6 could have an important role in the development and proliferation of lung carcinomas. With adenocarcinomas, CYP2A6 could be a target candidate for therapeutic and chemopreventive intervention.

Background: CKD-602, a topoisomerase I inhibitor, has antitumor activity in a broad spectrum of tumor types. STEALTH liposomal CKD-602 (S-CKD602) prolongs circulation of CKD-602 in plasma, increases drug exposure in tumors and improves efficacy compared with free drug., Materials and Methods: Different dosing regimens of S-CKD602, free CKD-602 and topotecan were compared for antitumor activity in female athymic nude mice bearing human A375 melanoma, ES-2 ovarian, H82 SCLC or HT-29 colon tumor xenografts., Results: S-CKD602 was more efficacious than free drug in all tumor types studied. The therapeutic index (TI) of S-CKD602 was estimated to be approximately 6-fold greater than that of free CKD-602 in ES-2 and approximately 3-fold greater in H82 tumors. TI of S-CKD602 was approximately 2-fold greater than that of free CKD-602 and approximately 5-fold greater than that of topotecan in A375, and > or = 3-fold greater in HT-29 tumors. In A375 tumors, once-weekly dosing of S-CKD602 was superior to once every 2 weeks or twice weekly schedules., Conclusion: The therapeutic index of S-CKD602 was greater than that of free CKD-602 and topotecan in several human tumor types.

The c-Met receptor tyrosine kinase is emerging as a novel target in many solid tumors, including lung cancer. PHA-665752 was identified as a small molecule, ATP competitive inhibitor of the catalytic activity of the c-Met kinase. Here, we show that treatment with PHA665752 reduced NCI-H69 (small cell lung cancer) and NCI-H441 (non-small cell lung cancer) tumorigenicity in mouse xenografts by 99% and 75%, respectively. Reduction in tumor size was also observed by magnetic resonance imaging of tumors in mice. PHA665752 inhibited c-Met phosphorylation at the autophosphorylation and c-Cbl binding sites in mouse xenografts derived from non-small cell lung cancer cell lines (NCI-H441 and A549) and small cell lung cancer cell line (NCI-H69). PHA665752 also inhibited angiogenesis by >85% in all the abovementioned cell lines and caused an angiogenic switch which resulted in a decreased production of vascular endothelial growth factor and an increase in the production of the angiogenesis inhibitor thrombospondin-1. These studies show the feasibility of selectively targeting c-Met with ATP competitive small molecule inhibitors and suggest that PHA665752 may provide a novel therapeutic approach to lung cancer.

Objective: To investigate the expression and its significance of DNA topoisomerase I (Topo I) in small cell lung cancer (SCLC)., Methods: Topo I expression was detected by immunohistochemical S-P technique on 50 cases of SCLC and 12 cases of normal lung tissues., Results: The total positive rate of Topo I in normal lung tissue was 25.0% (3/12) and 78.0% (39/50) in SCLC. The expression of Topo I does not correlate with age, gender, smoking, tumor size and tumor site (P > 0.05), but significantly correlated with lymph node metastasis and clinical stage (P <0.05)., Conclusion: High Topo I expression is a rationale indication of Topo I inhibitor treatment of malignancies. It should be possible to predict anti-tumor drug sensitivity by assessment of Topo I expression and help to improve the therapeutic efficacy for cancer patients.

Background and Objective: Matrix metalloproteinases (MMPs) play an important role in several steps of cancer development. MMP2 and MMP9 have previously been implicated in lymphatic and vascular invasion of lung cancer; however, the expression and prognostic significance of MMP2 and MMP9 is not fully clarified. This study was designed to investigate the significance of MMP2 and MMP9 in lung cancer tissue or serum, and their correlation with lung cancer prognosis., Methods: Immunohistochemical analysis was performed to determine MMP2 and MMP9 staining in human nonsmall cell lung cancer (NSCLC). Serum MMP2 and MMP9 protein levels in patients after surgery were measured using the ELISA method. The correlation between MMP2 and MMP9 serum levels and clinicopathological features of NSCLC were analyzed by survival analysis. We also performed reverse transcriptase (RT)-PCR assays to detect messenger RNA (mRNA) expression to further confirm the activity of MMP2 and MMP9 in human lung cancer., Results: Increased MMP2 immunostaining and MMP2 serum level correlated with advanced tumor stage and the presence of distant metastasis (Pearson's chi(2) test and ANOVA, p < 0.05). However, for MMP9, only serum level showed a correlation with advanced tumor stage. No significant correlation was observed between MMP2 or MMP9 immunostaining expression and tumor histologic features (Pearson's chi(2) test, p = 0.061 and p = 0.087, respectively). A high densitometry value of MMP2 and MMP9 PCR products (i.e. mRNA expression level) was related to poor differentiation grade, distant metastasis, and small cell carcinoma histologic type (ANOVA, p < 0.05)., Conclusions: Our results suggest that MMP2 is a more sensitive predictor than MMP9 of lung cancer progression, metastasis, and survival. Serum MMP2 levels may be a valuable prognosis variable and could help to stratify lung cancer patients into low- and high-risk groups.

A 53-year-old woman diagnosed with small-cell lung carcinoma (SCLC) was referred to our hospital because of general malaise and inappetence. Serum amylase levels were drastically elevated at 13,920 IU/l, with the salivary type dominating. She suffered multiple liver metastases and presented with disseminated intravascular coagulation (DIC). She succumbed to progressive malaise one month after admission. The amylase level was increased to 18,630 IU/l just before her death. Necropsy of the right supraclavicular lymph node confirmed SCLC with partial necrosis. Immunohistological analysis revealed that the SCLC produced salivary-type amylase. A rare case of salivary-type amylase-producing SCLC with a futile outcome was reported with review of the previous literature.

Background/aims: The determination of neuron-specific enolase (NSE) is relatively frequently requested in the differential diagnosis of small-cell lung carcinoma and non-small-cell lung carcinoma. The individual results of different immunoassays are often not comparable, which has been confirmed by long-term external quality assessments. In this study, we assessed the possible sources of these differences., Methods: More than 3,000 NSE analyses were performed using seven different immunoassays: DELFIA (PerkinElmer), Elecsys 2010 or Modular Analytics E 170 (Roche), Kryptor (B.R.A.H.M.S.), the enzyme-linked immunosorbent assay DRG and three assays based on immunoradiometric assays (DiaSorin, Immunotech and Schering-CIS). The following parameters were evaluated: precision profile of the individual methods, linearity on dilution and modified recovery, comparability and discrimination of immunoassays, sensitivity, and specificity., Results: There were differences in the correlation of values of certain low-concentration specimens. Some assays correlate well while others do not (up to fivefold difference), especially in the case of controls prepared synthetically. Therefore, the current non-standardized preparation of controls is questionable in our opinion. In the cutoff range, the difference in the results of native samples did not exceed its double value. The variation in values >100 microg/l obtained with different assays is <40%., Conclusion: Our results confirmed expected matrix interferences especially in the range of normal and cutoff NSE concentrations. Another source of discrepancies can be attributed to different antibody affinity to alphagamma- and gammagamma-enolase isoenzymes. Finally, improper settings of cutoff values also contribute to the different discrimination of the methods., (Copyright (c) 2007 S. Karger AG, Basel.)

It has been suggested that the alpha-class glutathione S-transferases (GSTs) protect various cell types from oxidative stress and lipid peroxidation (LPO). In order to examine the protective role of alpha-class GST isozyme hGSTA1-1 against doxorubicin (DOX)-induced lipid peroxidation, cytotoxicity, and apoptosis, human small cell lung cancer (SCLC) H69 cells were stably transfected with hGSTA1. Immunological and biochemical characterization of hGSTA1-transfected cells revealed the expression of functionally active hGSTA1-1 localized near the cellular plasma membranes. hGSTA1-transfected cells acquired significantly increased resistance to the DOX-induced cytotoxicity by suppressing lipid peroxidation levels in these cells. Overexpression of hGSTA1-1 in cells inhibited DOX-mediated depletion of GSH and higher GSH levels were found in DOX-treated hGSTA1-transfected cells as compared with empty vector-transfected controls. hGSTA1-1 overexpression also provided protection to cells from DOX-induced apoptosis by inhibiting phosphorylation of c-Jun-N-terminal kinases (JNK), caspase-3 activation, and by preserving the levels of anti-apoptotic protein Bcl-2. These results are consistent with the idea that the alpha-class GSTs provide protection against oxidative stress by attenuating lipid peroxidation and these enzymes can modulate signaling for apoptosis.

Objective: To determine the cut-off value of serum neuron-specific enolase (NSE) level for distinguishing small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC)., Methods: Serum NSE levels were measured by enzyme-linked immunosorbent assay in 137 patients with NSCLC or SCLC, and the best cut-off value was analyzed using ROC curve., Results: The positivity rate of serum NSE was significantly higher in patients with SCLC than in those with NSCLC (P<0.01). The best cut-off value was 15.45 microg/L using ROC curve, which gave a sensitivity of 66.7% and specificity of 65.7%., Conclusion: Serum NSE level may allow simple and cost-effective differentiation of SCLC and NSCLC.

Proteasome inhibition is a novel therapeutic approach that is being investigated in non-small cell and small cell lung cancer (NSCLC and SCLC). Proteasome inhibition affects a range of intracellular signals and disrupts the levels of numerous proteins, causing apoptosis via multiple pathways. Importantly, malignant cells are more sensitive to proteasome inhibition than normal cells. A number of proteasome inhibitors have demonstrated activity in preclinical studies, both as single agents and in combination with conventional and novel antineoplastic agents. However, only bortezomib, a dipeptide boronic acid analog, has been investigated in lung cancer clinical trials, in which it has shown activity as a single agent and in combination regimens. Numerous preclinical and clinical studies are ongoing in both NSCLC and SCLC. Proteasome inhibition could potentially play a significant role in the future management of these conditions.

O6-alkylguanine-DNA alkyltransferase (AGT) plays an important role in the repair of O6-alkylguanine adducts, which are major mutagenic lesions produced by environmental carcinogens. Polymorphisms in the AGT gene may affect the capacity to repair DNA damage and thereby have influence on individual's susceptibility to smoking-related cancer. To test this hypothesis, we investigated the potential association of AGT polymorphisms (485C > A, Leu53Leu (C > T) and Leu84Phe] with the risk of lung cancer in a Korean population. The AGT genotypes were determined in 432 lung cancer patients and in 432 healthy controls who were frequency-matched for age and gender. The 485 AA genotype was associated with a significantly increased risk for overall lung cancer as compared with the 485 CC genotype and the combined 485 CC + CA genotype, respectively (adjusted odds ratio (OR) = 1.83, 95% confidence interval (CI) = 1.12-2.99, P = 0.02, and Bonferroni corrected P-value (Pc) = 0.04; and adjusted OR = 1.67, 95% CI = 1.05-2.66, P = 0.03, respectively). When the lung cancer cases were categorized by the tumor histology, the 485 AA genotype was associated with a significantly increased risk of adenocarcinoma (AC) and small cell carcinoma (SmCC), respectively, as compared with the combined 485 CC + CA genotype (adjusted OR = 2.54, 95% CI = 1.39-4.66, P = 0.003; and adjusted OR = 2.19, 95% CI = 1.06-4.55, P = 0.04, respectively). However, the genotype distributions of the Leu53Leu and Leu84Phe polymorphisms were not significantly different between the lung cancer cases and the controls. On a promoter assay, the 485C > A polymorphism did not have an effect on the promoter activity of the AGT gene. These results suggest that the effect of the AGT 485C > A polymorphism on the risk of lung cancer may be secondary to linkage disequilibrium (LD) with either another AGT variant or with a true susceptibility gene, and that the AGT 485C > A polymorphism could be used as a marker for the genetic susceptibility to lung cancer., (Copyright 2005 Wiley-Liss, Inc)

The inhibitor of apoptosis protein (IAP) survivin is overexpressed in many tumors but is absent in most normal adult tissues. We report high levels of survivin expression in small cell lung cancer (SCLC), and describe the role of the phosphatidylinositol 3-kinase (PI3K)/Akt pathway in survivin upregulation. Moreover, the cytoprotective function of survivin in response to the anti-cancer agent cisplatin (CDDP) was investigated. Negative modulation of PI3K/Akt using pharmacological inhibitors or dominant negative Akt (DN-Akt) decreased Akt kinase activity and resulted in decreased survivin expression and phosphorylation on Thr34, whereas transfection of constitutively active Akt (CA-Akt) increased survivin expression and phosphorylation. Interestingly, we found that treatment of SCLC cells with CDDP further increased survivin expression in a cell cycle independent manner by activation of Akt. CA-Akt or lentiviral survivin also inhibited apoptosis induced by CDDP, whereas DN-Akt or survivin-specific RNA interference sensitized cells to CDDP. We identified survivin as an anti-apoptotic protein in SCLC cells that is regulated by Akt, and demonstrate that treatment with the DNA damaging agent CDDP activates the PI3K/Akt/survivin pathway that in part protects cells from drug-induced apoptosis., (Copyright 2005 Wiley-Liss, Inc)