Search

In this study, three insect-resistant transgenic Bacillus thuringiensis (Bt) oilseed rape events (GT1, GT5 and GT9) under field conditions were utilised to analyse the dynamics of Cry1Ac protein and the changes in soil enzyme activities in the rhizosphere soil of transgenic Bt plants during different growth stages over two successive cultivation years. The results indicated that compared to the non-transgenic control plant cv. Westar, the amount of Cry1Ac protein in the rhizosphere soil of the three transgenic oilseed rape events was significantly higher during the flowering and podding stages in the first cultivation year. Additionally, in the second cultivation year, transgenic GT1 and GT9 had significantly higher amounts of Cry1Ac protein in the rhizosphere soil during the flowering stage, and all three transgenic oilseed rape events had significantly higher amounts of Cry1Ac protein in the rhizosphere soil during the podding stage. Over the two successive cultivation years, the sucrase activity in the rhizosphere soil of transgenic events showed significant changes during bolting, flowering and podding stages, while all three transgenic events exhibited significant changes in phosphatase activity during the four different stages. Furthermore, different transgenic events showed varying significant changes in urease and protease activities during the bolting, flowering and podding stages of the first year, and all three transgenic events had significant changes in dehydrogenase activities during the four different stages of the second cultivation year. PCA and correlation analysis clearly demonstrated a strong correlation between the Cry1Ac protein and five soil enzyme activities, as well as a close interconnectedness among those five soil enzyme activities. These findings suggest that the amount of insecticidal crystal proteins in the rhizosphere soil of transgenic Bt (Cry1Ac) oilseed rape varies with different growth periods, and the enzyme activities in the rhizosphere soil of transgenic Bt oilseed rape plants undergo significant changes over two successive planting years.

Abstract Plants and microbes communicate to collaborate to stop pests, scavenge nutrients, and react to environmental change. Microbiota consisting of thousands of species interact with each other and plants using a large chemical language that is interpreted by complex regulatory networks. In this work, we develop modular interkingdom communication channels, enabling bacteria to convey environmental stimuli to plants. We introduce a “sender device” in Pseudomonas putida and Klebsiella pneumoniae, that produces the small molecule p-coumaroyl-homoserine lactone (pC-HSL) when the output of a sensor or circuit turns on. This molecule triggers a “receiver device” in the plant to activate gene expression. We validate this system in Arabidopsis thaliana and Solanum tuberosum (potato) grown hydroponically and in soil, demonstrating its modularity by swapping bacteria that process different stimuli, including IPTG, aTc and arsenic. Programmable communication channels between bacteria and plants will enable microbial sentinels to transmit information to crops and provide the building blocks for designing artificial consortia.

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue ‘omics’-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

Soybean (Glycine max) is an important crop in agricultural production where water shortage limits yields in soybean. Root system plays important roles in water-limited environments, but the underlying mechanisms are largely unknown. In our previous study, we produced a RNA-seq dataset generated from roots of soybean at three different growth stages (20-, 30-, and 44-day-old plants). In the present study, we performed a transcriptome analysis of the RNA-seq data to select candidate genes with probable association with root growth and development. Candidate genes were functionally examined in soybean by overexpression of individual genes using intact soybean composite plants with transgenic hairy roots. Root growth and biomass in the transgenic composite plants were significantly increased by overexpression of the GmNAC19 and GmGRAB1 transcriptional factors, showing up to 1.8-fold increase in root length and/or 1.7-fold increase in root fresh/dry weight. Furthermore, greenhouse-grown transgenic composite plants had significantly higher seed yield by about 2-fold than control plants. Expression profiling in different developmental stages and tissues showed that GmNAC19 and GmGRAB1 were most highly expressed in roots, displaying a distinct root-preferential expression. Moreover, we found that under water-deficit conditions, overexpression of GmNAC19 enhanced water stress tolerance in transgenic composite plants. Taken together, these results provide further insights into the agricultural potential of these genes for development of soybean cultivars with improved root growth and enhanced tolerance to water-deficit conditions.

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters.Graphical overview

Trypsin inhibitors (TIs) are widely distributed in plants and are known to play a protective role against herbivores. TIs reduce the biological activity of trypsin, an enzyme involved in the breakdown of many different proteins, by inhibiting the activation and catalytic reactions of proteins. Soybean (Glycine max) contains two major TI classes: Kunitz trypsin inhibitor (KTI) and Bowman-Birk inhibitor (BBI). Both genes encoding TI inactivate trypsin and chymotrypsin enzymes, which are the main digestive enzymes in the gut fluids of Lepidopteran larvae feeding on soybean. In this study, the possible role of soybean TIs in plant defense against insects and nematodes was investigated. A total of six TIs were tested, including three known soybean trypsin inhibitors (KTI1, KTI2 and KTI3) and three genes encoding novel inhibitors identified in soybean (KTI5, KTI7, and BBI5). Their functional role was further examined by overexpression of the individual TI genes in soybean and Arabidopsis. The endogenous expression patterns of these TI genes varied among soybean tissues, including leaf, stem, seed, and root. In vitro enzyme inhibitory assays showed significant increase in trypsin and chymotrypsin inhibitory activities in both transgenic soybean and Arabidopsis. Detached leaf-punch feeding bioassays detected significant reduction in corn earworm (Helicoverpa zea) larval weight when larvae fed on transgenic soybean and Arabidopsis lines, with the greatest reduction observed in KTI7 and BBI5 overexpressing lines. Whole soybean plant greenhouse feeding bioassays with H. zea on KTI7 and BBI5 overexpressing lines resulted in significantly reduced leaf defoliation compared to non-transgenic plants. However, bioassays of KTI7 and BBI5 overexpressing lines with soybean cyst nematode (SCN, Heterodera glycines) showed no differences in SCN female index between transgenic and non-transgenic control plants. There were no significant differences in growth and productivity between transgenic and non-transgenic plants grown in the absence of herbivores to full maturity under greenhouse conditions. The present study provides further insight into the potential applications of TI genes for insect resistance improvement in plants.

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six synthetic drought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis-regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Oilseed rape (Brassica napus L.) is an important cash crop, but transgenic oilseed rape has not been grown on a commercial scale in China. It is necessary to analyze the characteristics of transgenic oilseed rape before commercial cultivation. In our study, differential expression of total protein from the leaves in two transgenic lines of oilseed rape expressing foreign Bt Cry1Ac insecticidal toxin and their non-transgenic parent plant was analyzed using a proteomic approach. Only shared changes in both of the two transgenic lines were calculated. Fourteen differential protein spots were analyzed and identified, namely, eleven upregulated expressed protein spots and three downregulated protein spots. These proteins are involved in photosynthesis, transporter function, metabolism, protein synthesis, and cell growth and differentiation. The changes of these protein spots in transgenic oilseed rape may be attributable to the insertion of the foreign transgenes. However, the transgenic manipulation might not necessarily cause significant change in proteomes of the oilseed rape.

Genome-editing has enabled rapid improvement for staple food crops, such as potato, a key beneficiary of the technology. In potato, starch contained within tubers represents the primary product for use in food and non-food industries. Starch granules are produced in the plastids of tubers with plastid size correlated with the size of starch grana. The division of plastids is controlled by proteins, including the tubulin-like GTPase FtsZ1. The altered expression of FtsZ1 has been shown to disrupt plastid division, leading to the production of “macro-plastid”-containing plants. These macro-chloroplast plants are characterized by cells containing fewer and enlarged plastids. In this work, we utilize CRISPR/Cas9 to generate FtsZ1 edited potato lines to demonstrate that genome-editing can be used to increase the size of starch granules in tubers. Altered plastid morphology was comparable to the overexpression of FtsZ1 in previous work in potato and other crops. Several lines were generated with up to a 1.98-fold increase in starch granule size that was otherwise phenotypically indistinguishable from wild-type plants. Further, starch paste from one of the most promising lines showed a 2.07-fold increase in final viscosity. The advantages of enlarged starch granules and the potential of CRISPR/Cas9-based technologies for food crop improvement are further discussed.

Switchgrass (Panicum virgatum L.) has immense potential as a bioenergy crop with the aim of producing biofuel as an end goal. Nitrogen (N)-related sustainability traits, such as nitrogen use efficiency (NUE) and nitrogen remobilization efficiency (NRE), are important factors affecting switchgrass quality and productivity. Hence, it is imperative to develop nitrogen use-efficient switchgrass accessions by exploring the genetic basis of NUE in switchgrass. For that, we used 331 diverse field-grown switchgrass accessions planted under low and moderate N fertility treatments. We performed a genome wide association study (GWAS) in a holistic manner where we not only considered NUE as a single trait but also used its related phenotypic traits, such as total dry biomass at low N and moderate N, and nitrogen use index, such as NRE. We have evaluated the phenotypic characterization of the NUE and the related traits, highlighted their relationship using correlation analysis, and identified the top ten nitrogen use-efficient switchgrass accessions. Our GWAS analysis identified 19 unique single nucleotide polymorphisms (SNPs) and 32 candidate genes. Two promising GWAS candidate genes, caffeoyl-CoA O-methyltransferase (CCoAOMT) and alfin-like 6 (AL6), were further supported by linkage disequilibrium (LD) analysis. Finally, we discussed the potential role of nitrogen in modulating the expression of these two genes. Our findings have opened avenues for the development of improved nitrogen use-efficient switchgrass lines.

Phytosensors are genetically engineered plant-based sensors that feature synthetic promoters fused to reporter genes to sense and report the presence of specific biotic and abiotic stressors on plants. However, when induced reporter gene output is below detectable limits, owing to relatively weak promoters, the phytosensor may not function as intended. Here, we show modifications to the system to amplify reporter gene signal by using a synthetic transcription factor gene driven by a plant pathogen-inducible synthetic promoter. The output signal was unambiguous green fluorescence when plants were infected by pathogenic bacteria. We produced and characterized a phytosensor with improved sensing to specific bacterial pathogens with targeted detection using spectral wavelengths specific to a fluorescence reporter at 3 m standoff detection. Previous attempts to create phytosensors revealed limitations in using innate plant promoters with low-inducible activity since they are not sufficient to produce a strong detectable fluorescence signal for standoff detection. To address this, we designed a pathogen-specific phytosensor using a synthetic promoter-transcription factor system: the S-Box cis-regulatory element which has low-inducible activity as a synthetic 4xS-Box promoter, and the Q-system transcription factor as an amplifier of reporter gene expression. This promoter-transcription factor system resulted in 6-fold amplification of the fluorescence after infection with a potato pathogen, which was detectable as early as 24 h post-bacterial infection. This novel bacterial pathogen-specific phytosensor potato plant demonstrates that the Q-system may be leveraged as a powerful orthogonal tool to amplify a relatively weak synthetic inducible promoter, enabling standoff detection of a previously undetectable fluorescence signal. Pathogen-specific phytosensors would be an important asset for real-time early detection of plant pathogens prior to the display of disease symptoms on crop plants.

Abstract Background Switchgrass (Panicum virgatum L.), a North American prairie grassland species, is a potential lignocellulosic biofuel feedstock owing to its wide adaptability and biomass production. Production and genetic manipulation of switchgrass should be useful to improve its biomass composition and production for bioenergy applications. The goal of this project was to develop a high-throughput stable switchgrass transformation method using Agrobacterium tumefaciens with subsequent plant regeneration. Results Regenerable embryogenic cell suspension cultures were established from friable type II callus-derived inflorescences using two genotypes selected from the synthetic switchgrass variety ‘Performer’ tissue culture lines 32 and 605. The cell suspension cultures were composed of a heterogeneous fine mixture culture of single cells and aggregates. Agrobacterium tumefaciens strain GV3101 was optimum to transfer into cells the pANIC-10A vector with a hygromycin-selectable marker gene and a pporRFP orange fluorescent protein marker gene at an 85% transformation efficiency. Liquid cultures gave rise to embryogenic callus and then shoots, of which up to 94% formed roots. The resulting transgenic plants were phenotypically indistinguishable from the non-transgenic parent lines. Conclusion The new cell suspension-based protocol enables high-throughput Agrobacterium-mediated transformation and regeneration of switchgrass in which plants are recovered within 6–7 months from culture establishment.

Abstract Background The recalcitrance of cellulosic biomass is widely recognized as a key barrier to cost-effective biological processing to fuels and chemicals, but the relative impacts of physical, chemical and genetic interventions to improve biomass processing singly and in combination have yet to be evaluated systematically. Solubilization of plant cell walls can be enhanced by non-biological augmentation including physical cotreatment and thermochemical pretreatment, the choice of biocatalyst, the choice of plant feedstock, genetic engineering of plants, and choosing feedstocks that are less recalcitrant natural variants. A two-tiered combinatoric investigation of lignocellulosic biomass deconstruction was undertaken with three biocatalysts (Clostridium thermocellum, Caldicellulosiruptor bescii, Novozymes Cellic® Ctec2 and Htec2), three transgenic switchgrass plant lines (COMT, MYB4, GAUT4) and their respective nontransgenic controls, two Populus natural variants, and augmentation of biological attack using either mechanical cotreatment or cosolvent-enhanced lignocellulosic fractionation (CELF) pretreatment. Results In the absence of augmentation and under the conditions tested, increased total carbohydrate solubilization (TCS) was observed for 8 of the 9 combinations of switchgrass modifications and biocatalysts tested, and statistically significant for five of the combinations. Our results indicate that recalcitrance is not a trait determined by the feedstock only, but instead is coequally determined by the choice of biocatalyst. TCS with C. thermocellum was significantly higher than with the other two biocatalysts. Both CELF pretreatment and cotreatment via continuous ball milling enabled TCS in excess of 90%. Conclusion Based on our results as well as literature studies, it appears that some form of non-biological augmentation will likely be necessary for the foreseeable future to achieve high TCS for most cellulosic feedstocks. However, our results show that this need not necessarily involve thermochemical processing, and need not necessarily occur prior to biological conversion. Under the conditions tested, the relative magnitude of TCS increase was augmentation > biocatalyst choice > plant choice > plant modification > plant natural variants. In the presence of augmentation, plant modification, plant natural variation, and plant choice exhibited a small, statistically non-significant impact on TCS.

Unmanned aerial vehicle (UAV) technology is an emerging powerful approach for high-throughput plant phenotyping field-grown crops. Switchgrass (Panicum virgatum L.) is a lignocellulosic bioenergy crop for which studies on yield, sustainability, and biofuel traits are performed. In this study, we exploited UAV-based imagery (LiDAR and multispectral approaches) to measure plant height, perimeter, and biomass yield in field-grown switchgrass in order to make predictions on bioenergy traits. Manual ground truth measurements validated the automated UAV results. We found UAV-based plant height and perimeter measurements were highly correlated and consistent with the manual measurements (r = 0.93, p < 0.001). Furthermore, we found that phenotyping parameters can significantly improve the natural saturation of the spectral index of the optical image for detecting high-density plantings. Combining plant canopy height (CH) and canopy perimeter (CP) parameters with spectral index (SI), we developed a robust and standardized biomass yield model [biomass = (m × SI) × CP × CH] where the m is an SI-sensitive coefficient linearly varying with the plant phenological changing stage. The biomass yield estimates obtained from this model were strongly correlated with manual measurements (r = 0.90, p < 0.001). Taking together, our results provide insights into the capacity of UAV-based remote sensing for switchgrass high-throughput phenotyping in the field, which will be useful for breeding and cultivar development.

The wide-scale production of renewable fuels from lignocellulosic feedstocks continues to be hampered by the natural recalcitrance of biomass. Therefore, there is a need to develop robust and reliable methods to characterize and quantify components that contribute to this recalcitrance. In this study, we utilized a method that incorporates pyrolysis with successive gas chromatography and mass spectrometry (Py-GC/MS) to assess lignification in cell suspension cultures. This method was compared with other standard techniques such as acid-catalyzed hydrolysis, acetyl bromide lignin determination, and nitrobenzene oxidation for quantification of cell wall bound phenolic compounds. We found that Py-GC/MS can be conducted with about 250 µg of tissue sample and provides biologically relevant data, which constitutes a substantial advantage when compared to the 50–300 mg of tissue needed for the other methods. We show that when combined with multivariate statistical analyses, Py-GC/MS can distinguish cell wall components of switchgrass (Panicum virgatum) suspension cultures before and after inducing lignification. The deposition of lignin precursors on uninduced cell walls included predominantly guaiacyl-based units, 71% ferulic acid, and 5.3% p-coumaric acid. Formation of the primary and partial secondary cell wall was supported by the respective ~15× and ~1.7× increases in syringyl-based and guaiacyl-based precursors, respectively, in the induced cells. Ferulic acid was decreased by half after induction. These results provide the proof-of-concept for quick and reliable cell wall compositional analyses using Py-GC/MS and could be targeted for either translational genomics or for fundamental studies focused on understanding the molecular and physiological mechanisms regulating plant cell wall production and biomass recalcitrance.

A primary focus of the rapidly growing field of plant synthetic biology is to develop technologies to precisely regulate gene expression and engineer complex genetic circuits into plant chassis. At present, there are few orthogonal tools available for effectively controlling gene expression in plants, with most researchers instead using a limited set of viral elements or truncated native promoters. A powerful repressible-and engineerable-binary system that has been repurposed in a variety of eukaryotic systems is the Q-system from Neurospora crassa. Here, we demonstrate the functionality of the Q-system in plants through transient expression in soybean (Glycine max) protoplasts and agroinfiltration in Nicotiana benthamiana leaves. Further, using functional variants of the QF transcriptional activator, it was possible to modulate the expression of reporter genes and to fully suppress the system through expression of the QS repressor. As a potential application for plant-based biosensors (phytosensors), we demonstrated the ability of the Q-system to amplify the signal from a weak promoter, enabling remote detection of a fluorescent reporter that was previously undetectable. In addition, we demonstrated that it was possible to coordinate the expression of multiple genes through the expression of a single QF activator. Based on the results from this study, the Q-system represents a powerful orthogonal tool for precise control of gene expression in plants, with envisioned applications in metabolic engineering, phytosensors, and biotic and abiotic stress tolerance.

CRISPR/Cas9 has been widely applied to various plant species accelerating the pace of plant genome editing and precision breeding in crops. Unintended effects beyond off-target nucleotide mutations are still somewhat unexplored. We investigated the degree and patterns of epigenetic changes after gene editing. We examined changes in DNA methylation in genome-edited promoters of naturally hypermethylated genes (AT1G72350 and AT1G09970) and hypomethylated genes (AT3G17320 and AT5G28770) from Arabidopsis. Transgenic plants were developed via Agrobacterium-mediated floral dip transformation. Homozygous edited lines were selected from segregated T2 plants by an in vitro digestion assay using ribonucleoprotein complex. Bisulfite sequencing comparisons were made between paired groups of edited and non-edited plants to identify changes in DNA methylation of the targeted loci. We found that directed mutagenesis via CRISPR/Cas9 resulted in no unintended morphological or epigenetic alterations. Phenotypes of wild-type, transgenic empty vector, and transgenic edited plants were similar. Epigenetic profiles revealed that methylation patterns of promoter regions flanking target sequences were identical among wild-type, transgenic empty vector, and transgenic edited plants. There was no effect of mutation type on epigenetic status. We also evaluated off-target mutagenesis effects in the edited plants. Potential off-target sites containing up to 4-bp mismatch of each target were sequenced. No off-target mutations were detected in candidate sites. Our results showed that CRISPR/Cas9 did not leave an epigenetic footprint on either the immediate gene-edited DNA and flanking DNA or introduce off-target mutations.

Abstract Background Genetic engineering of switchgrass (Panicum virgatum L.) for reduced cell wall recalcitrance and improved biofuel production has been a long pursued goal. Up to now, constitutive promoters have been used to direct the expression of cell wall biosynthesis genes toward attaining that goal. While generally sufficient to gauge a transgene’s effects in the heterologous host, constitutive overexpression often leads to undesirable plant phenotypic effects. Green tissue-specific promoters from switchgrass are potentially valuable to directly alter cell wall traits exclusively in harvestable aboveground biomass while not changing root phenotypes. Results We identified and functionally characterized three switchgrass green tissue-specific promoters and assessed marker gene expression patterns and intensity in stably transformed rice (Oryza sativa L.), and then used them to direct the expression of the switchgrass MYB4 (PvMYB4) transcription factor gene in transgenic switchgrass to endow reduced recalcitrance in aboveground biomass. These promoters correspond to photosynthesis-related light-harvesting complex II chlorophyll-a/b binding gene (PvLhcb), phosphoenolpyruvate carboxylase (PvPEPC), and the photosystem II 10 kDa R subunit (PvPsbR). Real-time RT-PCR analysis detected their strong expression in the aboveground tissues including leaf blades, leaf sheaths, internodes, inflorescences, and nodes of switchgrass, which was tightly up-regulated by light. Stable transgenic rice expressing the GUS reporter under the control of each promoter (756–2005 bp in length) further confirmed their strong expression patterns in leaves and stems. With the exception of the serial promoter deletions of PvLhcb, all GUS marker patterns under the control of each 5′-end serial promoter deletion were not different from that conveyed by their respective promoters. All of the shortest promoter fragments (199–275 bp in length) conveyed strong green tissue-specific GUS expression in transgenic rice. PvMYB4 is a master repressor of lignin biosynthesis. The green tissue-specific expression of PvMYB4 via each promoter in transgenic switchgrass led to significant gains in saccharification efficiency, decreased lignin, and decreased S/G lignin ratios. In contrast to constitutive overexpression of PvMYB4, which negatively impacts switchgrass root growth, plant growth was not compromised in green tissue-expressed PvMYB4 switchgrass plants in the current study. Conclusions Each of the newly described green tissue-specific promoters from switchgrass has utility to change cell wall biosynthesis exclusively in aboveground harvestable biomass without altering root systems. The truncated green tissue promoters are very short and should be useful for targeted expression in a number of monocots to improve shoot traits while restricting gene expression from roots. Green tissue-specific expression of PvMYB4 is an effective strategy for improvement of transgenic feedstocks.

Abstract Background The mission of the BioEnergy Science Center (BESC) was to enable efficient lignocellulosic-based biofuel production. One BESC goal was to decrease poplar and switchgrass biomass recalcitrance to biofuel conversion while not affecting plant growth. A transformation pipeline (TP), to express transgenes or transgene fragments (constructs) in these feedstocks with the goal of understanding and decreasing recalcitrance, was considered essential for this goal. Centralized data storage for access by BESC members and later the public also was essential. Results A BESC committee was established to codify procedures to evaluate and accept genes into the TP. A laboratory information management system (LIMS) was organized to catalog constructs, plant lines and results from their analyses. One hundred twenty-eight constructs were accepted into the TP for expression in switchgrass in the first 5 years of BESC. Here we provide information on 53 of these constructs and the BESC TP process. Eleven of the constructs could not be cloned into an expression vector for transformation. Of the remaining constructs, 22 modified expression of the gene target. Transgenic lines representing some constructs displayed decreased recalcitrance in the field and publications describing these results are tabulated here. Transcript levels of target genes and detailed wall analyses from transgenic lines expressing six additional tabulated constructs aimed toward modifying expression of genes associated with wall structure (xyloglucan and lignin components) are provided. Altered expression of xyloglucan endotransglucosylase/hydrolases did not modify lignin content in transgenic plants. Simultaneous silencing of two hydroxycinnamoyl CoA:shikimate hydroxycinnamoyl transferases was necessary to decrease G and S lignin monomer and total lignin contents, but this reduced plant growth. Conclusions A TP to produce plants with decreased recalcitrance and a LIMS for data compilation from these plants were created. While many genes accepted into the TP resulted in transgenic switchgrass without modified lignin or biomass content, a group of genes with potential to improve lignocellulosic biofuel yields was identified. Results from transgenic lines targeting xyloglucan and lignin structure provide examples of the types of information available on switchgrass lines produced within BESC. This report supplies useful information when developing coordinated, large-scale, multi-institutional reverse genetic pipelines to improve crop traits.

Abstract Background Genetic engineering has been effective in altering cell walls for biofuel production in the bioenergy crop, switchgrass (Panicum virgatum). However, regulatory issues arising from gene flow may prevent commercialization of engineered switchgrass in the eastern United States where the species is native. Depending on its expression level, microRNA156 (miR156) can reduce, delay, or eliminate flowering, which may serve to decrease transgene flow. In this unique field study of transgenic switchgrass that was permitted to flower, two low (T14 and T35) and two medium (T27 and T37) miR156-overexpressing ‘Alamo’ lines with the transgene under the control of the constitutive maize (Zea mays) ubiquitin 1 promoter, along with nontransgenic control plants, were grown in eastern Tennessee over two seasons. Results miR156 expression was positively associated with decreased and delayed flowering in switchgrass. Line T27 did not flower during the 2-year study. Line T37 did flower, but not all plants produced panicles. Flowering was delayed in T37, resulting in 70.6% fewer flowers than controls during the second field year with commensurate decreased seed yield: 1205 seeds per plant vs. 18,539 produced by each control. These results are notable given that line T37 produced equivalent vegetative aboveground biomass to the controls. miR156 transcript abundance of field-grown plants was congruent with greenhouse results. The five miR156 SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) target genes had suppressed expression in one or more of the transgenic lines. Line T27, which had the highest miR156 overexpression, showed significant downregulation for all five SPL genes. On the contrary, line T35 had the lowest miR156 overexpression and had no significant change in any of the five SPL genes. Conclusions Because of the research field’s geographical features, this study was the first instance of any genetically engineered trait in switchgrass, in which experimental plants were allowed to flower in the field in the eastern U.S.; USDA-APHIS-BRS regulators allowed open flowering. We found that medium overexpression of miR156, e.g., line T37, resulted in delayed and reduced flowering accompanied by high biomass production. We propose that induced miR156 expression could be further developed as a transgenic switchgrass bioconfinement tool to enable eventual commercialization.

Abstract Background Genetically engineered biofuel crops, such as switchgrass (Panicum virgatum L.), that produce their own cell wall-digesting cellulase enzymes would reduce costs of cellulosic biofuel production. To date, non-bioenergy plant models have been used in nearly all studies assessing the synthesis and activity of plant-produced fungal and bacterial cellulases. One potential source for cellulolytic enzyme genes is herbivorous insects adapted to digest plant cell walls. Here we examine the potential of transgenic switchgrass-produced TcEG1 cellulase from Tribolium castaneum (red flour beetle). This enzyme, when overproduced in Escherichia coli and Saccharomyces cerevisiae, efficiently digests cellulose at optima of 50 °C and pH 12.0. Results TcEG1 that was produced in green transgenic switchgrass tissue had a range of endoglucanase activity of 0.16–0.05 units (µM glucose release/min/mg) at 50 °C and pH 12.0. TcEG1 activity from air-dried leaves was unchanged from that from green tissue, but when tissue was dried in a desiccant oven (46 °C), specific enzyme activity decreased by 60%. When transgenic biomass was “dropped-in” into an alkaline buffer (pH 12.0) and allowed to incubate at 50 °C, cellobiose release was increased up to 77% over non-transgenic biomass. Saccharification was increased in one transgenic event by 28%, which had a concurrent decrease in lignin content of 9%. Histological analysis revealed an increase in cell wall thickness with no change to cell area or perimeter. Transgenic plants produced more, albeit narrower, tillers with equivalent dry biomass as the control. Conclusions This work describes the first study in which an insect cellulase has been produced in transgenic plants; in this case, the dedicated bioenergy crop switchgrass. Switchgrass overexpressing the TcEG1 gene appeared to be morphologically similar to its non-transgenic control and produced equivalent dry biomass. Therefore, we propose TcEG1 transgenics could be bred with other transgenic germplasm (e.g., low-lignin lines) to yield new switchgrass with synergistically reduced recalcitrance to biofuel production. In addition, transgenes for other cell wall degrading enzymes may be stacked with TcEG1 in switchgrass to yield complementary cell wall digestion features and complete auto-hydrolysis.

Abstract Background Switchgrass is C4 perennial grass species that is being developed as a cellulosic bioenergy feedstock. It is wind-pollinated and considered to be an obligate outcrosser. Genetic engineering has been used to alter cell walls for more facile bioprocessing and biofuel yield. Gene flow from transgenic cultivars would likely be of regulatory concern. In this study we investigated pollen-mediated gene flow from transgenic to nontransgenic switchgrass in a 3-year field experiment performed in Oliver Springs, Tennessee, U.S.A. using a modified Nelder wheel design. The planted area (0.6 ha) contained sexually compatible pollen source and pollen receptor switchgrass plants. One hundred clonal switchgrass ‘Alamo’ plants transgenic for an orange-fluorescent protein (OFP) and hygromycin resistance were used as the pollen source; whole plants, including pollen, were orange-fluorescent. To assess pollen movement, pollen traps were placed at 10 m intervals from the pollen-source plot in the four cardinal directions extending to 20 m, 30 m, 30 m, and 100 m to the north, south, west, and east, respectively. To assess pollination rates, nontransgenic ‘Alamo 2’ switchgrass clones were planted in pairs adjacent to pollen traps. Results In the eastward direction there was a 98% decrease in OFP pollen grains from 10 to 100 m from the pollen-source plot (Poisson regression, F1,8 = 288.38, P < 0.0001). At the end of the second and third year, 1,820 F1 seeds were collected from pollen recipient-plots of which 962 (52.9%) germinated and analyzed for their transgenic status. Transgenic progeny production detected in each pollen-recipient plot decreased with increased distance from the edge of the transgenic plot (Poisson regression, F1,15 = 12.98, P < 0.003). The frequency of transgenic progeny detected in the eastward plots (the direction of the prevailing wind) ranged from 79.2% at 10 m to 9.3% at 100 m. Conclusions In these experiments we found transgenic pollen movement and hybridization rates to be inversely associated with distance. However, these data suggest pollen-mediated gene flow is likely to occur up to, at least, 100 m. This study gives baseline data useful to determine isolation distances and other management practices should transgenic switchgrass be grown commercially in relevant environments.

Abstract Background Panicum hallii Vasey (Hall’s panicgrass) is a compact, perennial C4 grass in the family Poaceae, which has potential to enable bioenergy research for switchgrass (Panicum virgatum L.). Unlike P. hallii, switchgrass has a large genome, allopolyploidy, self-incompatibility, a long life cycle, and large stature—all suboptimal traits for rapid genetics research. Herein we improved tissue culture methodologies for two inbred P. hallii populations: FIL2 and HAL2, to enable further development of P. hallii as a model C4 plant. Results The optimal seed-derived callus induction medium was determined to be Murashige and Skoog (MS) medium supplemented with 40 mg L−1 L-cysteine, 300 mg L−1 L-proline, 3% sucrose, 1 g L−1 casein hydrolysate, 3 mg L−1 2,4-dichlorophenoxyacetic acid (2,4-D), and 45 μg L−1 6-benzylaminopurine (BAP), which resulted in callus induction of 51 ± 29% for FIL2 and 81 ± 19% for HAL2. The optimal inflorescence-derived callus induction was observed on MP medium (MS medium supplemented with 2 g L−1 L-proline, 3% maltose, 5 mg L−1 2,4-D, and 500 μg L−1 BAP), resulting in callus induction of 100 ± 0.0% for FIL2 and 84 ± 2.4% for HAL2. Shoot regeneration rates of 11.5 ± 0.8 shoots/gram for FIL2 and 11.3 ± 0.6 shoots/gram for HAL2 were achieved using seed-induced callus, whereas shoot regeneration rates of 26.2 ± 2.6 shoots/gram for FIL2 and 29.3 ± 3.6 shoots/gram for HAL2 were achieved from inflorescence-induced callus. Further, cell suspension cultures of P. hallii were established from seed-derived callus, providing faster generation of callus tissue compared with culture using solidified media (1.41-fold increase for FIL2 and 3.00-fold increase for HAL2). Conclusions Aside from abbreviated tissue culture times from callus induction to plant regeneration for HAL2, we noted no apparent differences between FIL2 and HAL2 populations in tissue culture performance. For both populations, the cell suspension cultures outperformed tissue cultures on solidified media. Using the methods developed in this work, P. hallii callus was induced from seeds immediately after harvest in a shorter time and with higher frequencies than switchgrass. For clonal propagation, P. hallii callus was established from R1 inflorescences, similar to switchgrass, which further strengthens the potential of this plant as a C4 model for genetic studies. The rapid cycling (seed-to-seed time) and ease of culture, further demonstrate the potential utility of P. hallii as a C4 model plant.

Genetic engineering has been used to decrease the lignin content and to change the lignin composition of switchgrass (Panicum virgatum L.) to decrease cell wall recalcitrance to enable more efficient cellulosic biofuel production. Previous greenhouse and field studies showed that downregulation of the gene encoding switchgrass caffeic acid O-methyltransferase (COMT) and overexpression of the switchgrass PvMYB4 (MYB4) gene effectively improved ethanol yield. To understand potential environmental impacts of cultivating these transgenic bioenergy crops in the field, we quantified the effects of field cultivation of transgenic switchgrass on soil organic carbon (SOC) dynamics. Total and active SOC as well as soil respiration were measured in soils grown with two COMT-downregulated transgenic lines (COMT2 and COMT3), three MYB4-overexpressed transgenic lines (L1, L6, and L8), and their corresponding non-transgenic controls. No differences in total SOC, dissolved organic carbon (DOC), and permanganate oxidizable carbon (POXC) were detected between transgenic and non-transgenic treatments for both COMT (10.4–11.1 g kg−1 for SOC, 60.0–64.8 mg kg−1 for DOC, and 299–384 mg kg−1 for POXC) and MYB4 lines (6.89–8.21 g kg−1 for SOC, 56.0–61.1 mg kg−1 for DOC, and 177–199 mg kg−1 for POXC). Soil CO2-carbon (CO2-C) production from the COMT2 transgenic line was not significantly different from its non-transgenic control. In contrast, the COMT3 transgenic line had greater soil CO2-C production than its non-transgenic control (210 vs. 165 µg g−1) after 72 days of laboratory incubation. Combining the improvement in ethanol yield and biomass production reported in previous studies with negligible change in SOC and soil respiration, COMT2 could be a better biofuel feedstock than COMT3 for environmental conservation and cost-effective biofuel production. On the other hand, MYB4 transgenic line L8 produced more biomass and total ethanol per hectare while it released more CO2-C than the control (253 vs. 207 µg g−1). Long-term in situ monitoring of transgenic switchgrass systems using a suite of soil and environmental variables is needed to determine the sustainability of growing genetically modified bioenergy crops.

Advances in molecular biology including genomics, high-throughput sequencing, and genome editing enable increasingly faster and more precise cultivar development. Identifying genes and functional markers (FMs) that are highly associated with plant phenotypic variation is a grand challenge. Functional genomics approaches such as transcriptomics, targeting induced local lesions in genomes (TILLING), homologous recombinant (HR), association mapping, and allele mining are all strategies to identify FMs for breeding goals, such as agronomic traits and biotic and abiotic stress resistance. The advantage of FMs over other markers used in plant breeding is the close genomic association of an FM with a phenotype. Thereby, FMs may facilitate the direct selection of genes associated with phenotypic traits, which serves to increase selection efficiencies to develop varieties. Herein, we review the latest methods in FM development and how FMs are being used in precision breeding for agronomic and quality traits as well as in breeding for biotic and abiotic stress resistance using marker assisted selection (MAS) methods. In summary, this article describes the use of FMs in breeding for development of elite crop cultivars to enhance global food security goals.

Switchgrass (Panicum virgatum L.) is a leading lignocellulosic bioenergy feedstock. Cellulose is a major component of the plant cell walls and the primary substrate for saccharification. Accessibility of cellulose to enzymatic breakdown into fermentable sugars is limited by the presence of lignin in the plant cell wall. In this study, putatively novel switchgrass secondary cell wall cellulose synthase PvCesA4 and primary cell wall PvCesA6 genes were identified and their functional role in cellulose synthesis and cell wall composition was examined by overexpression and knockdown of the individual genes in switchgrass. The endogenous expression of PvCesA4 and PvCesA6 genes varied among including roots, leaves, stem, and reproductive tissues. Increasing or decreasing PvCesA4 and PvCesA6 expression to extreme levels in the transgenic lines resulted in decreased biomass production. PvCesA6-overexpressing lines had reduced lignin content and syringyl/guaiacyl lignin monomer ratio accompanied by increased sugar release efficiency, suggesting an impact of PvCesA6 expression levels on lignin biosynthesis. Cellulose content and cellulose crystallinity were decreased, while xylan content was increased in PvCesA4 and PvCesA6 overexpression or knockdown lines. The increase in xylan content suggests that the amount of non-cellulosic cell wall polysaccharide was modified in these plants. Taken together, the results show that the manipulation of the cellulose synthase genes alters the cell wall composition and availability of cellulose as a bioprocessing substrate.

Conyza bonariensis (hairy fleabane) is one of the most problematic and widespread glyphosate-resistant weeds in the world. This highly competitive weed species significantly interferes with crop growth and substantially decreases crop yield. Despite its agricultural importance, the molecular mechanisms of glyphosate resistance are still unknown. The present RNA-Seq study was performed with the goal of identifying differentially expressed candidate transcripts (genes) related to metabolism-based non-target site glyphosate resistance in C. bonariensis. The whole-transcriptome was de novo assembled from glyphosate-resistant and -sensitive biotypes of C. bonariensis from Southern Brazil. The RNA was extracted from untreated and glyphosate-treated plants at several timepoints up to 288 h after treatment in both biotypes. The transcriptome assembly produced 90,124 contigs with an average length of 777 bp and N50 of 1118 bp. In response to glyphosate treatment, differential gene expression analysis was performed on glyphosate-resistant and -sensitive biotypes. A total of 9622 genes were differentially expressed as a response to glyphosate treatment in both biotypes, 4297 (44.6%) being up- and 5325 (55.4%) down-regulated. The resistant biotype presented 1770 up- and 2333 down-regulated genes while the sensitive biotype had 2335 and 2800 up- and down-regulated genes, respectively. Among them, 974 up- and 1290 down-regulated genes were co-expressed in both biotypes. In the present work, we identified 41 new candidate target genes from five families related to herbicide transport and metabolism: 19 ABC transporters, 10 CYP450s, one glutathione S-transferase (GST), five glycosyltransferases (GT), and six genes related to antioxidant enzyme catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD). The candidate genes may participate in metabolic-based glyphosate resistance via oxidation, conjugation, transport, and degradation, plus antioxidation. One or more of these genes might ‘rescue’ resistant plants from irreversible damage after glyphosate treatment. The 41 target genes we report in the present study may inform further functional genomics studies, including gene editing approaches to elucidate glyphosate-resistance mechanisms in C. bonariensis.

The antioxidant defense system acts to maintain the equilibrium between the production of reactive oxygen species (ROS) and the elimination of toxic levels of ROS in plants. Overproduction and accumulation of ROS results in metabolic disorders and can lead to the oxidative destruction of the cell. Several stress factors cause ROS overproduction and trigger oxidative stress in crops and weeds. Recently, the involvement of the antioxidant system in weed interference and herbicide treatment in crops and weeds has been the subject of investigation. In this review, we address ROS production and plant mechanisms of defense, alterations in the antioxidant system at transcriptional and enzymatic levels in crops induced by weed interference, and herbicide exposure in crops and weeds. We also describe the mechanisms of action in herbicides that lead to ROS generation in target plants. Lastly, we discuss the relations between antioxidant systems and weed biology and evolution, as well as the interactive effects of herbicide treatment on these factors.

Following publication of the original article [1], the authors reported that the omission of author name.

Phytosensors are plants that are genetically engineered for sensing and reporting the presence of a specific contaminant, including agriculturally important biological agents. Phytosensors are constructed by transforming plants to contain specific biotic- or abiotic-inducible promoters fused to a reporter gene. When such transgenic plants encounter the target biotic or abiotic agent, the specific inducible promoter is triggered and subsequently drives the expression of the reporter gene, which produces a signal for detection. However, several systems lack robustness, rapid induction and promoter strength. Here, we tested the FLP/FRT recombination system in a construct containing a two gene cassette organization and examined its potential in transgenic Arabidopsis and tobacco plants using a b-glucuronidase (GUS) reporter. In this model system, a heat-shock inducible promoter was employed to control the expression of the FLP recombinase gene. Upon heat induction and subsequent active FLP-mediated excision event, the GUS gene was placed in close proximity to the 35S promoter resulting in an active GUS reporter expression. Our results demonstrate that the two gene cassette scheme of inducible FLP/FRT recombination system is functional in tobacco and Arabidopsis, providing additional insights into its possible application in phytosensing such as creating strong readout capabilities.

Real-time systems that provide evidence of pathogen contamination in crops can be an important new line of early defense in agricultural centers. Plants possess defense mechanisms to protect against pathogen attack. Inducible plant defense is controlled by signal transduction pathways, inducible promoters and cis-regulatory elements corresponding to key genes involved in defense, and pathogen-specific responses. Identified inducible promoters and cis-acting elements could be utilized in plant sentinels, or ‘phytosensors’, by fusing these to reporter genes to produce plants with altered phenotypes in response to the presence of pathogens. Here, we have employed cis-acting elements from promoter regions of pathogen inducible genes as well as those responsive to the plant defense signal molecules salicylic acid, jasmonic acid, and ethylene. Synthetic promoters were constructed by combining various regulatory elements supplemented with the enhancer elements from the Cauliflower mosaic virus (CaMV) 35S promoter to increase basal level of the GUS expression. The inducibility of each synthetic promoter was first assessed in transient expression assays using Arabidopsis thaliana protoplasts and then examined for efficacy in stably transgenic Arabidopsis and tobacco plants. Histochemical and fluorometric GUS expression analyses showed that both transgenic Arabidopsis and tobacco plants responded to elicitor and phytohormone treatments with increased GUS expression when compared to untreated plants. Pathogen-inducible phytosensor studies were initiated by analyzing the sensitivity of the synthetic promoters against virus infection. Transgenic tobacco plants infected with Alfalfa mosaic virus showed an increase in GUS expression when compared to mock-inoculated control plants, whereas Tobacco mosaic virus infection caused no changes in GUS expression. Further research, using these transgenic plants against a range of different pathogens with the regulation of detectable reporter gene could provide biological evidence to define the functional differences between pathogens, and provide new technology and applications for transgenic plants as phytosensors.

One usually thinks of plant biology as a non-controversial topic, but the concerns raised over the biosafety of genetically modified (GM) plants have reached disproportionate levels relative to the actual risks. While the technology of changing the genome of plants has been gradually refined and increasingly implemented, the commercialization of GM crops has exploded. Today’s commercialized transgenic plants have been produced using Agrobacterium tumefaciens-mediated transformation or gene gun-mediated transformation. Recently, incremental improvements of biotechnologies, such as the use of green fluorescent protein (GFP) as a selectable marker, have been developed. Non-transformation genetic modification technologies such as chimeraplasty will be increasingly used to more precisely modify germplasm. In spite of the increasing knowledge about genetic modification of plants, concerns over ecological and food biosafety have escalated beyond scientific rationality. While several risks associated with GM crops and foods have been identified, the popular press, spurred by colorful protest groups, has left the general public with a sense of imminent danger. Reviewed here are the risks that are currently under research. Ecological biosafety research has identified potential risks associated with certain crop/transgene combinations, such as intra- and interspecific transgene flow, persistence and the consequences of transgenes in unintended hosts. Resistance management strategies for insect resistance transgenes and non-target effects of these genes have also been studied. Food biosafety research has focused on transgenic product toxicity and allergenicity. However, an estimated 3.5′ 1012 transgenic plants have been grown in the U.S. in the past 12 years, with over two trillion being grown in 1999 and 2000 alone. These large numbers and the absence of any negative reports of compromised biosafety indicate that genetic modification by biotechnology poses no immediate or significant risks and that resulting food products from GM crops are as safe as foods from conventional varieties. We are increasingly convinced that scientists have a duty to conduct objective research and to effectively communicate the results—especially those pertaining to the relative risks and potential benefits—to scientists first and then to the public. All stakeholders in the technology need more effective dialogues to better understand risks and benefits of adopting or not adopting agricultural biotechnologies.

Green fluorescent protein (GFP) is increasingly being used in plant biology from the cellular level to whole plant level. At the cellular level, GFP is being used as an in vivo reporter to assess frequency of transient and stable transformation. GFP has also proven to be an invaluable tool in monitoring trafficking and subcellular localization of protein. At the organ level and up, many exciting applications are rapidly emerging. The development of brighter GFP mutants with more robust folding properties has enabled better macroscopic visualization of GFP in whole leaves and plants. One interesting example has been the use of GFP to monitor virus movement in and among whole plants. GFP is also emerging as a powerful tool to monitor transgene movement and transgenic plants in the field. In a proof-of-concept study, tobacco was transformed with a modified version of the GFP gene controlled by a constitutive (35S) promoter. GFP expression in progeny plants ranged from 0% to 0.5%, and approximately 0.1% GFP was the minimal amount needed for unambiguous macroscopic detection. GFP is the first truly in vivo reporter system useful in whole plants, and we project its usefulness will increase even further as better forms of GFP genes become available.