Search

Background Endothelial damage has been described in antiphospholipid antibody (aPL)-positive patients. However, it is uncertain whether circulating endothelial cells (CECs)—which are released when endothelial injury occurs—can be a marker of patients at high risk for thrombosis. Methods Ninety-seven patients with aPL and/or systemic lupus erythematosus (SLE) were included. CECs were determined by an automated CellSearch system. We also assayed plasma levels of tissue factor-bearing extracellular vesicles (TF+/EVs) and soluble triggering receptor expressed on myeloid cells 1 (sTREM-1) as markers of endothelial dysfunction/damage. Results Patients' mean age was 46.1 ± 13.9 years, 77 were women. Thirty-seven had SLE and 75 patients were suffering from antiphospholipid syndrome. Thirty-seven percent of patients presented a medical history of arterial thrombosis and 46% a history of venous thromboembolism (VTE). Thirteen patients had increased levels of CECs (>20/mL), with a mean CEC level of 48.3 ± 21.3 per mL. In univariate analysis, patients with obesity or medical history of myocardial infarction (MI), VTE, or nephropathy had a significant increased CEC level. In multivariate analysis, obesity (odds ratio [OR] = 6.07, 95% confidence interval [CI]: 1.42–25.94), VTE (OR = 7.59 [95% CI: 1.38–41.66]), and MI (OR = 5.5 [95% CI: 1.1–26.6)] were independently and significantly associated with elevated CECs. We also identified significant correlations between CECs and other markers of endothelial dysfunction: sTREM-1 and TF+/EVs. Conclusion This study demonstrated that endothelial injury assessed by the levels of CECs was associated with thromboembolic events in patients with aPL and/or autoimmune diseases.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

Estrogens act through nuclear and membrane-initiated signaling. Estrogen receptor alpha (ERα) is critical for reproduction, but the relative contribution of its nuclear and membrane signaling is unclear. To address this question, we used two complementary approaches: estetrol (E4) a natural estrogen described to act as an agonist of nuclear ERα and a mERα antagonist and the C451A-ERα mouse lacking mERα. E4dose-dependently blocks ovulation in female rats, but the mechanism underlying this effect is unknown. To determine whether E4acts centrally to control ovulation, we tested its effect on the positive feedback of estradiol (E2) on LH secretion. In ovariectomized females chronically exposed to a low dose of E2, estradiol benzoate (EB) alone or combined with progesterone (P) induced a LH surge and the associated increase in the number of activated kisspeptin (Kp) and gonadotropin-releasing hormone (GnRH) neurons. However, E4blocked these effects of EB when provided alone, but not when combined to P. These results indicate that E4blocked the induction of the positive feedback and the associated neuronal activation in the absence of P, suggesting an antagonistic effect of E4on mERα as shown in peripheral tissues. In parallel, C451A-ERα females do not show a pre-ovulatory LH surge and the associated activation of Kp and GnRH neurons in response to EB unless they are treated with P. The similarity of the responses of C451A-ERα mice and wild-type females treated with E4 supports a role for membrane-initiated estrogen signaling in the EB-induced LH surge.

While population density can change the overall water demand of a neighborhood, socioeconomic shifts can change the temporal distribution of daily peak demands. This study seeks to determine the comparative criticality of the impacts of both types of population dynamics on the operations of a water system—as measured by pressure. This study specifically assesses scenarios of gentrification, associated with increases in higher-income populations and density changes. Researchers carried out hydraulic simulations of gentrification scenarios using an existing water system in a gentrifying U.S. city. The results indicate that in gentrifying cities such as Portland and Minneapolis, the impact of the socioeconomic shifts may be negligible when compared that of density changes. In gentrifying cities such as Washington D.C. and Atlanta, however, socioeconomic shifts cannot be overlooked. Given the complexity of population dynamics such as gentrification, we recommend decision-makers to carefully assess these dynamics to enhance urban resilience.

Prognosis of hepatoblastoma patients has increased with cisplatin-based chemotherapy and high-quality resection including liver transplant. Consequently current risk-adapted therapeutic strategy aims to reduce long-term side effects in patients with standard risk disease. We report long-term mortality and morbidity data concerning 151 2-year hepatoblastoma survivors treated with SIOPEL risk-adapted strategies (sex-ratio M/F = 1.6, median age at diagnosis = 2.6 years [range 0–17.7], median year at diagnosis = 2008 [1994–2017]). Fifty-three patients had loco-regional risk factors VPEFR, 12 were PRETEXT-IV and 30 were metastatic. All received cisplatin and 84 anthracyclines. Twelve had liver transplant. To assess hearing, renal and cardiac functions, audiograms were performed in 116/151 patients (76.8%), glomerular filtration rate in 113/151 (74.8%) and cardiac ultrasound in 65/84 (77.4%) anthracycline-exposed patients. With a median follow-up of 9.4 years (range 2.1–25.8), four late relapses, one second malignancy (Acute Myeloid Leukemia AML-M5) and two deaths (one from hepatoblastoma, one from AML) occurred. The 10-years event free survival and overall survival probabilities were 95.5% (95% CI 91.9–99.1) and 98.7% (95% CI 96.8–100), respectively. Sixty-eight non-oncologic health-events included 57 cases of hearing loss (including 25 Brock 3–4), three liver cirrhosis, three pre-operative portal cavernoma, two focal nodular hyperplasia, two grade-1 chronic kidney diseases and one asymptomatic cardiac dysfunction were reported. Ototoxicity was significantly associated with cisplatin cumulative dose (OR = 2.07, 95% CI 1.32–3.24, p = 0.001) and carboplatin exposure (OR = 3.14, 95% CI 1.30–7.58, p = 0.01) in multivariable analysis adjusted for sex and age at diagnosis. With current risk-adapted strategies, hepatoblastoma is a highly curable disease, with very rare relapses, and few late effects except hearing loss which remains a serious condition in these very young patients.

The binding of 17β-oestradiol to oestrogen receptor alpha (ERα) plays a crucial role in the control of reproduction, acting through both nuclear and membrane-initiated signalling. To study the physiological role of membrane ERα in the reproductive system, we used the C451A-ERα mouse model with selective loss of function of membrane ERα. Despite C451A-ERα mice being described as sterile, daily weighing and ultrasound imaging revealed that homozygous females do become pregnant, allowing the investigation of the role of ERα during pregnancy for the first time. All neonatal deaths of the mutant offspring mice resulted from delayed parturition associated with failure in pre-term progesterone withdrawal. Moreover, pregnant C451A-ERα females exhibited partial intrauterine embryo arrest at about E9.5. The observed embryonic lethality resulted from altered expansion of Tpbpa-positive spiral artery-associated trophoblast giant cells into the utero-placental unit, which is associated with an imbalance in expression of angiogenic factors. Together, these processes control the trophoblast-mediated spiral arterial remodelling. Hence, loss of membrane ERα within maternal tissues clearly alters the activity of invasive trophoblast cells during placentogenesis. This previously unreported function of membrane ERα could open new avenues towards a better understanding of human pregnancy-associated pathologies.

Study question To evaluate the association between sleep parameters, sleep disorders and idiopathic infertility. Summary answer Some sleep parameters, such as bedtime, sleep latency and chronotypes, might be associated with male and female fertility. What is known already Some studies suggested that sleep might play an important role in reproductive health. Short sleep duration might interfere with the menstrual cycle, sperm parameters or natural fertility. The biological clock chronotype was found to be associated with fertility, with altered sperm parameters in the “evening” type and more reproductive troubles in the “intermediate” type when compared to the “morning” type. Irregular and night work schedules were also associated with some degree of fertility dysfunction, such as irregular menstrual cycles, a longer time to pregnancy, or male infertility. However, the interrelations between sleep and fertility are not fully elucidated. Study design, size, duration Fertile and infertile couples were recruited in the ALIFERT cross-sectional case–control multicentric study, between September 2009 and December 2013. The study group consisted of 94 infertile men and 95 infertile women, presenting with a primary idiopathic infertility of more than 12 months. The control group consisted in 85 fertile men and 86 fertile women who had a spontaneously conceived child under 2 years of age with a time to pregnancy less than 12 months. Participants/materials, setting, methods Male and female participants answered the French version of the Pittsburgh Sleep Quality Index, including questions about sleep timing and duration and symptoms of sleep disorders. Sleep parameters were compared between infertile and fertile participants for each sex, and between partners. The Wilcoxon-Mann-Whitney test was used to compare differences in sleep parameters due to a non-normal distribution, and the Fisher's exact test was used for qualitative variables. Main results and the role of chance Bedtime was significantly later for infertile compared to fertile male participants (p = 0.03). Infertile female participants had significantly later wake time, greater sleep latency and sleep apnea symptoms compared to fertile female participants (p ≤ 0.02). Fertile participants of both sexes were more frequently moderate morning types compared to infertile participants (p ≤ 0.04). No differences were observed regarding total sleep time, time spent in bed, sleep efficacy, insomnia, hypersomnia, or periodic leg movement symptoms. Infertile couples had more frequently different chronotypes than fertile couples (p = 0.02). Differences in wake time between partners were significantly greater among infertile couples (p Limitations, reasons for caution Sleep parameters were evaluated based on self-reported questionnaire. Further studies including objective measures of sleep will be needed to allow a more objective determination of sleep parameters. A discussion about mechanistic hypothesis should also be considered to better understand the links between sleep and fertility. Wider implications of the findings Sleep could be an original and innovative parameter to consider in the reproduction field. Further investigation is needed to elucidate how sleep and reproductive functions are interrelated and how sleep might constitute a useful modifiable target in infertility management. Trial registration number NCT01093378

In recent years, the global health community has been increasingly reporting the problem of ‘invisibility’ as aspects of health and wellbeing that are often overlooked and ignored, and predominantly affects the most marginalized and precarious people. However, it is unclear how to realistically manage global health invisibility and move forward. In this letter, we reflect on several case studies of invisibility experienced by people in Brazil, Malaysia, West Africa and other transnational contexts. Highlighting the complex nature of invisibility and its interconnectedness with social, political and economic issues and trends, we argue that while local and targeted interventions might provide relief and comfort locally, they will not be able to solve the underlying causes of invisibility. Moving forward, we argue that in dealing with an intersectional issue such as invisibility, twenty-first century global health bioethics could pursue a more ‘disturbing’ framework, challenging the narrow comforting solutions and sociomaterial inequalities of the sociopolitical status quo. We highlight that comforting and disturbing bioethical frameworks should not be considered as opposing sides, but as two approaches working in tandem in order to achieve the internationally set global health milestones of providing better health and wellbeing for everyone. In doing so, we call for taking seriously insights from sociology, anthropology, postcolonial studies, history, feminist studies and other styles of critical reasoning that have long been disturbing the grand assumptions about people and their conditions, and, practically, to rediscover the ethos of the WHO Alma Ata Declaration, calling for cooperation and support beyond the narrow market logic that dominates the landscape of contemporary global health.

Riassunto I tumori della regione pineale sono rari e possono essere osservati a qualsiasi eta, anche se sono piu frequenti nei bambini. Si distinguono principalmente tre gruppi istologici: i tumori del parenchima pineale (TPP) (25-30%), che raggruppano il pinealocitoma, il pinealoblastoma e i TPP di differenziazione intermedia di gradi II e III, i tumori germinali (30%), che comprendono il germinoma e i tumori germinali non germinomatosi, e i tumori gliali (astrocitomi pilocitici, ependimomi, tumori papillari). La diagnosi si basa sulla risonanza magnetica encefalica e panmidollare, che precisa la posizione e un’eventuale disseminazione spinale. Questo esame e sistematicamente completato da un dosaggio nel sangue e nel liquido cerebrospinale dei marcatori tumorali (betaormone corionico gonadotropico [β-hCG], alfafetoproteina), il cui aumento segnala un tumore germinale secernente e citologico alla ricerca di cellule tumorali. Dopo la conferma della diagnosi istologica (in assenza di prove indirette) mediante biopsia durante una ventricolocisternostomia endoscopica o stereotattica, il trattamento si basa sull’exeresi chirurgica piu completa possibile e/o sulla chemioradioterapia in funzione della natura del tumore. Di solito, nei TPP e nelle lesioni gliali, il trattamento e dapprima chirurgico (pinealocitoma, astrocitoma pilocitico, tumori papillari), talvolta completato da una radioterapia (TPP intermedi, tumori papillari, ependimomi) o, anche, da una radiochemioterapia (pinealoblastoma). Nei tumori germinali, e spesso proposta la chemioterapia seguita da una radioterapia con, eventualmente, un intervento chirurgico tra le due sequenze terapeutiche. La prognosi e eccellente in pinealocitoma, germinoma puro, teratoma e astrocitoma pilocitico, ma molto piu variabile negli altri tipi istologici. A volte sono possibili recidive tardive, giustificando un monitoraggio prolungato.

The incidence of intracranial germ cell tumors (iGCT) is much lower in European and North American (E&NA) than in Asian population. However, E&NA cooperative groups have simultaneously developed with success treatment strategies with specific attention paid to long-term sequelae. Neurological sequelae may be reduced by establishing a diagnosis with an endoscopic biopsy and/or cerebrospinal fluid (CSF) and/or serum analysis, deferring the need to perform a radical surgery. Depending on markers and/or histological characteristics, patients are treated as either germinoma or non-germinomatous germ cell tumors (NGGCT). Metastatic disease is defined by a positive CSF cytology and/or distant drops in craniospinal MRI. The combination of surgery and/or chemotherapy and radiation therapy is tailored according to grouping and staging. With more than 90% 5-year event-free survival (EFS), localized germinomas can be managed without aggressive surgery, and benefit from chemotherapy followed by whole ventricular irradiation with local boost. Bifocal germinomas are treated as non-metastatic entities. Metastatic germinomas may be cured with craniospinal irradiation. With a 5-year EFS over 70%, NGGCT benefit from chemotherapy followed by delayed surgery in case of residual disease, and some form of radiotherapy. Future strategies will aim at decreasing long-term side effects while preserving high cure rates.

Carrot virome analysis using high-throughput sequencing revealed the presence of two RNA molecules with properties of satellite RNAs that are homologous to the satellite RNA of cereal yellow dwarf virus-RPV (CYDV-RPV). Satellite 1 is 298 nt long, while satellite 2 is 368 nt long. Their positive and negative genome strands contain hammerhead ribozymes similar to those found in other self-cleaving satellite RNAs. While both satellites were detected in Spanish carrot populations, only satellite 2 was found in French carrot populations. The most likely helper virus for these two satellites is carrot red leaf virus (CtRLV), which, like CYDV-RPV, is a polerovirus.

Background: Genomic research is expanding at an exponential pace across the globe and increased access to genome analysis has led to greater generations of genetic results with specific relevance to individuals. This study aims to explore preferences and expectations of feedback of individually relevant genetic research results among parents of children with neurodevelopmental conditions. Methods: Following a qualitative approach, we conducted four deliberative focus group discussions with (n=27) South African parents of children involved in genomics research on neurodevelopmental disorders. Results: Most participants expressed a strong interest in receiving genetic results regardless of severity, actionability and preventability. These results were viewed as valuable because they could empower or emancipate individuals, families, and communities. Receiving risk information was also believed to motivate healthier lifestyle choices. However, some participants were uncertain or articulated a desire not to receive results due to fears of anxiety or psychological distress. In addition, participants expected to receive results as a demonstration of respect from researchers and articulated it as an act to build trust between researchers and participants. Conclusions: Internationally, a debate continues around whether individually relevant genetic results should or should not be fed back to participants of genomic research studies. In Africa, there is scant literature which has investigated this question and no policies to guide researchers. This study provides a basis of empirical data on perspectives of African participants which could inform work on the development of a consolidated approach to the feedback of genetic research results in the continent.

Esophageal atresias/tracheoesophageal fistulas (EA/TEF) are rare congenital anomalies caused by aberrant development of the foregut. Previous studies indicate that rare or de novo genetic variants significantly contribute to EA/TEF risk, and most individuals with EA/TEF do not have pathogenic genetic variants in established risk genes. To identify novel genetic contributions to EA/TEF, we performed whole genome sequencing of 185 trios (probands and parents) with EA/TEF, including 59 isolated and 126 complex cases with additional congenital anomalies and/or neurodevelopmental disorders. There was a significant burden of protein altering de novo coding variants in complex cases (p=3.3e-4), especially in genes that are intolerant of loss of function variants in the population. We performed simulation analysis of pathway enrichment based on background mutation rate and identified a number of pathways related to endocytosis and intracellular trafficking that as a group have a significant burden of protein altering de novo variants. We assessed 18 variants for disease causality using CRISPR-Cas9 mutagenesis in Xenopus and confirmed 13 with tracheoesophageal phenotypes. Our results implicate disruption of endosome-mediated epithelial remodeling as a potential mechanism of foregut developmental defects. This research may have implications for the mechanisms of other rare congenital anomalies.

BACKGROUND: Citrulline (CIT), is not extracted by the splanchnic area, can stimulate muscle protein synthesis and could potentially find clinical applications in conditions involving low amino acid (AA) intake, such as in malnourished older subjects. OBJECTIVE: Our purpose was to research the effects of CIT supplementation on protein metabolism in particular on non-oxidative leucine disposal (NOLD, primary endpoint), and splanchnic extraction of amino acids in malnourished older patients. DESIGN: This prospective randomized multicenter study determined whole-body and liver protein synthesis, splanchnic protein metabolism and appendicular skeletal muscle mass (ASMM) in 24 malnourished older patients [80-92 years; 18 women and 6 men] in inpatient rehabilitation units. All received an oral dose of 10 g of CIT or an equimolar mixture of six non-essential amino acids (NEAAs), as isonitrogenous placebo, for 3 weeks. RESULTS: NOLD and albumin fractional synthesis rates were not different between the NEAA and CIT groups. Splanchnic extraction of dietary amino acid tended to decrease (p = 0.09) in the CIT group (45.2%) compared with the NEAA group (60.3%). Total differences in AA and NEAA area under the curves between fed-state and postabsorptive-state were significantly higher in the CIT than in the NEAA group. There were no significant differences for body mass index, fat mass (FM), lean mass (LM) or ASMM in the whole population except for a tendential decrease in FM for the citrulline group (p = 0.089). Compared with Day 1, lean mass and ASMM significantly increased (respectively p = 0.016 and p = 0.018) at Day 20 in CIT-treated women (mean respective increase of 1.7 kg and 1.1 kg), and fat mass significantly decreased (p = 0.001) at Day 20 in CIT-group women (mean decrease of 1.3 kg). CONCLUSIONS: Our results demonstrate that CIT supplementation has no effect on whole-body protein synthesis or liver protein synthesis in malnourished older subjects. However, CIT supplementation was associated with a higher systemic AA availability. In the subgroup of women, CIT supplementation increased LM and ASMM, and decreased FM.

Since 2005, 12 months of trastuzumab added to chemotherapy alone is the standard of care in patients with HER2-positive breast cancer. PHARE ('Protocol for Herceptin® as Adjuvant therapy with Reduced Exposure') is the first trial comparing a reduction of adjuvant trastuzumab versus the standard 12 months. In 2012, the first analysis failed to prove that 6-months was non-inferior to 12-months of adjuvant trastuzumab (NCT00381901). The current presentation reports the final analysis. Methods: The trial was sponsored by the French National Cancer Institute (INCa) (www.e-cancer.fr), and approved by central Ethical Committee on May 15th 2006. Patients with HER2-positive early breast cancer were randomly assigned between 12 and 6 months of adjuvant trastuzumab duration. The randomization was stratified by concomitant or sequential trastuzumab administration with chemotherapy, estrogen receptor (ER) status and center. The primary objective was non-inferiority of 6- versus 12-months arms in the intent to treat population, in terms of disease-free survival (DFS) with a pre-specified hazard margin of 1.15. Overall Survival (OS) and metastasis free survival (MFS) were secondary endpoints. Results: A total of 3380 patients were randomized, their median age was 54 years (21-86). Patients and disease characteristics were well balanced between the two arms. No involved axillary node was observed in 54.5% of cases, 41.7% of tumors were ER negative. At a median follow-up of 7.5 years, 704 events counting for DFS were observed. Between the 12- and 6-months arms, the adjusted Hazard Ratio (HR) for DFS rates was 1.08 (95%CI: 0.93-1.25; p=0.39) favoring the longer exposure. The 1.15 margin of non-inferiority was included in the 95%CI. No heterogeneity in terms of treatment effect was observed, no significant difference for trastuzumab duration effects was found in any subgroups.For OS and MFS, the adjusted HR were 1.13 (95%CI 0.92-1.39) and 1.15 (95%CI 0.96-1.37), respectively. Conclusion: The choice of the non-inferiority margin will remain inherently a subject of controversy especially in the context of oncology trials where the primary outcome is survival and the least additional death could be considered unacceptable questioning the very feasibility of such trials. Nevertheless, PHARE failed to show that 6 months of adjuvant trastuzumab was non-inferior to 12 months. The standard of care should remain 12 months of adjuvant trastuzumab. Citation Format: Pivot X, Romieu G, Debled M, Pierga J-Y, Kerbrat P, Bachelot T, Espie M, Lortholary A, Fumoleau P, Serin D, Jacquin J-P, Jouannaud C, Rios M, Abadie-Lacourtoisie S, Venat-Bouvet L, Cany L, Catala S, Khayat D, Gambotti L, Pauporte I, Faure Mercier C, Paget-Bailly S, Henriques J, Grouin J-M. PHARE randomized trial final results comparing 6 to 12 months of trastuzumab in adjuvant early breast cancer [abstract]. In: Proceedings of the 2018 San Antonio Breast Cancer Symposium; 2018 Dec 4-8; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2019;79(4 Suppl):Abstract nr GS2-07.

Objectifs L’etude aUROre vise a decrire les caracteristiques et la prise en charge de patients atteints de cancer renal avance ou metastatique non prealablement traite, en fonction de l’expression de PD-L1. Dans ce cadre, une etude exploratoire de concordance inter-observateur de l’evaluation du statut PD-L1 a ete realisee sur une cohorte de 250 patients selectionnes dans la base de donnees clinico-biologique nationale du reseau UroCCR ( http ://www.uroccr.fr ). Methodes A partir du tissu tumoral colore avec l’anticorps PD-L1 SP142, trois pathologistes–dont deux formateurs dans l’evaluation PD-L1, ci-apres « experts » – ont determine independamment le statut PD-L1 (pourcentage de surface occupee par des cellules immunitaires exprimant PD-L1 – seuil de positivite ≥ 1 %). Une phase d’evaluation a porte sur 60 cas, suivie d’une 2e phase sur 190 cas apres concertation entre les pathologistes. Les objectifs sont de mesurer la concordance du statut PD-L1 entre pathologistes sur les 190 cas (coefficients de Kappa [+ 95 % IC]) et d’evaluer l’impact de la concertation a la fin de la 1ere phase sur le taux de concordance de la 2e. Resultats Sur les 190 cas, 179 sont consideres evaluables par les 3 pathologistes ( Tableau 1 ). Une concordance parfaite entre les 3 pathologistes est observee pour 123 cas (68,7 % ; Kappa de Fleiss de 0,58 [0,49–0,67], Tableau 2 ). La concordance est plus elevee entre les 2 experts (88,3 %, Kappa de Cohen de 0,77 [0,67–0,86]) qu’entre ceux de niveaux de formation differents (73,2 % [0,47 (0,35–0,59)] et 76,0 % [0,52 (0,41–0,64)]). La comparaison avec les 60 premiers cas (57 evaluables) montre une nette amelioration de la concordance sur le statut PD-L1 (+35,0 %), et du coefficient de concordance (+123 % [0,26 (0,09–0,43), Kappa de Fleiss]). Cette amelioration est plus elevee entre pathologistes de niveaux de formations differents (+236 % [0,14 (0,02–0,26)] et +77 % [0,30 (0,08–0,52)]) qu’entre les 2 experts (+45 % [0,53 (0,33–0,72)]). Conclusion La concordance inter-observateur est moderee a elevee (Landis, 1977 ; Fleiss, 1981) et croit avec le niveau de formation des pathologistes. Une nette amelioration est observee apres concertation entre pathologistes, particulierement pour le moins entraines. Ces resultats confortent la necessite de formations adaptees et du partage d’experience entre anatomopathologistes pour l’interpretation optimale du statut PD-L1 dans les echantillons tumoraux.

BackgroundGenomic medicine is expanding at an exponential pace across the globe and increased access to genome analysis has led to greater generations of genetic results with specific relevance to individuals. AimThis study aims to explore preferences and expectations of feedback of individual genetic research results among parents of children with neurodevelopmental conditions. MethodsFollowing a qualitative approach, we conducted four deliberative focus group discussions with (n=27) South African parents of children involved in genomics research on neurodevelopmental conditions. ResultsMost participants expressed a strong interest in receiving individual genetic results regardless of severity, actionability and preventability. These results were viewed as valuable because they could empower or emancipate individuals, families and communities. Receiving risk information was also believed to motivate healthier lifestyle choices. However, some participants were uncertain or articulated a desire not to receive results due to fears of anxiety or psychological harm. In addition, participants expected to receive results as a demonstration of respect from researchers and articulated it as an act to build trust between researchers and participants. ConclusionsInternationally, a debate continues around whether individual genetic results should or should not be fed back to participants of research studies. In Africa, there is scant literature which has investigated this question and no policies to guide researchers. This study provides a basis of empirical data on perspectives of African participants which could inform work on the development of a consolidated approach to the feedback of incidental findings in the continent.

Sudden population influxes into cities&mdash, such as those seen during post-disaster migration&mdash, place unexpected demands on the urban housing system. Decisions made during these influxes are often controversial, potentially hindering the ability of the organizations involved to respond. This study&rsquo, s objective was to explore strategies (e.g., types of information shared and types of accommodation chosen) that can be used during decision-making processes when providing emergency accommodations to increase stakeholder acceptance, and thus lead to sustainable institutional responses. This study specifically sought to shed light on how, during the Refugee Crisis in Germany of 2015 and 2016, stakeholders legitimized decisions made to provide centralized emergency accommodations to displaced persons. Making this study possible were 25 semi-structured interviews with utility, government, nonprofit, and company employees involved in the provision of centralized accommodations for displaced persons. Interviews were conducted in 2016 and underwent a qualitative analysis. Results indicate that stakeholders primarily legitimized the provision of centralized accommodations based on convictions of right and wrong (moral legitimacy), while they legitimized decisions to not provide such accommodations based on their understanding and experience of practical barriers (cultural-cognitive legitimacy). Recommendations arising from this study include the following: provide information to stakeholders about accommodations&rsquo, livability (to gain consequential legitimacy) and past successes (to gain comprehensibility legitimacy), adapt regulations to help stakeholders use procedural legitimacy, and prefer fully renovated buildings or modular housing to buildings with no major renovations or container housing (to gain consequential rather than procedural legitimacy).

This abstract was withdrawn by the authors.

Summary Introduction Immediate breast reconstruction (IBR) improves the quality of life of patients who undergo mastectomy. The latissimus dorsi flap (LDF) method provides particularly good aesthetic results, but its tolerance to subsequent radiotherapy remains unclear. We thus sought to assess tolerance and esthetic results and satisfaction, as reported by patients who underwent IBR by LDF with or without subsequent radiotherapy. Materials and methods We performed a retrospective case–control study in a population of women who were diagnosed with breast cancer between January 1999 and January 2014 and who had mastectomies with IBR by LDF without prostheses. We paired 29 patients who needed postoperative radiotherapy to 58 control patients who did not. These patients responded to a questionnaire to evaluate tolerance and their satisfaction with the aesthetic results of the reconstruction. Results In total, 86.2% of all patients reported "very good" or "good" overall aesthetic satisfaction. Consistency was judged as "very good" or "good" by 82.7% of control patients and by 93.1% of case patients. No statistically significant differences were identified between the two groups with regard to reconstruction results. The number of surgical procedures needed did not differ significantly between the two groups. Conclusion In our study, IBR by LDF appeared to have excellent tolerance to subsequent radiotherapy, the latter having no impact on patient aesthetic satisfaction. Our results suggest that the possibility of postoperative radiotherapy should not prevent physicians from proposing this method to women who are candidates for it.

Actinomycosis is a rare bacterial disease caused by Actinomyces spp., an anaerobic bacteria from the oropharynx, digestive, and female genital tracts. Initial clinical presentation often mimics malignancy, which can lead to a delay in diagnosis. Cervico-facial, genitourinary, digestive, and respiratory features are the most frequent. Few cases are reported in children and risk factors are not well known in this population. We report on the case of an 8-year-old boy with disseminated actinomycosis with cervico-facial, pulmonary, and bone involvement caused by Actinomyces israelii. The infiltrative appearance initially suggested malignancy and the patient was started on chemotherapy for presumed histiocytosis. Evaluation of subsequent tissue samples demonstrated the presence of filamentous structures consistent with fungal or filamentous bacterial infection. Prolonged culture yielded the correct diagnosis. The patient had a severe allergic reaction to piperacillin/tazobactam and was therefore transitioned to clindamycin to complete a 9-month course. This treatment, which has not been reported in children, led to a favorable clinical, biological, and radiological response, with a good clinical tolerance.

Los efectos secundarios oculares de los farmacos, que suelen ser bilaterales, a menudo se pasan por alto debido a que a menudo son benignos, aunque pueden ser graves. Se pueden afectar todas las estructuras oculares. Los efectos iatrogenicos oftalmologicos, incluso leves como la sequedad ocular, no deben pasarse por alto, porque suelen ser invalidantes y pueden causar un mal cumplimiento terapeutico. Los efectos secundarios oftalmologicos suelen identificarse bien y, en la mayoria de los casos, una vigilancia estrecha permite casi siempre reducir el riesgo de afectacion funcional y conservar una funcion visual optima. Las declaraciones de farmacovigilancia son fundamentales, debido al gran incremento del arsenal terapeutico, para aumentar permanentemente nuestros conocimientos. La gravedad y la posible irreversibilidad de las retinopatias y neuropatias toxicas, a menudo asintomaticas en un primer tiempo, requieren una formacion e informacion adecuadas de los prescriptores, de los oftalmologos y de los pacientes. Realizar una revision exhaustiva de los efectos secundarios de los farmacos sistemicos es dificil. En este articulo, se presentan las principales clases terapeuticas en funcion del nivel de su afectacion.

Background Women who have experienced childhood trauma may be at risk for postpartum depression, increasing the likelihood of negative outcomes among their children. Predictive pathways from maternal childhood trauma to child outcomes, as mediated by postpartum depression, require investigation. Methods A longitudinal sample of South African women (N=150) was followed through pregnancy and postpartum. Measures included maternal trauma history reported during pregnancy; postpartum depression through six months; and maternal-infant bonding, infant development, and infant physical growth at one year. Structural equation models tested postpartum depression as a mediator between maternal experiences of childhood trauma and children’s outcomes. A subset of women (N=33) also participated in a lab-based emotional Stroop paradigm, and their responses to fearful stimuli at six weeks were explored as a potential mechanism linking maternal childhood trauma, postpartum depression, and child outcomes. Results Women with childhood trauma experienced greater depressive symptoms through six months postpartum, which then predicted negative child outcomes at one year. Mediating effects of postpartum depression were significant, and persisted for maternal-infant bonding and infant growth after controlling for covariates and antenatal distress. Maternal avoidance of fearful stimuli emerged as a potential affective mechanism. Limitations Limitations included modest sample size, self-report measures, and unmeasured potential confounders. Conclusions Findings suggest a mediating role of postpartum depression in the intergenerational transmission of negative outcomes. Perinatal interventions that address maternal trauma histories and depression, as well as underlying affective mechanisms, may help interrupt cycles of disadvantage, particularly in high-trauma settings such as South Africa.

En el varon, los tumores de los organos genitales estan representados sobre todo por los tumores testiculares o paratesticulares y los tumores vesicoprostaticos. En la nina, se trata esencialmente de tumores del ovario y mas raramente de tumores vaginales o cervicouterinos. Las principales entidades histologicas de los tumores malignos de localizacion genital en el nino y el adolescente, observados en ambos sexos, son los tumores germinales, los tumores de los cordones sexuales y los rabdomiosarcomas. Los carcinomas son raros en el nino, al contrario que en la poblacion adulta, pero se pueden encontrar carcinomas ovaricos en periodo pospuberal. Los tumores benignos estan representados esencialmente por los teratomas maduros, los tumores epiteliales benignos del ovario y algunos tumores benignos paratesticulares. El objetivo de un tratamiento adecuado es anticipar la naturaleza de la lesion antes de la intervencion quirurgica. Los elementos clinicos (cuadro «endocrino» con virilizacion o seudopubertad precoz), biologicos (elevacion de los marcadores tumorales) o radiologicos permiten orientar el tratamiento. Ante la duda, la lesion siempre debe considerarse como maligna hasta que se demuestre lo contrario, y la reseccion quirurgica debe obedecer a reglas carcinologicas. Ante un tumor manifiestamente benigno, puede considerarse una tumorectomia. En caso de un tumor maligno, el tratamiento depende de la resecabilidad de la lesion. Solo debe realizarse una cirugia inicial si es posible la exeresis sin sacrificar otros organos ademas de los inicialmente afectados. Por lo tanto, el tratamiento quirurgico nunca debe comportar cirugia mutilante (castracion, histerectomia, etc.) de entrada, porque la mayoria de las histologias malignas son quimiosensibles, lo cual permite realizar secundariamente un acto lo mas conservador posible, sobre todo respecto a la fertilidad.

Background Half of the patient treated with neoadjuvant chemotherapy (NAC) for a large operable breast cancer has no axillary lymph node involvement at the time of surgery. Sentinel lymph node detection (SLND), after NAC, is aimed to select patient who should be safely spared of an axillary lymphadenectomy (ALND).GANEA 2 is a French prospective multi institutional trial, aimed to assess SLND after NAC. Objective To assess the risk of relapse for patients without previous axillary node involvement treated with NAC followed with a SLND without a systematic lymphadenectomy. Patients and Method Inclusion: FIGO stage T1-T3 infiltrating breast carcinoma, indication of NAC. Exclusion: inflammatory cancer, local relapse, contra-indication to NAC, NAC interrupted due to progressive disease. Design: indication to plan a NAC, axillary sonography with fine needle cytology before NAC to select patients without lymph node involvement, SLND after NAC. ALND was mandatory in case of SLN involvement (macro or micro-metastasis) or SLND failure. Follow-up was scheduled with a medical visit / 6 months with axillary assessment and a mammography each year. Follow-up results are updated every 6 months. Pathological analysis were carried out according to standard methods and classified according to the last American Joint Committee staging system. Studied parameters were SLND detection rate, pathological results on breast specimen and nodes, rate of relapse (axilla, breast, metastasis), and survival. Results From July 2010 to February 2014, 587 patients were enrolled, from 17 institutions, and experienced breast tumor surgery and a SLND after NAC. Each patient experienced breast surgery. A breast tumour pathological complete response was found in 21.3% (125/587). SLND rate was 97% (570/587), with a median number of 2 sentinel nodes (1-9). Patients with a sentinel detection failure (n=17) experienced a systematic lymphadenectomy, without any involvement (n=13), a micro-metastasis (n=2) and a macro-metastasis (n=2). A total of 140 patients had at least one sentinel node involved: macro-metastasis (n=86), micro-metastasis (n=54). A lymphadenectomy was performed in 128 cases: metastasis free (n=100), macro-metastasis (n=17), micro-metastasis (n=11). A total of 430 patients had a SLN metastasis free (75% ;430/570). A not mandatory lymphadenectomy was performed (n=14): metastasis free (n=11), macro-metastasis (n=2) and micro-metastasis (n=1). 17 patients were lost to follow-up. A total of 399 patients without sentinel node involvement were followed 2.3 years (from 0.5 to 5.6 yrs). At 3 years overall survival was 97.8% [94.9-99.1], disease free survival was 94.8% [91.0-97.1%]. Six patients died. Fifteen patients experienced a relapse: 8 metastasis, 4 homolateral breast, 2 controlateral breast, 1 homolateral axillary relapse. Conclusion This is the most important series of patients followed 2.3 years after SLND without axillary lymphadenectomy after NAC for an advanced breast cancer, showing acceptable results. The current series validate the safety of this conservative strategies avoiding systematic lymphadenectomy to patients without initially involved axillary node treated with NAC. Citation Format: Classe J-M, Loaec C, Alran S, Paillocher N, Tunon-Lara C, Gimbergues P, Faure-Virelizier C, Chauvet M-P, Lasry S, Dupre P-F, Verhaeghe J-L, De Blaye P, Gutowski M, Barranger E, Lecuru F, Lefevre Lacoeuille C, Loussert L, Lambaudie E, Ferron G, Campion L. Sentinel node detection after neoadjuvant chemotherapy in patient without previous axillary node involvement (GANEA 2 trial): Follow-up of a prospective multi-institutional cohort [abstract]. In: Proceedings of the 2016 San Antonio Breast Cancer Symposium; 2016 Dec 6-10; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2017;77(4 Suppl):Abstract nr S2-07.