Search

ilustraciones, fotografías Objetivo: El objetivo de esta investigación fue evaluar el impacto de variantes patogénicas en la ARN Polimerasa III subunidad A (POLR3A) sobre la retención de intrones y la expresión relativa del ARN corto nuclear U6 y de diferentes isoformas de p53 en fibroblastos derivados de pacientes con Síndrome de Wiedemann-Rautenstrauch (SWR). Metodología: Se realizó un cultivo primario de fibroblastos de dos pacientes con Síndrome de Wiedemann-Rautenstrauch (SWR) y de un control sano. Se extrajo el ARN de los fibroblastos por medio de TRIzol. A partir del ARN extraído se midió la expresión de 6 isoformas de p53, del ARN corto nuclear U6 y de genes relacionados con la senescencia celular por medio de RT-PCR. Adicionalmente se realizó un secuenciamiento global de ARN mensajero (RNA-Seq) y se analizó la retención de intrones utilizando el programa IRFinder. Resultados y conclusiones: En el análisis de retención de intrones no se encontraron diferencias marcadas en el porcentaje de retención de intrones (control: 7.8%, WRS1: 6.3% y WRS2: 8.14%). Los genes con mayor retención de intrones están relacionados principalmente con vías relacionadas con la unión al ARN, la regulación del ciclo celular, regulación positiva de la transcripción, regulación positiva de vías relacionadas con la inflamación, regulación negativa de la apoptosis, transcripción del ARN, mitocondria y regulación del inicio de la traducción. Los genes con mayor retención de intrones en los pacientes se relacionan con la respuesta inmune y la función mitocondrial, mientras que los que retuvieron más intrones en el control se relacionan con la respuesta al estrés oxidativo. La paciente WRS1 mostró una mayor expresión de ARN corto nuclear U6 comparada con el control y con la paciente WRS2. Los fibroblastos de las pacientes con SWR expresaron un mayor porcentaje de p53 y un menor porcentaje de 133p53 concordante con una mayor expresión de los marcadores de senescencia celular p16 y p21. Estos resultados resaltan la importancia de la función de la ARN polimerasa III en el mantenimiento de la homeostasis celular, principalmente en los procesos de empalme y de reparación del ADN. (Texto tomado de la fuente) Aim: The aim of this study was to evaluate the impact of pathogenic variants in RNA Polymerase III subunit A (POLR3A) on intron retention and on the relative expression of the short nuclear RNA U6 and of different p53 isoforms in fibroblasts derived from patients with Wiedemann-Rautenstrauch Syndrome (WRS). Methods: Primary culture of fibroblasts from two patients with Wiedemann-Rautenstrauch Syndrome (WWS) and a healthy control was performed. RNA was extracted from fibroblasts using TRIzol. The expression of six p53 isoforms, the short nuclear RNA U6 and genes related to cell senescence were measured by RT-PCR. Additionally, global mRNA sequencing (RNA-Seq) was performed, and intron retention was analyzed using IRFinder. Results and conclusions: In the intron retention analysis, no significant differences were found in the percentage of intron retention (control: 7.8%, WRS1: 6.3% and WRS2: 8.14%). The genes with more intron retention are mainly related to pathways related to RNA binding, cell cycle regulation, positive regulation of transcription, positive regulation of pathways related to inflammation, negative regulation of apoptosis, RNA transcription, mitochondria, and regulation of translation initiation. The genes with more intron retention in WRS patients are related to the immune response and mitochondrial function, while those with more retained introns in the control are related to the response to oxidative stress. Patient WRS1 showed a higher expression of short nuclear RNA U6 compared to control and patient WRS2. Fibroblasts from patients with WRS express a higher percentage of p53 and a lower percentage of 133p53, consistent with a higher expression of the cellular senescence markers p16 and p21. These results highlight the importance of an adequate function of RNA polymerase III in the maintenance of cellular homeostasis, mainly in the splicing and DNA repair processes. Maestría Magíster en Genética Humana 4.1 Tipo de estudio Estudio experimental llevado a cabo en fibroblastos obtenidos de dos pacientes con Síndrome de Wiedemann-Rautenstrauch y un control sano. 4.2 Descripción de las pacientes La paciente WRS1 es una paciente de sexo femenino de 21 años de edad, natural y procedente de Bogotá, con fenotipo concordante con el Síndrome de Wiedemann-Rautenstrauch y con hallazgo de una variante patogénica heredada de la madre en el gen POLR3A (c. 3772_2773delCT; p.Leu1258Glyfs*12). Esta variante está clasificada como una variante patogénica debido a que cumple con los criterios de patogenicidad de las guías del Colegio Americano de Genética Médica (ACMG): PVS1, PP5 y PM2, y no cumple con ningún criterio de benignidad. La paciente WRS2 es una paciente de sexo femenino de 6 años de edad, natural y procedente de Bogotá, con fenotipo concordante con el Síndrome de Wiedemann-Rautenstrauch y con hallazgo de una variante patogénica heredada del padre en el gen POLR3A (c.3G>T; p.Met1Leu*). Esta variante está clasificada como una variante patogénica debido a que cumple con los criterios de patogenicidad de las guías del ACMG: PVS1, PP5 y PM2, y no cumple con ningún criterio de benignidad. El control es una persona sana de sexo femenino de 21 años de edad. 4.3 Obtención de fibroblastos Previo consentimiento informado se tomó una biopsia de piel de la parte interna del brazo de dos pacientes femeninas con Síndrome de Wiedemann-Rautenstrauch en la primera y en la tercera década de la vida y de un control sano. Para obtener la muestra se desinfectó el área con alcohol al 70% y se extrajó un fragmento de piel de la zona deseada usando el punch y las pinzas de disección, luego se suturó la herida con un punto. Posteriormente, la muestra recogida fue colocada en un tubo falcon de 15 mL con 12 mL de medio suplementado previamente atemperado a 37°C. Después, en la cabina de flujo, se retiró el medio en el cual se encontraba la biopsia y se realizaron tres lavados con PBS 1X al 1% de penicilina/estreptomicina estéril con movimientos rotatorios y se descartó el sobrenadante. Luego, en una caja de Petri de 100 mm se añadieron 3 mL de PBS 1X, 3 mL de medio suplementado y el fragmento de piel. Una vez sumergida, la muestra se fragmentó en 12 a 18 trozos con una hoja de bisturí anclado a un mango adecuado. Una vez ya obtenidos los fragmentos, se retiró cuidadosamente el medio circundante y se agregaron 3 mL de tripsina-EDTA al 0.25% y se dejó incubando durante 5 minutos a 37°C. Posteriormente, se inactivó la tripsina con 10 mL de medio suplementado en un tubo falcon de 15 mL. Se centrifugó el contenido del tubo a 1000 rpm durante tres minutos, se descartó el sobrenadante y se resuspendió en 8 mL de medio suplementado fresco. El contenido del tubo falcon fue dividido en dos partes iguales y transferido a dos frascos T25 que se dejaron incubando a 37°C y 5% de CO2. Se cambió el medio cada 24 horas aproximadamente. Los fibroblastos alcanzaron un porcentaje de confluencia cercano al 70% a los 25-30 días. 4.4 Extracción de ARN Alrededor de 30 días después de la obtención de la biopsia, una vez las células alcanzaron un porcentaje alto de confluencia, se extrajo el ARN con TRIzol para los análisis posteriores. Las células fueron lisadas usando el reactivo TRIzol durante 5-10 minutos, con el objetivo de permitir la disociación completa de los complejos de nucleoproteína. Después se pasó el lisado celular a un eppendorf de 1.5 mL, se centrifugó a 14mil rpm durante diez minutos y se transfirió el sobrenadante a un tubo nuevo. Luego se agregaron 200 µL de cloroformo por cada mL de reactivo TRIzol y se agitó vigorosamente a mano durante 15 segundos. Posteriormente, se dejó incubando a temperatura ambiente durante 10 minutos y se centrifugó a 12mil gravedades durante 15 minutos a 4 grados Celsius. Después de la centrifugación, la fase acuosa, que contiene el ARN se transfirió a un tubo nuevo y el ARN se precipitó agregando 500 µL de alcohol isopropílico. Las muestras se dejaron incubando a temperatura ambiente durante 10 minutos y se centrifugaron a 12 mil gravedades durante 10 minutos a 4 grados Celsius. Después se removió el sobrenadante y se lavó el pellet de ARN con 1 mL de etanol al 75% en agua DEPC mezclando con vórtex. Luego, se centrifugó a 7500 gravedades durante 8 minutos a 4 grados Celsius, se removió el sobrenadante y se secó el ARN durante 5 minutos. Una vez seco, el ARN fue disuelto en 50 µL de agua DEPC. Las muestras fueron cuantificadas usando NanoDrop. Este proceso se realizó por triplicado. 4.5 Análisis de expresión global de ARN (RNA-Seq) El ARN extraído fue llevado a secuenciación de nueva generación de ARNs con secuencia de poliA utilizando un equipo Illumina. Los datos del RNA-Seq fueron entregados en formato FASTA y con las secuencias de adaptadores eliminadas. Las secuencias fueron alineadas usando STAR aligner v27.0a, utilizando como genoma de referencia y como genoma de anotación la secuencia del genoma humano GRCh38. Una vez concluido el proceso de alineación, se obtuvieron los archivos BAM unsorted, luego estos archivos fueron subidos al programa IRFinder, en dónde se obtuvieron los resultados de la medición retención de intrones global en archivos de texto, como la proporción de retención de intrones, que es igual a la abundancia de intrones sobre la abundancia de intrones más exones (Middleton, et al., 2017). Luego se realizó el análisis diferencial de la retención de intrones en DESeq2 en una interfaz R, siguiendo las instrucciones del manual de IRFinder. Después se analizaron las vías metabólicas en las que participan los genes con una retención de intrones diferencial utilizando las bases de datos de ontología genética y KEGG (Zheng, et al., 2020), utilizando DAVID. 4.6 Medición de la expresión relativa del ARN corto nuclear U6, de las diferentes isoformas de p53 y de otros genes relacionados con el empalme o la senescencia celular El ARN extraído y previamente cuantificado fue utilizado para realizar síntesis de ADN complementario mediante un proceso de transcripción reversa utilizando el kit Superscript III de Invitrogen. Se agregó el volumen equivalente a 5 µg de ARN en un tubo de PCR (reacción en cadena de la polimerasa) libre de ARNasas y luego se añadieron los otros componentes de la mezcla para alcanzar una concentración final de 10 M de primers de hexámeros al azar, 0.5 mM de deoxinucleotidos trifosfato (dNTPs), 1X de buffer, 0.5 UI de transcriptasa reversa, 40 UI de RNase OUT y se completó el volumen con agua DEPC hasta alcanzar 10 µL. La mezcla se dejó incubando a temperatura ambiente durante 5 minutos. En el termociclador se inició con un periodo de 2 minutos a 94 grados Celsius, con el objetivo de alcanzar la denaturación completa del ARN y después se realizaron 40 ciclos de denaturación (94 grados Celsius durante 45 segundos), anillaje (60 grados Celsius durante 30 segundos) y extensión (72 grados Celsius durante 40 segundos), finalmente se dejó incubando la muestra a 4 grados Celsius. El ADN complementario obtenido fue cuantificado usando NanoDrop. Una vez obtenido el ADN complementario se midió la expresión relativa de las isoformas de p53, de U2AF1, p16, p21, GSTM1 y del ARN corto nuclear U6 usando los primers nombrados en la tabla 2. Para la cuantificación de la expresión de GSTM1, p16, p21 y U2AF1 se usó como gen control el de la gliceraldehído-3-fosfato-deshidrogenasa (GAPDH), en el caso del ARN corto nuclear U6, se usó el gen de ARN corto nuclear U48 (RNU48) y en el caso de las isoformas de p53 se utilizó como gen de referencia el de la beta-actina. Tabla 2 Primers utilizados para medir la expresión relativa del ARN corto nuclear U6, de las diferentes isoformas de p53 y de genes relacionados con el empalme y la senescencia celular. ARN corto nuclear U6 Primer Forward 5’-CAGCACATATACTAAAATTGGAACG-3’ Primer Reverse 5’-ACGAATTTGCGTGTCATCC-3’ Gen control: ARN corto nuclear U48 Primer Forward 5′-TGATGATGACCCCAGGTAACTC-3′ Primer Reverse 5′-GAGCGCTGCGGTGATG-3 Isoformas de p53 Primer Forward (e2.1-exón 2) 5’ -GTCACTGCCATGGAGGAGCCGCA-3’ Primer Forward (e2-exón 2) 5’- ATGGAGGAGCCGCAGTCAGAT-3’ Primer Forward (i4FI-intrón 4) 5’- TAGACGCCAACTCTCTCTAG -3’ Primer Forward (i4F2–intrón 4) 5’- CTAGTGGGTTGCAGGAGGTGCTTACAC-3’ Primer Reverse (RT1-exón 11) 5’- GACGCACACCTATTGCAAGCAAGGGTTC -3’ Primer Reverse (RT2-exón 11) 5’- ATGTCAGTCTGAGTCAGGCCCTTCTGTC -3’ Primer Reverse (p53b-exón 9b) 5’- TTTGAAAGCTGGTCTGGTCCTGA-3’ Primer Reverse (p53g-exón 9g) 5’- TCGTAAGTCAAGTAGCATCTGAAGG-3’ Gen control: actina Primer Forward 5’-ATCTGGCACCACACCTTCTACAATGAGCTGCG-3’ Primer Reverse 5’-CGTCATACTCCTGCTTGCTGATCCACATCTGC-3’ Glutatión-S-Transferasa 1 (GSTM1) Primer Forward 5’- TACTCTGAGCCCTGCTCGGT-3 Primer Reverse 5’- TGTATTCCAGGAGCAGGCGG-3’ p16 Primer Forward 5'-CCAACGCACCGAATAGTTACG-3' Primer Reverse 5'-GCGCTGCCCATCATCATG-3' p21 Primer Forward 5'-TGGAGACTCTCAGGGTCGAAA-3' Primer Reverse 5'-AGATGGTGATGGGCTTCCC-3' U2AF1 (Factor auxiliar del ARN corto nuclear U2 tipo 1) Primer Forward 5’- CCAGTCTGCTGACGGTTTG-3 Primer Reverse 5’- AGGTGGTCTCCCAGGTTGT-3 Gen control: gliceraldehído-3-fosfato-deshidrogenasa (GAPDH) Primer Forward 5’- TGGTATCGTGGAAGGACTCA-3´ Primer Reverse 5’-CCAGTAGAGGCAGGGATGAT-3´ Para medir la expresión relativa del ARN corto nuclear U6, de GSTM1, de U2AF1, de p16 y de p21, se realizó una PCR en tiempo real en el CFX96 Touch Real-Time PCR Detection System (BioRad) midiendo la fluorescencia utilizando SYBR-Green y realizando 48 ciclos de denaturación, anilaje y extensión. El análisis de los resultados se realizó siguiendo el método Ct. Para medir la expresión relativa de las isoformas de p53 se realizó una PCR anidada utilizando el ADN complementario obtenido y realizando las reacciones establecidas en la Tabla 3. El análisis de los resultados se realizó siguiendo el método Ct. Tabla 3 Primers específicos utilizados en cada reacción de PCR anidada para medir la expresión relativa de 6 isoformas de p53. Adaptado de: Khoury, M. P., Marcel, V., Fernandes, K., Diot, A., Lane, D. P., & Bourdon, J. C. (2013). Detecting and quantifying p53 isoforms at mRNA level in cell lines and tissues. In p53 Protocols (pp. 1-14). Humana Press, Totowa, NJ. 4.7 Verificación del análisis de retención de intrones Para la verificación del análisis de retención de intrones se realizó una electroforesis en un gel de agarosa al 2% de los productos de PCR utilizando los primers descritos en la Tabla 4. Tabla 4 Primers utilizados para la verificación del análisis de retención de intrones PILRB (Receptor beta tipo 2 tipo inmunoglobulina emparejado) Primer Forward 5-‘ ATCCCCTGTTAGAGACGGGC-3’ Primer Reverse 5’- GAACTCAGGCATAGGGGAGC-3’ K7EP35 (NADH Deshidrogenasa 1 Alfa Subunidad 11) Primer Forward 5’-CCTGTCTGCTGTGATTCAGG-3’ Primer Reverse 5’-GGAGGTTGCAGTGAGCTGAG-3’ Glutatión-S-Transferasa 1 (GSTM1) Primer Forward 5’-TTAGGCCTGTCTGCGGAATC-3’ Primer Reverse 5’-GAGATGGAGGGTCCCTGACT-3’ OAS1 (2'-5'-oligoadenilato sintetasa 1) Primer Forward 5’-CCTCCAGCTGCAACCATG-3’ Primer Reverse 5’-GTCTGCTTCCTAGCCATCTG-3’ Síndromes progeroides

Universidad Nacional Agraria La Molina. Escuela de Posgrado. Doctorado en Ciencia Animal El objetivo de la investigación fue la identificación de polimorfismos de nucleótido simple (PNSs) y su asociación con el diámetro de fibra en alpacas Huacaya. En una primera etapa se genotipificaron muestras de ADN de 40 alpacas Huacaya utilizando una micromatriz de 777,962 PNSs diseñada para bovinos (BovineHD Genotyping Beadchip, Illumina). El análisis de datos incluyó el uso de combinaciones de los parámetros umbral de no determinación (≥ 0.05, ≥ 0.15 y ≥ 0.25) y frecuencia de genotipificación (≥ 0.9 y = 1.0); también se consideraron la puntuación “GenCall” (GC) promedio (≥ 0.70) y la puntuación “GenTrain” (≥ 0.25). Los PNSs con frecuencia alélica menor (FAM) ≥ 0.05 o ≥ 0.01 fueron conservados. Todas las secuencias flanqueantes de PNSs positivos con alineaciones perfectas entre los genomas bovino y de alpaca para los primeros 21 o 26 nucleótidos que flanquean el nucleótido variante en ambos lados fueron seleccionados. Los PNSs localizados en un único andamio fueron considerados únicos. Los PNSs únicos identificados en ambos genomas de referencia se conservaron y mapearon en el genoma de Vicugna_pacos-2.0.2. El uso del umbral de no determinación ≥ 0.25, frecuencia de genotipificación = 1 y puntuación GC promedio ≥ 0.7 resultó en el menor número de PNSs identificados (6,756 PNSs), de los cuales 400 eran únicos y polimórficos (FAM ≥ 0.01). La asignación a los cromosomas de alpaca fue posible para 292 PNSs. Asimismo, 209 PNSs se localizaron en 202 loci de genes de alpaca. En una segunda etapa se colectaron muestras de ADN de 881 alpacas Huacaya hembras de color blanco procedentes de dos regiones geográficas andinas, considerando tres rebaños de alpacas dentro de cada región. Las muestras se genotipificaron utilizando una micromatriz de 76,508 PNSs, diseñada para alpacas (Affymetrix Custom Alpaca genotyping array). Se desarrollaron dos controles de calidad utilizando los programas Axiom Analysis Suite v.4.0.3.3 y PLINK v1.90p. Se realizaron cuatro métodos de estudio de asociación del genoma completo (GWAS, por sus siglas en inglés): (i) GWAS basado en un modelo lineal, (ii) Análisis de haplotipos y marcadores, (iii) GWAS con descomposición de autovectores (EigenGWAS) y (iv) Señales de selección basadas en homocigosidad de haplotipo extendido entre poblaciones (XP-EHH, por sus siglas en inglés). Después del primer control de calidad, se conservaron 861 muestras y 69,685 PNSs. Luego del segundo control de calidad, se retuvo un total de 61,814 PNSs, ubicados en 1,838 andamios. De14 acuerdo con cada método se identificaron: (i) 39 PNSs no significativos con p-value menor a 1 x 10-4, (ii) once haplotipos con una heredabilidad estandarizada superior a 6 desviaciones estándar, (iii) 50 PNSs con p-value corregido menor a 8.09 x 10-7, (iv) 217 PNSs con valores estandarizados de XP-EHH superiores a |3|. Se identificaron 337 PNSs distribuidos en 149 regiones, de las cuales 53 regiones se encuentran formadas por dos o más PNSs separados a una distancia máxima de 500 kbp. Las anotaciones Gene Ontology (GO) de estos genes incluyeron la morfogénesis del folículo piloso (BCL2, SOSTDC1, WNT10A), el desarrollo del folículo piloso (EDA, TNFRSF19, WNT10A) y el desarrollo de la piel (ABCB6, EDA, WNT10A). Cuatro regiones candidatas con PNSs adyacentes identificados por dos métodos se ubicaron en los cromosomas VPA2, VPA5, VPA18 y VPA26. PNSs significativos localizados en los cromosomas VPA5, VPA18 y VPA27 fueron localizados dentro o cercano a genes reportados en cabras para características de fibra, y podrían ser considerados como PNSs candidatos. Este es el primer estudio de asociación del genoma completo con el diámetro de fibra en alpacas Huacaya, utilizando una micromatriz de PNSs diseñada para alpacas. The aim of the research was the identification of single nucleotide polymorphisms (SNPs) and their association with fiber diameter in Huacaya alpacas. In a first stage, DNA samples from 40 Huacaya alpacas were genotyped using a 777,962 SNPs microarray designed for cattle (BovineHD Genotyping Beadchip, Illumina). The data analysis included the use of combinations of the threshold parameters of no-call threshold (≥0.05, ≥0.15, and ≥0.25) and call frequency (≥0.9 and =1.0); Average GenCall (GC) score (≥0.70) and GenTrain score (≥0.25) were also considered. SNPs with minor allele frequency (MAF) ≥ 0.05 or ≥ 0.01 were retained. All positive SNP flanking sequences showing perfect alignments between the bovine and alpaca genomes for the first 21 or 26 nucleotides flanking the variant nucleotide at either side were selected. Only SNPs localized in one scaffold were assumed unique. Unique SNPs identified in both reference genomes were kept and mapped on the Vicugna_pacos-2.0.2 genome. The use of the no-call threshold ≥ 0.25, call frequency = 1 and average GC score ≥ 0.7 resulted in the lowest number of SNPs identified (6,756 SNPs), of which 400 were unique and polymorphic (MAF ≥ 0.01). Assignment to alpaca chromosomes was possible for 292 SNPs. Likewise, 209 SNPs were localized in 202 alpaca gene loci. In a second stage, DNA samples were collected from 881 female Huacaya alpacas from two geographical Andean regions, considering three herds of alpacas within each region. The samples were genotyped using a microarray of 76,508 SNPs, designed for alpacas (Affymetrix Custom Alpaca genotyping array). Two quality controls were developed using Axiom Analysis Suite v.4.0.3.3 and PLINK v1.90p. Four genome wide association study (GWAS) methods were performed: (i) GWAS based on a linear model, (ii) Haplotype and marker analysis, (iii) GWAS with eigenvector decomposition (EigenGWAS) and (iv) Selection signatures based on Cross Population Extended Haplotype Homozygosity (XP-EHH). After the first quality control, 861 samples and 69,685 SNPs were selected. After the second quality control, a total of 61,814 SNPs, localized on 1,838 scaffolds, were retained. According to each method: (i) 39 not significant SNPs with p-value less than 1 x 10-4, (ii) eleven haplotypes with standardized haplotype heritability higher than 6 standard deviations, (iii) 50 SNPs with corrected p-value less than 8.09 x 10-7, (iv) 217 SNPs with standardized XP-EHH values greater than |3|, were identified. A set of 337 SNPs distributed16 in 149 regions were identified, of which 53 regions are formed by two or more SNPs separated at a maximum distance of 500 kbp. Gene Ontology (GO) annotations of these genes included hair follicle morphogenesis (BCL2, SOSTDC1, WNT10A), hair follicle development (EDA, TNFRSF19, WNT10A) and skin development (ABCB6, EDA, WNT10A). Four candidate regions with adjacent SNPs identified by two methods were located on chromosomes VPA2, VPA5, VPA18 and VPA26. Significant SNPs localized on chromosomes VPA5, VPA18 and VPA27 were localized within o close to genes reported in goats for fiber traits, and could be considered candidate SNPs. This study represents the first alpaca genome wide association study for fiber diameter in Huacaya alpacas, using a SNP microarray designed for alpacas.

The hypothalamus is implicated in controlling feeding and adiposity, besides many other physiological functions, and thus can be of great importance in explaining productive differences between lean and fatty pig breeds. The present study aimed to evaluate the hypothalamic transcriptome of pure Iberian (IBxIB) and Large White x Iberian crossbreds (IBxLW) at 60 days-old, produced in a single maternal environment. Results showed the implication of gender and genotype in the hypothalamic transcriptome, with 51 differentially expressed genes (DEGs) between genotypes and 10 DEGs between genders. Fourteen genotype by sex interactions were found, due to a higher genotype effect on transcriptome found in males. In fact, just 31 DEGs were identified when using only females but 158 using only males. A higher expression of genes related to mitochondrial activity in IBxIB male animals (ND3, ND4, ND5, UQCRC2 and ATP6) was found, which was related to a higher oxidative phosphorylation and greater reactive oxygen species and nitric oxide production. IBxLW male animals showed higher expression of SIRT3 regulator, also related to mitochondrial function. When females were analysed, such differences were not found, since only some differences in genes related to the tricarboxylic acid cycle. Thus, the results indicate a significant effect and interaction of the breed and the sex on the hypothalamic transcriptome at this early age.

[spa] La palma aceitera (Elaeis guineensis Jacq.), a nivel mundial, es uno de los cultivos de aceite más importantes, uno de los de más alto rendimiento, y segundo más consumido. Una de las principales limitantes de la producción de palma es la enfermedad conocida como pudrición de cogollo (PC). En Ecuador se registró por primera vez en 1974, en la ciudad de Santo Domingo, luego de lo cual se extendió hacia las laderas amazónicas, generando un efecto devastador que resultó en la pérdida de un alto porcentaje de las palmas. Los cultivos de palma se localizan principalmente en la región costa, siendo la provincia de Esmeraldas la que concentra el 44.37% (109405 ha) de las 246574 ha plantadas y que presenta un mayor área de cultivos afectada por PC (82948 ha) de acuerdo al último censo palmero en 2017. El Centro de Investigación en Palma de Aceite (Cenipalma), en la búsqueda del agente causal de la PC en Colombia, identificó a Phytophthora palmivora en plantaciones de palma al norte de Colombia, sin embargo, en Ecuador no existen estudios que confirmen este hallazgo. En este trabajo de investigación se identifican los microorganismos potencialmente patógenos presentes en tejidos del primer y segundo estadio de PC de cultivos de palma aceitera del cantón Quinindé de la provincia de Esmeraldas. Para la identificación se emplearon técnicas dependientes de cultivo, barcoding y secuenciación de alto rendimiento (HTS). Se realizaron pruebas de patogenicidad con los microorganismos potencialmente patógenos. Adicionalmente, como posible tratamiento se valoró la actividad antagónica de agentes biológicos y químicos contra los microorganismos potencialmente patógenos. Finalmente se llevaron a cabo cuantificaciones de fenoles totales, como metabolitos implicados en la defensa y se evaluó la capacidad antioxidante de las palmas enfermas y sanas utilizando los métodos DPPH, FRAP y ABTS. En base a los resultados de HTS se determinó que los hongos más abundantes en plantas del primer estadio fueron Fusarium (20.73%) y Coprinopsis (16.75%), a diferencia del segundo estadio que fueron Antrodia (13.55%), un género no identificado de Didymellaceae (26.69%) y Candida (10.82%), mientras que en plantas sanas fue Kazachstania (81.81%). El género bacteriano más abundante en el primer estadio fue una bacteria perteneciente a la familia Enterobacteriaceae (17.13%), mientras que en el segundo estadio fueron Bacteroides (10.88%) y una bacteria perteneciente a la familia Enterobacteriaceae (7.08%). Con las técnicas dependientes de cultivo se obtuvo una mayor predominancia del género Fusarium en el primer estadio de la PC. Las pruebas de patogenicidad confirmaron la capacidad infectiva de las cepas E1H-35 (Fusarium oxysporum) y E1H-15 (Fusarium solani) al ser inoculadas en plantas sanas y producir lesiones cloróticas con necrosis similares a la PC. Se evidenció una mayor concentración de fenoles y poder reductor de los radicales FRAP, ABTS y DPPH, en los extractos metanólicos de las hojas de palma del primer estadio de PC y aparentemente sanas. De acuerdo a las pruebas antagónicas, la cepa E2H-3 (Trichoderma atroviride) y el fungicida Himexazol presentaron una mayor capacidad de inhibir los patógenos F. oxysporum y F. solani. La identificación de los microorganismos asociados a la enfermedad de PC en plantas de palma aceitera permitirá comprender la progresión etiológica de la enfermedad y que sirva como base para la búsqueda de un tratamiento., [eng] Oil palm (Elaeis guineensis Jacq.), is one of the highest-yielding oil crops and second most consumed globally. One of the main limitations of palm production is bud rot disease (PC). In Ecuador the palm crops are located mainly in the Esmeraldas province, that concentrates 44.37% of the 246574 hectares planted in the country and has the highest incidence of CP (82948 hectares affected), according to the palm census of 2017. The Oil Palm Research Center (Cenipalma) identified Phytophthora palmivora in palm plantations of northern Colombia, however, in Ecuador there are no studies that confirm this finding. In this research, the potentially pathogenic microorganisms present in oil palm crops with PC from Esmeraldas province were identified. Based on HTS, it was determined that the most abundant fungi in plants of the first stage were Fusarium (20.73%) and Coprinopsis (16.75%), in the second stage were Antrodia (13.55%), an unidentified genus of Didymellaceae (26.69 %) and Candida (10.82%), and in healthy plants it was Kazachstania (81.81%). The most abundant bacterial genus in the first stage belongs to the Enterobacteriaceae (17.13%), in the second stage were Bacteroides (10.88%) and bacterium of the Enterobacteriaceae (7.08%). With culture-dependent techniques, the genus Fusarium was predominant among isolates obtained from samples in the first stage of CP. Pathogenicity tests confirmed the infective capacity of E1H-35 (Fusarium oxysporum) and E1H-15 (Fusarium solani) strains when producing symptoms similar to PC in healthy plants, such as chlorosis and necrosis. A higher concentration of phenols and reducing power of FRAP, ABTS and DPPH radicals were evidenced in the methanolic extracts of leaves from palms that were asymptomatic or in the first stage of PC. According to the antagonistic tests, a strain Trichoderma atroviride E2H-3 and the fungicide Himexazol presented greater capacity to inhibit F. oxysporum and F. solani. The identification of microorganisms associated with PC in oil palm will contribute to understanding the etiological progression of the disease and will serve as the basis for future treatments.

Currently, the teacher is faced with several alternative educational methodologies that make the traditional expository method increasingly improved. Added to this, education has gone through delicate moments at the expense of the new Coronavirus pandemic (SARS-CoV-2). The use of educational games has been highly appreciated for facilitating and motivating student learning. In higher education, the genetic code theme is generally seen as complex and difficult to assimilate due to the vast amount of terms and concepts that need to be assimilated. The objective of this work is to propose a game that facilitates the understanding of the genetic code theme in the genetics discipline. In addition, the game allows you to approach topics of Biochemistry, regarding the characteristics of the structural constitution of amino acids, and other concepts such as essential, non-essential or conditionally essential amino acids. We believe that the use of this activity can captivate students and promote improvement in the teaching and learning process on the subject. Actualmente, el docente se enfrenta a varias metodologías educativas alternativas que hacen que el método expositivo tradicional sea cada vez más mejorado. Sumado a esto, la educación ha pasado por momentos delicados a expensas de la nueva pandemia de Coronavirus (SARS-CoV-2). El uso de juegos educativos ha sido muy apreciado por facilitar y motivar el aprendizaje de los estudiantes. En la educación superior, el tema del código genético generalmente se considera complejo y difícil de asimilar debido a la gran cantidad de términos y conceptos que deben asimilarse. El objetivo de este trabajo es proponer un juego que facilite la comprensión del tema del código genético en la disciplina genética. Además, el juego permite abordar temas de Bioquímica, referentes a las características de la constitución estructural de los aminoácidos, y otros conceptos como aminoácidos esenciales, no esenciales o condicionalmente esenciales. Creemos que el uso de esta actividad puede cautivar a los estudiantes y promover la mejora en el proceso de enseñanza y aprendizaje de la asignatura. Atualmente, o professor se depara com diversas metodologias educacionais alternativas que fazem com que o método tradicional expositivo seja cada vez mais aprimorado. Somado a isso, a educação tem passado por momentos delicados em detrimento a pandemia do novo Coronavírus (SARS-CoV-2). O uso de jogos didáticos tem sido bastante apreciado por facilitar e motivar a aprendizagem dos alunos. No ensino superior, o tema código genético geralmente é encarado como complexo e de difícil assimilação em função da vasta quantidade de termos e conceitos que precisam ser assimilados. O objetivo deste trabalho é propor um jogo que facilite a compreensão do tema código genético na disciplina de genética. Além, disso, o jogo permite abordar tópicos de Bioquímica, no que tange as características da constituição estrutural dos aminoácidos, e outros conceitos como aminoácidos essenciais, não essenciais ou condicionalmente essenciais. Acreditamos que, o uso dessa atividade possa cativar os alunos e promover melhoria no processo de ensino e aprendizagem do tema.

Simple Summary Epidemiological studies have identified a link between neurodegenerative disorders and a reduced risk of overall cancer. Increases and decreases in the risk of site-specific cancers have also been reported. However, it is still unknown whether these associations arise due to shared genetic and molecular factors or are explained by other phenomena (e.g., biases in epidemiological studies or the use of medication). In this study, we aimed to investigate the potential molecular, genetic, and pharmacological links between Alzheimer’s and Parkinson’s diseases and a large panel of 22 cancer types. To examine the overlapping involvement of genes and pathways, we obtained differential gene expression profiles through meta-analyses of post-mortem brain tissues from Alzheimer’s and Parkinson’s disease patients, primary tumors, and tissue-matched controls, and compared them. Genetic similarities were assessed through network-based methods and the computation of genetic correlations. Finally, the potential impact of drugs indicated for each disorder in the identified associations was evaluated using transcriptomic methods. Our research extends previous work in the field by identifying new significant patterns of transcriptomic associations (direct and inverse) between Alzheimer’s disease, Parkinson’s disease, and different site-specific cancers. The results reveal significant genetic correlations between Parkinson’s disease, prostate cancer, and melanoma. In addition, to our knowledge, this is the first time that the role of drugs indicated for the treatment of both sets of disorders has been investigated in the context of their comorbid associations using transcriptomic methods. Abstract Alzheimer’s (AD) and Parkinson’s diseases (PD) are the two most prevalent neurodegenerative disorders in human populations. Epidemiological studies have shown that patients suffering from either condition present a reduced overall risk of cancer than controls (i.e., inverse comorbidity), suggesting that neurodegeneration provides a protective effect against cancer. Reduced risks of several site-specific tumors, including colorectal, lung, and prostate cancers, have also been observed in AD and PD. By contrast, an increased risk of melanoma has been described in PD patients (i.e., direct comorbidity). Therefore, a fundamental question to address is whether these associations are due to shared genetic and molecular factors or are explained by other phenomena, such as flaws in epidemiological studies, exposure to shared risk factors, or the effect of medications. To this end, we first evaluated the transcriptomes of AD and PD post-mortem brain tissues derived from the hippocampus and the substantia nigra and analyzed their similarities to those of a large panel of 22 site-specific cancers, which were obtained through differential gene expression meta-analyses of array-based studies available in public repositories. Genes and pathways that were deregulated in both disorders in each analyzed pair were examined. Second, we assessed potential genetic links between AD, PD, and the selected cancers by establishing interactome-based overlaps of genes previously linked to each disorder. Then, their genetic correlations were computed using cross-trait LD score regression and GWAS summary statistics data. Finally, the potential role of medications in the reported comorbidities was assessed by comparing disease-specific differential gene expression profiles to an extensive collection of differential gene expression signatures generated by exposing cell lines to drugs indicated for AD, PD, and cancer treatment (LINCS L1000). We identified significant inverse associations of transcriptomic deregulation between AD hippocampal tissues and breast, lung, liver, and prostate cancers, and between PD substantia nigra tissues and breast, lung, and prostate cancers. Moreover, significant direct (same direction) associations of deregulation were observed between AD and PD and brain and thyroid cancers, as well as between PD and kidney cancer. Several biological processes, including the immune system, oxidative phosphorylation, PI3K/AKT/mTOR signaling, and the cell cycle, were found to be deregulated in both cancer and neurodegenerative disorders. Significant genetic correlations were found between PD and melanoma and prostate cancers. Several drugs indicated for the treatment of neurodegenerative disorders and cancer, such as galantamine, selegiline, exemestane, and estradiol, were identified as potential modulators of the comorbidities observed between neurodegeneration and cancer.

“Avibacterium paragallinarum es una bacteria Gram negativa patógena de aves, que causa una enfermedad en aves de corral conocida como coriza infecciosa, la cual se caracteriza por producir estornudo, lagrimeo, hinchazón en cabeza y ojos, escurrimiento nasal, pérdida de peso y disminución en la producción de huevo, ocasionando pérdidas económicas importantes en el sector avícola. Para controlar la coriza infecciosa se han producido vacunas, sin embargo, estas protegen a las aves de las infecciones producidas por serotipos homólogos a los incorporados en la vacuna, quedando vulnerables a los otros serotipos de A. paragallinarum. Se propone que es necesaria la búsqueda de nuevos factores de virulencia que permitan la generación de vacunas y que ofrezcan una mayor protección contra la coriza infecciosa. En algunas bacterias se ha reportado la presencia de enzimas condroitín liasas que se encargan de degradar sulfato de condroitina a oligosacáridos y posteriormente asimilarlos metabólicamente. El objetivo de este estudio fue la identificación funcional de dos operones relacionados con la utilización de carbohidratos de origen en tejido animal, en Avibacterium paragallinarum. Mediante análisis bioinformáticos se reportó la presencia de dos enzimas condroitín liasas, a partir de los cuales se diseñaron oligonucleótidos para la amplificación de secuencias de dos operones putativos que contienen genes de condroitín liasas.”

Tesis (Doctora en Ciencias Químicas) - - Universidad Nacional de Córdoba. Facultad de Ciencias Químicas, 2020 En este Trabajo de Tesis se describieron tres enzimas presentes en la base genómica de datos de G. lamblia como posibles histonas metiltransferasas, HMT1, HMT2 y SET2 encargadas de metilar residuos de lisina en histonas. Se estudió su rol durante el crecimiento y el enquistamiento de G. lamblia. Se observó que estas enzimas presentaban una localización nuclear, perinuclear y citoplasmática y que regulaban tanto positiva como negativamente el proceso de enquistamiento. A su vez, se identificaron y estudiaron las diferentes modificaciones post-traduccionales presentes en las histonas de los trofozoítos de G. lamblia. En primera instancia, se aislaron e identificaron diferentes péptidos de H2A, H2B, H3 y H4 comprendidos en la base de datos de histonas de G. lamblia. Se encontraron modificaciones conservadas en otros organismos, tales como metilación, acetilación y ubiquitinación de lisinas, metilación de argininas, y también fosforilación de treoninas, tirosinas y lisinas. Con respecto a la metilación de argininas, en el genoma de G. lamblia no hay enzimas descriptas como HRMT (histona-arginina metiltransferasa), por lo que la presencia de argininas metiladas indica que posiblemente algunas de las HMTs (histona metiltransferasas) las que normalmente modifican lisinas, puedan estar modificando a su vez argininas. Este trabajo proporciona la primera caracterización a gran escala del código de las histonas de G. lamblia, lo cual constituye una plataforma para el desarrollo de futuras investigaciones en el campo de la epigenética en este parásito. 2023-06-30 Salusso, Agostina. Universidad Nacional de Córdoba. Facultad de Ciencias Químicas; Argentina. Ropolo, Andrea Silvana. Universidad Nacional de Córdoba. Facultad de Ciencias Químicas. Consejo Nacional de Investigaciones Científicas y Técnicas. Instituto de Investigación Médica Mercedes y Martín Ferreyra; Argentina. Echenique, José Ricardo. Universidad Nacional de Córdoba. Facultad de Ciencias Químicas. Departamento de Bioquímica Clínica. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro de Investigaciones en Bioquímica Clínica e Inmunología; Argentina. Monti, Mariela Roxana. Universidad Nacional de Córdoba. Facultad de Ciencias Químicas. Departamento de Química Biológica. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro de Investigaciones en Química Biológica de Córdoba; Argentina. Nicola, Juan Pablo. Universidad Nacional de Córdoba. Facultad de Ciencias Químicas. Consejo Nacional de Investigaciones Científicas y Ténicas. Centro de Investigaciones en Bioquímica Clínica e Inmunología; Argentina. Carranza, Pedro Gabriel. Universidad Nacional de Santiago del Estero. Consejo Nacional de Investigaciones Científicas y Técnicas. Instituto Multidisciplinario de Salud, Tecnología y Desarrollo; Argentina.

Alpaca is a camelid species of broad economic, biological and biomedical interest, and an essential part of the cultural and historical heritage of Peru. Recently, efforts have been made to improve knowledge of the alpaca genome, and its genetics and cytogenetics, to develop molecular tools for selection and breeding. Here, we report cytogenetic mapping of 35 new markers to 19 alpaca autosomes and the X chromosome. Twenty-eight markers represent alpaca SNPs, of which 17 are located inside or near protein-coding genes, two are in ncRNA genes and nine are intergenic. The remaining seven markers correspond to candidate genes for fiber characteristics (BMP4, COL1A2, GLI1, SFRP4), coat color (TYR) and development (CHD7, PAX7). The results take the tally of cytogenetically mapped markers in alpaca to 281, covering all 36 autosomes and the sex chromosomes. The new map assignments overall agree with human&ndash, camelid conserved synteny data, except for mapping BMP4 to VPA3, suggesting a hitherto unknown homology with HSA14. The findings validate, refine and correct the current alpaca assembly VicPac3.1 by anchoring unassigned sequence scaffolds, and ordering and orienting assigned scaffolds. The study contributes to the improvement in the alpaca reference genome and advances camelid molecular cytogenetics.

Resumo não disponível

[eng] The present doctoral thesis has been devoted to the use of 1,2,4,5-tetrazines as potential tools for chemical biology. Tetrazines have become extremely interesting functionalities due to their ability to undergo fast inverse electron-demand Diels- Alder (iEDDA) cycloadditions in vivo. Therefore, the use of tetrazines in bioorthogonal reactions, which are reactions that can take place under biocompatible conditions, is having a major impact in the development of new research tools and novel therapeutic strategies. Initially, the synthesis of different 3-bromotetrazines with unprecedented yields is described, in a metal- and oxidant-free synthetic route. These 3-bromotetrazines have been used to attain late-stage functionalisation of small molecules, through either nucleophilic aromatic substitutions or Palladium-mediated cross-coupling reactions. Both the in vivo stability and kinetics in the iEDDA cycloaddition of the formed products have been studied, as they are critical factors when aiming for a bioorthogonal applicability. Of note, the spectroscopic characterisation of the generated tetrazine ethers has been performed due to their fluorescent behaviour. Next, the monosubstituted 3-bromo-1,2,4,5-tetrazine has been used to chemoselectively label proteins in solution through their natural lysine residues. The formed 3-aminotetrazines in the protein surface are able to trigger click-to-release reactions with trans-cyclooctene carbamates. This reaction has been exploited to activate prodrugs in vivo, opening the way for potential targeted drug delivery therapies. Finally, the site-selective incorporation of tetrazinyl-containing unnatural amino acids directly into proteins of choice is described. To that end, the manipulation of the translation machinery of the target organisms is required through an orthogonal translation system capable of recognising the desired amino acids without compromising cellular fitness, thereby successfully expanding the genetic code artificially. We have shown the incorporation of a new amino acid capable of undergoing click-to-release reactions in E. coli, and we have described the progress made towards such incorporation in mammalian cells through the development of a directed evolution assay., [cat] Aquesta tesi doctoral s’ha basat en la utilització de les 1,2,4,5-tetrazines com a eines potencials en química biològica. Les tetrazines han esdevingut unes funcionalitats químiques extremadament interessants degut a la seva capacitat de dur a terme cicloaddicions de Diels-Alder de demanada electrònica inversa (iEDDA) in vivo. Per tant, l’ús de les tetrazines en reaccions bioortogonals, és a dir, reaccions que poden tenir lloc en condicions biocompatibles, està tenint un gran impacte en el desenvolupament de noves eines per a investigació i d’estratègies terapèutiques innovadores. Inicialment es descriu la síntesi de diferents 3-bromotetrazines amb rendiments sense precedents, a través d’una ruta sintètica que no requereix ni metalls ni oxidants. Aquestes 3-bromotetrazines s’han utilitzat per aconseguir la funcionalització de molècules petites en última etapa, mitjançant substitucions nucleòfiles aromàtiques or reaccions d’acoblament catalitzades per Pal·ladi. Tant l’estabilitat in vivo com els paràmetres cinètics de la cicloaddició iEDDA dels productes formats s’han estudiat, ja que són factors crítics que en determinen la seva aplicabilitat en reaccions bioortogonals. Cal destacar que la caracterització espectroscòpica de les tetrazines generades s’ha dut a terme degut al seu comportament fluorescent. Seguidament, el compost monosubstituït 3-bromo-1,2,4,5-tetrazina s’ha utilitzat per funcionalitzar quimioselectivament proteïnes en solució a través de les seves lisines naturals. Les 3-aminotetrazines formades a la superfície de la proteïna són capaces de dur a terme reaccions d’alliberament a través de click amb carbamats de trans-ciclooctens. La reacció s’ha utilitzat per activar profàrmacs in vivo, obrint la porta per al desenvolupament de teràpies d’alliberament de fàrmacs dirigides. Finalment, es descriu la incorporació lloc-específica d’aminoàcids funcionalitzats amb tetrazines directament en posicions de proteïnes escollides. Amb aquesta finalitat, es requereix la manipulació de la maquinària de traducció de certs organismes a través d’un sistema de traducció ortogonal capaç de reconèixer els aminoàcids desitjats sense comprometre la viabilitat cel·lular, aconseguint així l’expansió del codi genètic artificialment. Aquí mostrem la incorporació de nous aminoàcids capaços de dur a terme reaccions d’activació bioortogonals en E. coli, i també descrivim el progrés realitzat cap a la consecució d’aquesta incorporació en cèl·lules de mamífer a través del desenvolupament d’assajos d’evolució dirigida.

Universidad Nacional Agraria La Molina. Escuela de Posgrado. Maestría en Producción Animal El objetivo del estudio fue desarrollar un mapa físico preliminar de polimorfismos de nucleótido simple (PNSs) en alpaca usando un panel celular híbrido irradiado alpaca/ hámster y una micromatriz de genotipado de alta densidad de bovino (BovineHD BeadChip-Illumina). Se realizó el genotipado de 92 clones celulares híbridos irradiados y cuatro muestras control (alpaca macho, alpaca hembra, hámster y 1:10 alpaca/hámster mezcla de ADN) con la micromatriz. Luego del genotipaje de las muestras control del ADN de alpaca y hámster solo se retuvieron PNSs de bovinos que mostraron una frecuencia de señal positiva de 1. Los PNSs identificados en el ADN de alpaca fueron filtrados para sustraer los presentes en el hámster. De estos últimos, solo se retuvieron para el análisis final aquellos que tuvieron una frecuencia de señal positiva de 0.2 a 0.8 para los 92 clones y se eliminaron los PNSs que presentaron falsos positivos. Los restantes PNSs específicos de alpaca fueron tabulados en el formato MapMaker y fueron analizados con el programa Carthagene para identificar grupos de ligamiento. Los grupos ligados fueron ubicados en el genoma referencial Vicugna_pacos-2.0.2, aplicando el programa BLAST y el comando SHORTBLAST, en la plataforma Galaxy. Las dos muestras control de alpaca registraron 294 165 PNSs, con señal positiva en la micromatriz de bovino. La cantidad de PNSs de alpaca, después de eliminar los PNSs positivos comunes con hámster, fue 50 686 y luego de eliminar los posibles falsos positivos quedaron 2924 PNSs. Esta cantidad se analizó con el programa Carthagene y resultó en 33 grupos de ligamiento, con un total de 216 PNSs. Las distancias calculadas entre estos PNSs oscilan entre 65.3 y 671.9 cR, con un logaritmo de probabilidades (LOD) >6.0. Finalmente, se encontraron un total de 31 PNSs en el genoma referencial (E-value6.0. Finally, a total of 31 SNPs was found in the reference genome (E-value

Tesis Doctoral presentada por Raquel Bajo Grañeras para optar al grado de doctora por la Universidad de Valladolid, Facultad de Medicina (Departamento de Bioquímica y Biología y Fisiología).-- Sujeta a Licencia Creative Commons., [EN]: ApoD is a secreted Lipocalin that has been functionally associated with aging, degeneration and nervous system damage, and with many cancer types as well. Recent work in model organisms like plants, flies and mice1-5 has shown that ApoD participates as a survival mechanism, conserved across species, against diverse oxidative stress situations. In this thesis we propose four objectives aiming to understand the ApoD protective role in various physiological and pathological situations. To carry out these objectives we have used biological models with high sensitivity to and/or high levels of oxidative stress. The experimental approach includes analyses at the following levels: 1) gene expression assays (microarrays or qPCR arrays), 2) biochemical assays (enzyme activity, lipid peroxidation, or dopamine levels), 3) cell cultures (cell lines or primary cultures), 4) tissue analyses (mouse nervous system tissue or human colorectal adenocarcinoma), and 5) locomotor behavior analyses in the whole organism (in the mouse experimental model). We further ask whether ApoD function changes in different tissues or whether it works through a general mechanism of action everywhere it is expressed. The first three objectives of this work have been performed in the nervous system, an essentially post-mitotic tissue highly sensitive to stress. We have focused on glial cells (astrocytes), because this cell type predominantly responds against pro-oxidative situations; and on dopaminergic neurons because they are particularly sensitive to this type of stress. The last thesis objective aims at studying ApoD function in a proliferating tissue that is able to support high levels and tolerance to the oxidative stress caused by its high rate of ROS production (human colorectal cancer). Thus, we have been able to contrast the similarities and differences between both physiological situations to contextualize the relevance and impact of ApoD., In summary, the presence of ApoD in the neuronal environment is necessary for an adequate protection against oxidative damage in the nervous system since it affects the transcriptional profile of the early response to this kind of stress. We have shown that ApoD preferentially alters the neuronal and oligodendroglial transcriptome with changes in expression of genes involved in neuronal excitability, synaptic transmission, management of myelin and the response to oxidative stress (Objective 1). After demonstrating the influence of ApoD in a proper glial response that could cushion the neurodegeneration associated with oxidative stress, we directed our study to the role of ApoD in the important glia-glia and glia-neuron interactions within the nervous system. We show that ApoD is secreted by astrocytes in response to the ROS-generator paraquat, and that it has a beneficial effect on the functionality of the locomotor system in the mouse, particularly on the dopaminergic system. Our data demonstrate that ApoD expression is induced by the activation of the JNK signaling pathway and that it functions as an autocrine mechanism to protect astrocytes against oxidative stress. In addition, ApoD modulates astroglial reactivity and alters the astrocytes transcriptional response upon oxidative stress. The addition of human ApoD to mouse astrocytes promotes their survival, further indicating the existence of mechanisms conserved across species. ApoD contributes to the endurance of astrocytes and reduces their reactivity both in vitro and in vivo. These two effects are sufficient to improve the functionality of the nigrostriatal dopaminergic system (Objective 2). The observed decrease in the impact of damage in neurons of the substantia nigra could be due to a combination of the benefits of a healthy surrounding glia and the direct effects of ApoD on neurons. Among other glial factors released to extracellular medium, ApoD could perform direct effects on the viability of neurons. We tested this hypothesis and found that ApoD is effective even in PINK1 deficient dopaminergic neurons (a Parkinson's disease model) and that these beneficial effects are mediated by ERK signaling pathway activation which promotes cell survival (Objective 3)., After observing what happens in the nervous system, where ApoD plays a protective role both for glia and for damaged neurons, we wanted to study a very different model to confirm if ApoD protective effects are applicable. For this purpose we have used human colorectal cancer tissues and a cell line of colon cancer. Both strategies have allowed us to observe a negative correlation between the ApoD expression and cancer progression. This represents a paradox because oxidative stress increases along cancer progression. Our study shows that cancer cells are able to respond to prooxidant stimuli. Even though ApoD expression is low in the stromal cells, it increases in the dysplastic epithelium. Finally, ApoD modifies neither the proliferation rate nor apoptosis levels in control conditions, but it promotes apoptosis under oxidative stress conditions. Therefore ApoD might become a therapeutic resource to promote cancer cell death when they are under stress (Objective 4). The general conclusion extracted from these results is that ApoD is a protein able to perform protective effects in different systems upon oxidative stress, promoting cell survival in glial and neurons (essentially post-mitotic cells), but promoting cell death in neoplastic cells under oxidative stress. Our work also uncovers some of the mechanisms by which this apparently pleiotropic protein is able to control the survival/death balance in both physiological and pathological conditions of diverse etiology.

The carbapenemase OXA-244 is a derivate of OXA-48, and its detection is very difficult in laboratories. Here, we report the identification and genomic analysis of an Escherichia coli isolate (28Eco12) harboring the blaOXA-244 gene identified in Colombia, South America. The 28Eco12 isolate was identified during a retrospective study, and it was recovered from a patient treated in Colombia. The complete nucleotide sequence was established using the PacBio platform. A comparative genomics analysis with other blaOXA-244–harboring Escherichia coli strains was performed. The 28Eco12 isolate belonged to sequence type (ST) 38, and its genome was composed of two molecules, a chromosome of 5,343,367 bp and a plasmid of 92,027 bp, which belonged to the incompatibility group IncY and did not harbor resistance genes. The blaOXA-244 gene was chromosomally encoded and mobilized by an ISR1-related Tn6237 composite transposon. Notably, this transposon was inserted and located within a new genomic island. To our knowledge, this is the first report of a blaOXA-244–harboring Escherichia coli isolate in America. Our results suggest that the introduction of the OXA-244-producing E. coli isolate was through clonal expansion of the ST38 pandemic clone. Other isolates producing OXA-244 could be circulating silently in America.

El género Dipteryx tiene una alta demanda en el mercado internacional de la madera dura. En el Perú, la madera se extrae de los departamentos de Madre de Dios, Ucayali, Loreto, Junín y Pasco, comercializándose como charapilla o shihuahuaco bajo los nombres científicos de Dipteryx odorata (Aubl.) Willd. y Coumarouna odorata Aubl., respectivamente. Un estudio reciente del Instituto de Investigaciones de la Amazonía Peruana (IIAP) sobre la morfología de Dipteryx en el Perú, advierte sobre la presencia de dos especies en la Amazonía peruana, y una de ellas con dos morfotipos, a saber, Dipteryx charapilla (J.F. Macbr.) Ducke, restringida al departamento de Loreto y dos morfotipos de Dipteryx micrantha Harms, de amplia distribución (Aldana et al., 2016). Se han realizado nuevas colectas botánicas que han permitido conocer la distribución geográfica de Dipteryx en la Amazonía peruana y realizar estudios de caracterización molecular que corroboran la existencia de tres entidades genéticas diferentes. Asimismo, se realizó el monitoreo de los individuos en campo con el fin de obtener muestras fértiles con flores y/o frutos que fueron muy valiosas en la determinación de estas especies y los morfotipos. Los estudios se enmarcaron en dos proyectos cuyo objetivo fue la verificación genética de la madera de especies forestales. Las fichas de identificación han sido elaboradas para ampliar el conocimiento de las especies forestales del país. Los nombres científicos utilizados están basados en las muestras tipo originales de Dipteryx y en la revisión taxonómica del género que se vienen en el Instituto de Pesquisas Jardim Botânico do Rio de Janeiro, Brasil. La unión de caracteres morfológicos y moleculares ha permitido la diferenciación e identificación, sin temor a equivocaciones, de estas especies muy parecidas morfológicamente entre sí. Estas fichas representan posiblemente la herramienta más completa desarrollada hasta la fecha sobre las especies del género Dipteryx en el Perú. Programa Nacional de Innovación para la Competitividad y Productividad - Innóvate Perú; Instituto Thünen, Alemania. Revisado por pares

Locust outbreaks affect near two thirds of the Earth’s dry surface, which requires a great investment in their control and repair of the damage they cause. The transformation of isolated and passive locusts into swarming and active locusts is regulated by a striking case of polyphenism called phase change. Despite the knowledge on some potential modulators of the locust phase change, its integrative genetic regulation is not yet understood. This dissertation studies the transcriptional consecuences of phase change in the desert locust Schistocerca gregaria Forskal by comparing the overall gene expression profile differences between the gregarious and solitarious phases. For this purpose, we first develope mathematical models in order to quantify the degree of locust gregariousness. Following that, we sequence, assemble, analyze and compare the transcripts and their expression profiles from two adult tissues (central nervous system and digestive tube) between the two phases, gregarious and solitarious. We validated the results using qPCR and by comparisons with the data from scientific publications on the phase change both in S. gregaria and in the migratory locust, Locusta migratoria. In addition, as case study, we characterize the copy number of chemosensory proteins (CSPs) in both species, and we found some of them to be linked to the phase change in one or both species. In summary, this thesis updates the study of phase change in S. gregaria with a behavioural tool and high amounts of genetic data. The behavioural models developed will facilitate and standarize the functional study of the effect of an experimental treatment in phase change. Our transcriptomes contribute with a wide set of interesting sequences probably involved in phase change and other set of interesting sequences that might be explorable for targeting locusts. In addition, we find that the gregarious CNS presents the highest number of pathways affected or involved in the phase change. We also identified transcripts from a potential biological control agent: a gregarine. The case study presented here offers an example on how to identify putative genes, their copy number, phylogenetic relationships and expression profiles in the gregarious and solitarious phases, which ultimately leads to revealing the potential association of the concrete transcripts with the phase change., Tesis Univ. Granada. Programa Oficial de Doctorado en: Biología Fundamental y de Sistemas, Ministerio de Economía y Competitividad del Gobierno de España a través del proyecto con referencia BFU2010-16438., Formación de Personal Investigador con referecia BES-2011-043627.

Why is an amino acid replacement in a protein accepted during evolution? The answer given by bioinformatics relies on the frequency of change of each amino acid by another one and the propensity of each to remain unchanged. We propose that these replacement rules are recoverable from the secondary structural trends of amino acids. A distance measure between high-resolution Ramachandran distributions reveals that structurally similar residues coincide with those found in substitution matrices such as BLOSUM: Asn ↔ Asp, Phe ↔ Tyr, Lys ↔ Arg, Gln ↔ Glu, Ile ↔ Val, Met → Leu; with Ala, Cys, His, Gly, Ser, Pro, and Thr, as structurally idiosyncratic residues. We also found a high average correlation (R¯¯¯¯ = 0.85) between thirty amino acid mutability scales and the mutational inertia (I X ), which measures the energetic cost weighted by the number of observations at the most probable amino acid conformation. These results indicate that amino acid substitutions follow two optimally-efficient principles: (a) amino acids interchangeability privileges their secondary structural similarity, and (b) the amino acid mutability depends directly on its biosynthetic energy cost, and inversely with its frequency. These two principles are the underlying rules governing the observed amino acid substitutions.

Universidad Nacional Agraria La Molina. Escuela de Posgrado. Maestría en Producción Animal El objetivo del presente trabajo de investigación fue desarrollar un mapa físico de polimorfismos de nucleótido simple (PNSs) en alpaca usando un panel celular híbrido irradiado alpaca/hámster y una micromatriz de genotipado de alta densidad de bovino. Los objetivos específicos fueron: a) identificar los PNSs de la micromatriz de alta densidad de bovinos detectados solo en ADN de alpaca y ausentes en el ADN de hámster; b) determinar las distancias entre grupos de PNSs coheredados en el panel de células híbridas irradiadas alpaca/hámster; y, c) determinar la localización cromosómica de los grupos ligados de PNSs. Se genotiparon las 96 muestras de ADN presentes en el panel (92 clones celulares híbridos alpaca/hámster, 2 muestras de alpaca, 1 muestra de hámster, 1:10 muestra alpaca/hámster) evaluadas con los programas GenomeStudio, R y Excel. Los PNSs identificados con la micromatriz en el ADN de alpaca se analizaron con el programa Carthagene para identificar los grupos de ligamiento. Los grupos ligados fueron ubicados en la base de datos VicPac 2.0.2, aplicando el programa Blast y el comando ShortBlast, en la plataforma Galaxy. Se identificó un 50,686 PNSs del total de polimorfismos de nucleótido simple, analizados en la micromatriz de bovino, presentes en el genoma de la alpaca y ausentes en el genoma del hámster; se determinaron 33 grupos de ligamiento, con un total de 216 PNSs, con distancias calculadas que oscilaron entre 65.3 y 671.9 cR, con un LOD>3.0; y, se halló la secuencia de 31 PNSs en el VicPac 2.0.2, y se infirió la localización de tres PNSs (1BovineHD0100027068, 8BovineHD0600011684 y 13BovineHD1100019948) en los cromosomas 1, 2 y 4 de alpaca. The aim of this research study was to develop a physical map of single nucleotide polymorphisms (SNPs) in alpaca using the alpaca/hamster radiation hybrid panel and a Bovine high-density SNP genotyping microarray. The specific objectives were: a) to identify SNPs on the bovine microarray present only in alpaca DNA and absent in hamster DNA; b) to determine the distances between SNP groups co-inherited in the alpaca/hamster radiation hybrid panel and; c) to determine the chromosomal location of the SNP linked groups. The 96 DNA samples present in the panel were genotyped (92 hybrid cells clones, 2 alpaca samples, 1 hamster sample, 1:10 alpaca/hamster sample) and were evaluated with the GenomeStudio, R and Excel programs. The SNPs found in alpacas were analyzed with the Carthagene software to identify linkage groups. These linked groups were located in the VicPac 2.0.2 database using the Blast software and the ShortBlast command with the help of the Galaxy platform. A total of 50,686 SNPs from the bovine microarray were detected in the alpaca genome and absent in the hamster genome. Thirty-three linkage groups that include 216 SNPs were identified. Their calculated distances that ranged between 65.3 and 671.9 cR, with a LOD> 3.0. The sequence of 31 of these SNPs was found in the VicPac 2.0.2 and the location of 3 SNPs (1BovineHD0100027068, 8BovineHD0600011684 and 13BovineHD1100019948) was inferred to be on alpaca chromosomes 1, 2 and 4. Tesis

[ENG] Ribosome biogenesis is one of the most energy consuming anabolic processes in a cell, required for the generation of the translational machinery to grow and proliferate. Moreover, this process necessitates the coordination of protein and nucleotide synthesis to generate ribosomal proteins (RPs) and ribosomal RNA (rRNA). Critically, increased rates of ribosome biogenesis are a hallmark of c-Myc driven CRC required to sustain exacerbated growth and proliferation, with recent studies showing that drugs that target ribosome biogenesis are clinically efficacious. We have previously shown that upon ribosome biogenesis impairment, a pre‐ribosomal complex formed by RPL11 and RPL5 and noncoding 5S rRNA is re‐directed from the incorporation into the pre-60S ribosome, to bind and inhibit HDM2, leading to p53 stabilization and cell cycle arrest. We have termed this response the Impaired Ribosome Biogenesis Checkpoint (IRBC). In this study I set out to analyze the effect of nucleotide depletion on ribosome biogenesis in c-Myc-driven CRC cell lines, addressing the role of the IRBC. Nucleotide depletion inhibited rRNA synthesis and elicited the IRBC, p53 stabilization, but failed to induce G1 cell cycle arrest as previously reported. I found that this was due to the loss of 5S RNA production, the limiting factor in triggering the IRBC, causing a disruption of the IRBC complex. Moreover, this allowed cells to escape G1 arrest and enter S phase, where they encountered replicative stress. These data support the hypothesis that in nucleotide deprived conditions the IRBC acts to hold cells in G1 to prevent them from replicating their DNA cells and eventually encountering genomic instability.

Submitted by José Rafael Pilan null (jrpilan@ibb.unesp.br) on 2017-04-18T14:57:25Z No. of bitstreams: 1 Dissertacao_v7_final.pdf: 6102051 bytes, checksum: 4df8262c1a6c3ff997bbe50cc07133c7 (MD5) Approved for entry into archive by Luiz Galeffi (luizgaleffi@gmail.com) on 2017-04-18T19:31:24Z (GMT) No. of bitstreams: 1 pilan_jr_me_araiq_par.pdf: 1995449 bytes, checksum: 4f99373a0da0fa27546af7e6b2f5949a (MD5) Made available in DSpace on 2017-04-18T19:31:24Z (GMT). No. of bitstreams: 1 pilan_jr_me_araiq_par.pdf: 1995449 bytes, checksum: 4f99373a0da0fa27546af7e6b2f5949a (MD5) Previous issue date: 2017-02-15 Na análise de dados metagenômicos temos duas perguntas básicas que podemos fazer: “Quem são?” e “O que estão fazendo?” os microorganismos de uma determinada amostra. Para responder a primeira pergunta utiliza-se a análise taxonômica de microorganismos. Existem diversos software que utilizam diferentes metodologias para atingir essa finalidade. Esses métodos são divididos em duas categorias principais: composicional e alinhamento por similaridade. O que diferencia os métodos são principalmente o tempo para ser realizada a análise, poder computacional e eficiência na identificação dos reads. Nesse trabalho propomos um novo método por composição que utiliza cinco assinaturas genômicas e suas combinações para identificação dos reads: concentração de GC (Guanina/Citocina), entropia de dipletes, entropia de tripletes, entropia de tetrapletes e abundância total de dinucleotı́deos. Utilizamos um conjunto de dados referente a 3055 genomas completos de bactérias provenientes do NCBI (National Center for Biotechnology Information)que foram fragmentados em dois grupos: teste e controle. Os grupos foram fragmentados em tamanhos de 50-1000pb com partições de tamanho 50pb, buscando se aproximar dos tamanhos de reads normalmente gerados pelos equipamentos de sequenciamento de nova geração. O desempenho da metologia foi avaliado por medidas de sensibilidade, especificidade, precisão e média harmônica em comparação aos resultados do grupo teste com o grupo controle. Dentre as combinações analisadas, a concentração de GC apresentou melhor desempenho na identificação dos organismos. Para a comparação do método com os software já existentes, prospectamos 233 amostras no EBI (European Bioinformatics Institute) do projeto “A human gut microbial gene catalog established by deep metagenomic sequencing”, realizamos a análise das amostras com os programas Phymm, Phymmbl e Raiphy e comparamos com os resultados de nossa metodologia. Na comparação, a medida de concentração de GC em conjunto com a medida entropia de dipletes mostrou-se eficiente em comparação as demais atingindo em média 89,5% de identificação dos reads. In analyzing metagenomic data we have two basic questions that we can ask: “Who are they?” and “What are doing the microorganisms of a given sample?” . To answer the first question we use the taxonomic analysis of microorganisms. There are several software that use different methodologies to achieve this purpose. These methods are divided into two main categories: compositional and alignment by similarity. What differentiates the methods are mainly the time to perform the analysis, computational power and efficiency in the identification of reads. In this work we propose a new compositional method that uses five genomic signatures and their combinations to identify reads: GC concentration, diplet entropy, triplet entropy, tetraplet entropy and total abundance of dinucleotides. We used a data set of 3055 complete bacterial genomes from the NCBI (National Center for Biotechnology Information) that were fragmented into two groups: test and control. The groups were fragmented in sizes of 50-1000bp with partitions of size 50bp, seeking to approximate the sizes of reads normally generated by the new generation sequencing equipment. The performance of the metology was evaluated by measures of sensitivity, specificity, precision and harmonic mean in comparison to the results of the test group with the control group. Among the combinations analyzed, the GC concentration presented better performance in the identification of organisms. For the comparison of the method with existing software, we prospected 233 samples in the EBI (European Bioinformatics Institute) of the project “A human gut microbial gene established by deep metagenomic sequencing”, we performed the analysis of the samples with the programs Phymm, Phymmbl and Raiphy and compared with the results of our methodology. In the comparison, the GC concentration measure in conjunction with the entropy measurement of diplets proved to be efficient in comparison to the others reaching a mean of 89.5% of the identification of the reads.

En el otoño del 2014, durante el crucero de evaluación de la población de merluza y otros demersales a bordo del BIC Humboldt, se registraron 9 familias y 12 especies: Cephalurus cephalus (Gilbert, 1892) “tiburón renacuajo”; Coelorinchus canus (Garman, 1899) “pez ratón”; Physiculus nematopus Gilbert, 1890 “carbonero de fango”; Merluccius gayi (Guichenot, 1848) “merluza”; Cherublemma emmelas (Gilbert, 1890) “congrio negro”; Pontinus sierra (Gilbert, 1890) “pez diablico”; Prionotus stephanophrys Lockington, 1881 “falso volador”; Citharichthys platophrys Gilbert, 1891 “lenguado plato”; Hippoglossina macrops Steindachner, 1876 “lenguado de ojo grande”; Hippoglossina tetrophthalma (Gilbert, 1890) “lenguado de 4 ocelos”; Engyophrys sanctilaurentii Jordan y Bollman, 1890 “lenguado de cola manchada” y Monolene maculipinna Garman, 1899 “lenguado de aguas profundas”. Se realizaron los análisis morfométrico, merístico y molecular, sirviendo el último para generar sus respectivos códigos de barras de ADN. Los ejemplares identificados morfológicamente como H. macrops, C. cephalus, C. emmelas, C. canus y P. sierra no pudieron ser corroborados molecularmente debido a la falta de registros en las bases de datos de nucleótidos. Las secuencias de ADN obtenidas fueron incorporadas a la base BOLD, siendo los primeros registros para estas especies. No se encontraron diferencias entre las muestras de M. gayi de Perú respecto a M. gayi reportada en Ecuador, ni M. gayi gayi de Chile, por lo que resulta importante realizar nuevos análisis en base a otros marcadores. Por otro lado, algunos ejemplares identificados preliminarmente como Physiculus talarae también presentaron características de P. rastrelliger y P. nematopus, de acuerdo al análisis morfológico realizado en laboratorio. El análisis molecular determinó que estos ejemplares corresponden a P. nematopus. Esto demuestra que los análisis de los caracteres morfológicos y moleculares constituyen herramientas que se complementan en las investigaciones, contribuyendo en la validación de la identificación, distribución y propagación de las especies en el subsistema bentodemersal. ABSTRACT: In autumn of 2014, during the evaluation cruise of the hake and other demersal population on board the BIC Humboldt, 9 families and 12 species were recorded: Cephalurus cephalus (Gilbert, 1892) “tadpole shark”; Coelorinchus canus (Garman, 1899) “mouse fish”; Physiculus nematopus Gilbert, 1890 “coal of mud”; Merluccius gayi (Guichenot, 1848) “hake”; Cherublemma emmelas (Gilbert, 1890) “black conger”; Pontinus sierra (Gilbert, 1890) “diabolical fish”; Prionotus stephanophrys Lockington, 1881 “false flyer”; Citharichthys platophrys Gilbert, 1891 “plate sole”; Hippoglossina macrops Steindachner, 1876 “bigeye flounder”; Hippoglossina tetrophthalma (Gilbert, 1890) “Fourspot flounder”; Engyophrys sanctilaurentii Jordan and Bollman, 1890 “Speckled-tail flounder” and Monolene maculipinna Garman, 1899 “Pacific deepwater flounder”. The morphometric, meristic and molecular analyzes were performed, the latter being used to generate their respective DNA barcodes. The specimens identified morphologically as H. macrops, C. cephalus, C. emmelas, C. canus and P. sierra could not be corroborated molecularly due to the lack of records in the nucleotide databases. The DNA sequences obtained were incorporated into the BOLD database, being the first records for these species. No differences were found between the samples of M. gayi from Peru with respect to M. gayi reported in Ecuador, nor M. gayi gayi from Chile, so it is important to perform new analyzes based on other markers. On the other hand, some specimens previously identified as Physiculus talarae also showed characteristics of P. rastrelliger and P. nematopus, according to the morphological analysis carried out in the laboratory. The molecular analysis determined that these specimens correspond to P. nematopus. This shows that the analysis of morphological and molecular characters constitutes complementary tools in the investigations, contributing in the validation of the identification, distribution and propagation of the species in the benthodemersal subsystem.

Recurrent pregnancy loss is a frequently occurring human infertility-related disease affecting ~1% of women. It has been estimated that the cause remains unexplained in >50% cases which strongly suggests that genetic factors may contribute towards the phenotype. Concerning its molecular aetiology numerous studies have had limited success in identifying the disease’s genetic causes. This might have been due to the fact that hundreds of genes are involved in each physiological step necessary for guaranteeing reproductive success in mammals. In such scenario, next generation sequencing provides a potentially interesting tool for research into recurrent pregnancy loss causative mutations. The present study involved whole-exome sequencing and an innovative bioinformatics analysis, for the first time, in 49 unrelated women affected by recurrent pregnancy loss. We identified 27 coding variants (22 genes) potentially related to the phenotype (41% of patients). The affected genes, which were enriched by potentially deleterious sequence variants, belonged to distinct molecular cascades playing key roles in implantation/pregnancy biology. Using a quantum chemical approach method we established that mutations in MMP-10 and FGA proteins led to substantial energetic modifications suggesting an impact on their functions and/or stability. The next generation sequencing and bioinformatics approaches presented here represent an efficient way to find mutations, having potentially moderate/strong functional effects, associated with recurrent pregnancy loss aetiology. We consider that some of these variants (and genes) represent probable future biomarkers for recurrent pregnancy loss. © 2017 Quintero-Ronderos et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Mestrado em Biologia Molecular e Celular Submitted by Cristina Santos (cmaria@ua.pt) on 2017-12-12T10:15:14Z No. of bitstreams: 1 A reporter system to study the role of tRNA modifying enzymes in human proteostasis.pdf: 1699210 bytes, checksum: ca5549782a6a37ebdf83df7afb4c8df8 (MD5) Made available in DSpace on 2017-12-12T10:15:14Z (GMT). No. of bitstreams: 1 A reporter system to study the role of tRNA modifying enzymes in human proteostasis.pdf: 1699210 bytes, checksum: ca5549782a6a37ebdf83df7afb4c8df8 (MD5) Previous issue date: 2017-01-03

Mestrado em Biologia Molecular e Celular A síntese proteica é um processo essencial para que todos os organismos mantenham a homeostasia celular. Os tRNAs são elementos cruciais na síntese proteica, uma vez que codificam a informação genética presente no mRNA. A linha celular HeLa, utilizada neste estudo, foi primeiramente isolada de uma mulher com cancro do colo do útero e desde então tem sido bastante usada na investigação, sendo muito importante no estudo das bases moleculares de muitas doenças. De modo a monitorizar a agregação proteica nesta linha celular, um sistema repórter foi desenvolvido utilizando uma fusão entre HspB1 (Hsp27) e a GFP. HspB1 é um chaperone molecular com capacidade de recrutar outros chaperones e restabelecer a conformação ideal das proteínas em situações de stress. A GFP é uma proteína fluorescente que marca certas condições biológicas de interesse. Para perceber o impacto dos erros da tradução na agregação de proteínas e no surgimento das doenças, o principal objetivo deste estudo foi desenvolver uma linha celular estável (HeLa) expressando um sistema repórter HspB1-GFP, de modo a monitorizar os erros no enovelamento das proteínas em resposta ao stress proteotóxico. Ao longo deste estudo o sistema repórter expressando HspB1-GFP foi desenvolvido com sucesso, permitindo assim a sua utilização para identificar situações fisiológicas e patológicas em que a agregação de proteínas ocorre em células de mamífero. Protein synthesis is essential for all organisms to maintain cell homeostasis. tRNAs are crucial elements in protein synthesis as they decode the genetic information organized in the mRNA codons. A HeLa cell line, used in this study, was first isolated from a woman with cervical cancer and since then was highly used in biological studies, being extremely important in the study of the molecular basis of several diseases. In order to monitor protein aggregation in this cell line, a reporter system was developed using an HspB1 (Hsp27) and a GFP fusion. HspB1 is a small heat shock protein that, in stress situations, recruits other proteins in order to restore the conformation of the proteins. GFP is a biosensor that reports several cellular conditions of interest. To understand the impact of translation errors on protein aggregation and on the disease arising, the main goal of this study was to develop a stable cell line (HeLa) expressing a reporter system HspB1-GFP to monitor the protein misfolding in response to proteotoxic stress. During this study, the reporter system expressing HspB1-GFP was developed successfully, allowing the identification of physiological and pathological situations where protein aggregation occurs in mammalian cells.

Mestrado em Biologia Molecular e Celular As mutações nonsense são mutações pontuais que originam codões de terminação prematura (PTCs). A expressão de genes portadores de PTCs pode levar à síntese de proteínas truncadas. As proteínas truncadas caracterizam-se por serem menores e, na maioria das vezes, não possuem função biológica, apesar de poderem ter funções deletérias para a célula. Em condições normais, transcritos portadores de PTCs são degradados rapidamente através do processo de nonsense mediated mRNA decay (NMD). Quando um PTC atinge o sítio A ribossomal, os fatores de terminação da tradução ligam-se ao mesmo e a tradução termina imediatamente. A terapia de supressão consiste numa abordagem terapêutica que tem o objetivo de utilizar compostos de baixo peso molecular para induzir a incorporação de aminoacil-tRNAs quase cognatos, moléculas que possuem complementaridade para dois dos três nucleótidos de um códão de stop, quando o ribossoma atinge um PTC. Assim, a tradução não termina prematuramente. Estudos anteriores mostraram que alguns aminoglicósidos possuem a capacidade de suprimir PTCs responsáveis por doenças, como fibrose quística e distrofia muscular de Duchenne. Algumas mutações nonsense são responsáveis pela β-talassemia. Neste estudo foram utilizados dois aminoglicósidos, canamicina e gentamicina, de modo a avaliar a sua capacidade em aumentar a competitividade de tRNAs quase cognatos com os fatores de terminação da tradução pelo sítio A ribossomal, na presença de um PTC, evitando dessa forma a terminação prematura da tradução. Nonsense mutations are point mutations that originate premature termination codons (PTCs). The expression of PTC-containing genes may lead to the synthesis of truncated proteins. Truncated proteins are shorter proteins that at most times do not have biological function, but may have deleterious functions for the cell. In regular conditions, PTC-containing transcripts are taken to rapid decay, through nonsense mediated mRNA decay (NMD). When a PTC reaches the ribosomal A-site, translation release factors bind it and translation immediately stops. Suppression therapy is a therapeutic approach that aims to suppress PTCs by using low molecular weight compounds to induce the incorporation of near cognate aminoacyl tRNAs, molecules that show complementarity to two of the three nucleotides of a stop codon, when the ribosome reaches a PTC. Thus, translation does not prematurely terminates. Previous studies have shown that some aminoglycosides have the ability to suppress PTCs responsible for diseases like cystic fibrosis and Duchenne muscular dystrophy. Some nonsense mutations are responsible for β-thalassemia disease. In this study two aminoglycoside compounds, kanamycin and gentamicin, were used in order to evaluate their capacity to increase the competition of near cognate aminoacyl tRNAs with translation release factors by the ribosomal A-site, when the ribosome reaches a PTC, therefore avoiding the premature termination of translation.

Mestrado em Biomedicina Molecular A Candida cylindracea constitui um caso particular do grupo de leveduras CTG-clade - apresenta uma total conversão do codão CUG de leucina (standard) em serina, em vez de o fazer de forma ambígua como os restantes membros do grupo. Para além disso, após a sequenciação e anotação do seu genoma completo e do seu mRNA, verificou-se que a Candida cylindracea possuí uma frequência consideravelmente elevada de genes iniciados pelos codões alternativos CTG e TTG relativamente às outras espécies filogeneticamente próximas, cuja grande maioria dos genes é iniciada por ATG (standard). Durante este trabalho foi validada a anotação do genoma desta espécie de modo a descartar possíveis artefactos, utilizando o MAKER como ferramenta. As sequências anotadas foram introduzidas na plataforma ANACONDA para desvendar algumas das principais características do genoma e do transcriptoma desta espécie. A análise destes dados basou-se em encontar diferenças significativas entre os diferentes tipos de sequências, de acordo com o seu codão de iniciação, tanto no genoma como no transcriptoma. A notória diferença entre a frequencia dos codões de iniciação das sequências de DNA e RNA, por sua vez, abriu portas à especulação acerca da presença de fenómenos de RNA editing. Ao reunir as peças deste puzzle tão singular, espera-se conseguir dar um passo em frente na compreensão do funcionamento do genoma de acordo com a relevância deste fenómeno. Resta para isso entender de que forma estas diferenças poderão estar conectadas e influenciar o genoma. Estudos posteriores com recurso a novas técnicas da era ómica poderão fornecer novos discernimentos nesta materia. Candida cylindracea yeast is a peculiar case within the CTG clade – its total conversion of the CUG leucine codon into serine contrasts with the ambiguous way that the rest of the yeasts belonging to this group decode the CUG codon. Furthermore, after the sequencing and annotation of its complete genome and its mRNA sequences, it was yet ascertained that Candida cylindracea has a substantial frequency of alternative initiation codons, when compared to other phylogenetically close species, where the majority of the genes is started with the standard ATG codon. MAKER was used as annotation tool to validate the previous annotation of Candida cylindracea’s genome and transcriptome in order to forgo possible artifacts. The sequences produced were introduced in the ANACONDA platform to unveil some of the main features of the genome and transcriptome of this species. The analysis of this data was based in finding the significant differences between the distinct types of sequences according to their initiation codon, in both genome and transcriptome levels. The considerable differences between the DNA and the RNA sequences regarding their initiation codon allowed instigating the presence of RNA editing phenomena. Putting it all together, these singular events are expected to yield a better comprehension of the genome functioning. It is, therefore, necessary to understand in which ways these differences may be connected and if they influence the genome. Posterior studies resorting to new techniques of the omics era can provide new insights on this matter. .

El fenómeno evolutivo histórico e irreversible es necesario conocerlo para comprender el resultado de la especiación y la diversificación de especies en base a la actuación de diferentes factores evolutivos que actúan, en muchas ocasiones, interdependientemente. En el estudio de dicho fenómeno se comprueban las diferentes pruebas que evidencian los agentes de presión selectiva en relación a las adaptaciones biológicas. La teoría evolutiva del Neodarwinismo argumenta, de manera muy convincente, el proceso evolutivo que pasa cada especie en la Biosfera. The historical and irreversible evolutionary phenomenon is necessary to know to understand the result of speciation and diversification of species based on the performance of different evolutionary factors acting on many occasions, interdependently. In the study of this phenomenon the different tests that show selective pressure agents in relation to biological adaptations are checked. The evolutionary theory of Neo-Darwinism argues, very convincingly, the evolutionary process that happens every species in the biosphere.

Mestrado em Biomedicina Molecular Submitted by Cristina Santos (cmaria@ua.pt) on 2017-04-04T14:25:09Z No. of bitstreams: 1 Tese de Mestrado - Carolina Lobato - Biomedicina Molecular - UA.pdf: 1916505 bytes, checksum: 50ac7e0ef097a90ce500af9b55c8d666 (MD5) Made available in DSpace on 2017-04-04T14:25:10Z (GMT). No. of bitstreams: 1 Tese de Mestrado - Carolina Lobato - Biomedicina Molecular - UA.pdf: 1916505 bytes, checksum: 50ac7e0ef097a90ce500af9b55c8d666 (MD5) Previous issue date: 2016

INTRODUÇÃO: TCF7L2 é um fator de transcrição envolvido na sinalização Wnt/beta-catenina e tem uma variante conhecida por associar-se consistentemente com o risco de diabetes tipo 2. Alguns estudos também relataram sua associação com o risco de alguns tipos de câncer. OBJETIVO: Como essa via pode também estar envolvida na fisiopatologia de outras doenças inflamatórias crônicas, tais como artrite reumatoide, o objetivo deste estudo foi investigar o efeito do polimorfismo rs7903146 do gene TCF7L2 na gravidade da artrite reumatoide em uma população brasileira. PACIENTES E MÉTODOS: Esse polimorfismo foi genotipado em 208 pacientes com artrite reumatoide e em 104 controles saudáveis. Analisou-se também a associação desse polimorfismo com história de tabagismo, classe funcional e indicadores radiológicos de gravidade da doença. RESULTADOS: A distribuição dos genótipos CC, CT e TT do polimorfismo rs7903146 do gene TCF7L2 não diferiu entre pacientes e controles, nem se encontrou qualquer associação entre o genótipo e os indicadores de gravidade da doença ou história de tabagismo. Quando os dados foram avaliados usando-se o modelo dominante, no qual portadores dos genótipos CT e TT foram agrupados, observou-se um aumento do alelo T em pacientes com fator reumatoide positivo e erosões, embora não significativo. A frequência do alelo T também estava aumentada nos pacientes com classe funcional II quando comparados àqueles com classe I (P = 0,032). CONCLUSÃO: É possível que o pequeno número de pacientes incluído neste estudo tenha dificultado achados adicionais. Outros estudos são, portanto, necessários para que se investigue o papel das variantes do gene TCF7L2 no risco de artrite reumatoide e sua gravidade. INTRODUCTION: TCF7L2 is a transcription factor involved in Wnt/beta-catenin signaling and which has a variant known to be consistently associated with type 2 diabetes risk and some studies have also indicated its association with risk of certain types of cancer. OBJECTIVE: Since this pathway may be involved in the pathophysiology of other chronic inflammatory diseases such as rheumatoid arthritis, we aimed to investigate the effect of TCF7L2 polymorphism rs7903146 on rheumatoid arthritis severity in a Brazilian population. PATIENTS AND METHODS: This polymorphism was genotyped in 208 patients with rheumatoid arthritis and in 104 healthy controls. We also analyzed the association of this polymorphism to smoking history, functional status classification and radiological indicators of disease severity. RESULTS: The distribution of CC, CT and TT genotypes of SNP rs7903146 of the TCF7L2 gene was not different between patients and controls, and no association between the genotype and indicators of disease severity or smoking history was found. When data were evaluated using the dominant model, in which carriers of the CT and TT genotypes were grouped, an increase in the T allele was observed in patients positive for rheumatoid factor and erosions, although this was not significant. The frequency of T allele was also increased in patients with functional class II compared to class I (P = 0.032). CONCLUSION: It is possible that the small number of patients included in this study may have restrained additional findings. Further studies are therefore needed to investigate the role of TCF7L2 gene variants in the risk of rheumatoid arthritis and its severity.

Mestrado em Biologia Molecular e Celular Recent evidences indicate that tRNA modifications and tRNA modifying enzymes may play important roles in complex human diseases such as cancer, neurological disorders and mitochondrial-linked diseases. We postulate that expression deregulation of tRNA modifying enzymes affects the level of tRNA modifications and, consequently, their function and the translation efficiency of their tRNA corresponding codons. Due to the degeneracy of the genetic code, most amino acids are encoded by two to six synonymous codons. This degeneracy and the biased usage of synonymous codons cause alterations that can span from protein folding to enhanced translation efficiency of a select gene group. In this work, we focused on cancer and performed a meta-analysis study to compare microarray gene expression profiles, reported by previous studies and evaluate the codon usage of different types of cancer where tRNA modifying enzymes were found de-regulated. A total of 36 different tRNA modifying enzymes were found de-regulated in most cancer datasets analyzed. The codon usage analysis revealed a preference for codons ending in AU for the up-regulated genes, while the down-regulated genes show a preference for GC ending codons. Furthermore, a PCA biplot analysis showed this same tendency. We also analyzed the codon usage of the datasets where the CTU2 tRNA modifying enzyme was found deregulated as this enzyme affects the wobble position (position 34) of specific tRNAs. Our data points to a distinct codon usage pattern between up and downregulated genes in cancer, which might be caused by the deregulation of specific tRNA modifying enzymes. This codon usage bias may augment the transcription and translation efficiency of some genes that otherwise, in a normal situation, would be translated less efficiently. Estudos recentes indicam que as modificações de tRNAs e as enzimas modificadoras de tRNAs desempenham papéis importantes em doenças Humanas complexas como são exemplos: cancro, doenças neurológicas e mitocondriais. Conjecturamos que a desregulação na expressão das enzimas modificadoras de tRNAs afecta o nível de modificações dos tRNAs e, consequentemente, as suas funções e eficiência de tradução dos codões correspondentes aos tRNAs que afectam. Devido à degeneração do código genético, a maior parte dos aminoácidos são codificados por dois a seis codões sinónimos. Esta degeneração e o uso tendencioso de codões sinónimos causam alterações que podem ir desde problemas de enovelamento proteico a um aumento de eficiência de tradução de um grupo de genes específico. Neste trabalho, focámo-nos no cancro e fizemos um estudo de metaanálise para comparar perfis de expressão génica de microarrays, onde foram encontradas enzimas modificadoras de tRNA desreguladas e analisar o codon usage dos diferentes tipos de cancro nestes dados, reportados em estudos anteriores. Encontrámos um total de 36 diferentes enzimas modificadoras de tRNAs que se encontram desreguladas na maior parte das datasets de cancro analisadas. A análise de codon usage revelou uma preferência, por parte dos genes sobre-expressos, por codões acabados em AU e uma preferência por codões acabados em GC, em genes sub-expressos. Uma subsequente análise de PCA biplot veio mostrar esta mesma tendência. Analisámos também o codon usage de datasets onde a enzima modificadora de tRNA CTU2 se encontrava desregulada uma vez que esta enzima afecta a posição “wobble” (posição 34) de tRNAs específicos. Os nossos dados apontam para um padrão de codon usage distinto entre genes sobre-expressos e sub-expressos em cancro, que pode ser causado pela desregulação de enzimas modificadores de tRNA específicas. Esta tendência de codon usage pode aumentar a transcrição e eficiência de tradução de alguns genes que, de outra forma, numa situação normal, seriam traduzidos de forma menos eficiente.

Mestrado em Biologia Molecular e Celular Submitted by Alexandra Bastos (alexandrabastos@ua.pt) on 2016-08-30T14:33:45Z No. of bitstreams: 1 tese.pdf: 3074084 bytes, checksum: ca25810fda24ba025e17ee2240df270f (MD5) Made available in DSpace on 2016-08-30T14:33:45Z (GMT). No. of bitstreams: 1 tese.pdf: 3074084 bytes, checksum: ca25810fda24ba025e17ee2240df270f (MD5) Previous issue date: 2015-12-16

Mestrado em Biomedicina Molecular The non-standard decoding of the CUG codon in Candida cylindracea raises a number of questions about the evolutionary process of this organism and other species Candida clade for which the codon is ambiguous. In order to find some answers we studied the transcriptome of C. cylindracea, comparing its behavior with that of Saccharomyces cerevisiae (standard decoder) and Candida albicans (ambiguous decoder). The transcriptome characterization was performed using RNA-seq. This approach has several advantages over microarrays and its application is booming. TopHat and Cufflinks were the software used to build the protocol that allowed for gene quantification. About 95% of the reads were mapped on the genome. 3693 genes were analyzed, of which 1338 had a non-standard start codon (TTG/CTG) and the percentage of expressed genes was 99.4%. Most genes have intermediate levels of expression, some have little or no expression and a minority is highly expressed. The distribution profile of the CUG between the three species is different, but it can be significantly associated to gene expression levels: genes with fewer CUGs are the most highly expressed. However, CUG content is not related to the conservation level: more and less conserved genes have, on average, an equal number of CUGs. The most conserved genes are the most expressed. The lipase genes corroborate the results obtained for most genes of C. cylindracea since they are very rich in CUGs and nothing conserved. The reduced amount of CUG codons that was observed in highly expressed genes may be due, possibly, to an insufficient number of tRNA genes to cope with more CUGs without compromising translational efficiency. From the enrichment analysis, it was confirmed that the most conserved genes are associated with basic functions such as translation, pathogenesis and metabolism. From this set, genes with more or less CUGs seem to have different functions. The key issues on the evolutionary phenomenon remain unclear. However, the results are consistent with previous observations and shows a variety of conclusions that in future analyzes should be taken into consideration, since it was the first time that such a study was conducted. A descodificação não-standard do codão CUG na Candida cylindracea levanta uma série de questões sobre o processo evolutivo deste organismo e de outras espécies do subtipo Candida para as quais o codão é ambíguo. No sentido de encontrar algumas respostas procedeu-se ao estudo do transcriptoma de C. cylindracea, comparando o seu comportamento com o de Saccharomyces cerevisiae (descodificador standard) e de Candida albicans (descodificador ambíguo). A caracterização do transcriptoma foi realizada a partir de RNA-seq. Esta metodologia apresenta várias vantagens em relação aos microarrays e a sua aplicação encontra-se em franca expansão. TopHat e Cufflinks foram os softwares utilizados na construção do protocolo que permitiu efectuar a quantificação génica. Cerca de 95% das reads alinharam contra o genoma. Foram analisados 3693 genes, 1338 dos quais com codão start não-standard (TTG/CTG) e a percentagem de genoma expresso foi de 99,4%. Maioritarimente, os genes têm níveis de expressão intermédios, alguns apresentam pouca ou nenhuma expressão e uma minoria é altamente expressa. O perfil de distribuição do codão CUG entre as três espécies é muito diferente, mas pode associar-se significativamente aos níveis de expressão: os genes com menos CUGs são os mais altamente expressos. Porém, o conteúdo em CUG não se relaciona com o nível de conservação: genes mais e menos conservados têm, em média, igual número de CUGs. Os genes mais conservados são os mais expressos. Os genes de lipases corroboram os resultados obtidos para os genes de C. cylindracea em geral, sendo muito ricos em CUGs e nada conservados. A quantidade reduzida de codões CUG que se observa em genes altamente expressos pode dever-se, eventualmente, a um número insuficiente de genes de tRNA para fazer face a mais CUGs sem comprometer a eficiência da tradução. A partir da análise de enriquecimento foi possível confirmar que os genes mais conservados estão associados a funções básicas como tradução, patogénese e metabolismo. Dentro destes, os genes com mais e menos CUGs parecem ter funções diferentes. As questões-chave sobre o fenómeno evolutivo permanecem por esclarecer. No entanto, os resultados são compatíveis com as observações anteriores e são apresentadas várias conclusões que em futuras análises devem ser tidas em consideração, já que foi a primeira vez que um estudo deste tipo foi realizado.

Made available in DSpace on 2015-10-06T13:02:52Z (GMT). No. of bitstreams: 0 Previous issue date: 2015-04-09. Added 1 bitstream(s) on 2015-10-06T13:19:24Z : No. of bitstreams: 1 000847289_20151210.pdf: 109983 bytes, checksum: 0805da618c3e8c3448f6b9e2d227a33b (MD5) Bitstreams deleted on 2015-12-11T11:22:37Z: 000847289_20151210.pdf,. Added 1 bitstream(s) on 2015-12-11T11:23:16Z : No. of bitstreams: 1 000847289.pdf: 738165 bytes, checksum: af1a367e9d0c1700d0efba7690754147 (MD5) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) Cromossomos B, também conhecidos como supernumerários, são considerados elementos dispensáveis ao organismo. Porém, alguns estudos têm apresentado evidências de uma possível funcionalidade destes cromossomos extras. São encontrados em muitas espécies de eucariotos, entre elas, Astatotilapia latifasciata, ciclídeo africano que possui de 1 a 2 cromossomos B. Os ciclídeos têm sido muito utilizados como organismos modelo para estudos genéticos e genômicos. Análises genômicas em larga escala prévias envolveram sequenciamento por next generation (Illumina HiSeq sequencing) de genomas sem cromossomo B (B-) e com cromossomo B (B+) de A. latifasciata e uma forma variante do gene hnRNP Q-like (Heterogeneous nuclear ribonucleoprotein Q-like) foi identificada. Esta sequência apresenta um alto número de cópias e características de retrogene no cromossomo B. Diante disso, foi objetivo do presente trabalho compreender a organização genômica, identificar os mecanismos de retro-inserção e fazer análises de expressão desta sequência, possibilitando um melhor entendimento da origem, evolução e possíveis efeitos deste cromossomo na espécie estudada. A partir de análises de bioinformática foram identificadas cópias variantes do gene hnRNP Q-like no genoma B+ e as regiões mais representativas foram selecionadas, de acordo com o grau de mutações, para demais estudos. Análises de fragmentos sequenciados e qPCR confirmaram que o gene possui maior número de cópias e ausência de íntrons no cromossomo B. Evidências de resquícios de domínios da transcriptase reversa de elementos transponíveis sugerem que o gene foi retroinserido no cromossomo B. Dados de qPCR em cDNA mostraram que, apesar de possuir mais cópias no genoma B+, o gene hnRNP Q-like não é diferencialmente expresso nos genomas B+ e B- B chromosomes, also known as supernumerary, are considered dispensable elements to organisms. However, some studies have presented evidences of a possible functionality of this extras chromosomes. They are observed in many eukaryote species, such as in the African cichlid, Astatotilapia latifasciata, which might have one or two B chromosomes. Cichlids have been used as model organisms to genetics and genomics studies. Previous genomic analyses based on next generation sequencing (Illumina HiSeq sequencing) were realized in the whole genome without B chromosome (B-) and with B chromosomes (B+) of A. latifasciata and a variant form of hnRNP Q-like (Heterogeneous nuclear ribonucleoprotein Q-like) gene was identified. This sequence presented a high copy number and characteristics of a retrogene in B chromosomes. Thus, the aim of this study consists in comprehend genomic organization, identify retroinsertion mechanisms and perform expression analyses of the hnRNP Q-like gene, making it possible a better understanding of origin, evolution and possible effects of this chromosomes in the studied species. Bioinformatics analyses identified variant copies of hnRNP Q-like gene in B+ genome and the higher and lower variable regions of the gene were selected, based in mutation rates, for further analysis. Analyses from sequenced fragments and qPCR confirmed gene has a higher number of copies and do not present introns in B chromosome. Evidences of transposable element relics with reverse transcriptase domains suggest gene was retroinserted in B chromosome. The data of qPCR in cDNA showed that the hnRNP Q-like gene is not differentially expressed in both genomes (with and without B chromosome)

Made available in DSpace on 2016-08-12T18:48:43Z (GMT). No. of bitstreams: 0 Previous issue date: 2015-04-08. Added 1 bitstream(s) on 2016-08-12T18:50:57Z : No. of bitstreams: 1 000865637.pdf: 1293456 bytes, checksum: d01165e048932b40382e97a518db2fc9 (MD5) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) A Tilápia do Nilo é uma espécie de grande relevância na aqüicultura mundial. Espécimes do sexo masculino têm maior crescimento quando comparado as fêmeas, uma característica importante em sistemas de produção de peixe. Infelizmente, os mecanismos envolvidos no desenvolvimento que levam à diferenciação sexual em peixes ainda são pouco compreendidos. Vários genes e miRNAs tem sido propostos como influênciadores desses processos, porém seu efetivo papel, permanece desconhecido. Considerando a importância biológica do desenvolvimento embrionário e determinação do sexo, microRNomas de tilápia do Nilo, expressos durante o desenvolvimento e em indivíduos machos e fêmeas adultos, foram analisados. Bibliotecas de pequenos RNAs foram geradas a partir de embriões de 3 e 5 dias pós fertilização (dpf), e cérebro e gônadas de indivíduos adultos de ambos os sexos, e seqüenciados via plataforma Illumina. Foram identificados 194 miRNAs já conhecidos com base em bancos de dados referência de zebrafish, sendo que destes 120 apresentaram expressão diferencial entre macho e fêmea de O. niloticus. Foram identificados ainda 74 novos miRNAs não presentes no banco de dados referência. Vinte e dois miRNAs foram testados por qPCR e cinco tiveram seus genes-alvo candidatos testados pelo ensaio de gene repórter da luciferase. Os resultados de qPCR mostraram que a expressão da família do miR-10 foi alta durante os períodos de 3 e 5dpf. Softwares de predição sugerem que essa família de miRNAs regula a expressão de membros dos genes Hox. Sendo assim, foram testados por qPCR e pelo ensaio do gene réporter da luciferase três genes dessa família: HoxA3a, HoxB3a e HoxD10a. Os resultados mostraram que miR-10b tem como alvos Hoxb3a e HoxD10a. Já na diferenciação do sexo, os resultados de qPCR apontaram uma alta expressão do miR-145-5p durante o desenvolvimento de embriões de fêmea, enquanto seu possível alvo, Sox9a, teve... The Nile tilapia is a species of great importance in world aquaculture. Male specimens have increased growth compared with females, an important feature in fish production systems. Unfortunately, the mechanisms involved in the development and sexual differentiation in fish are still poorly understood. Several genes and miRNAs have been reported as influencing these processes, but its effective role remains unknown. Given the biological importance of miRNAs to embryonic development and sex determination, microRNomes were analyzed during development and in adult male and female of O. niloticus. Small RNAs libraries were generated from 3 and 5 dpf embryos, and brain and gonads of adult specimens, and sequenced using Illumina platform. Out of 194 miRNAs identified based on zebrafish database, 120 showed differential expression between male and female of O. niloticus. Additionally, 74 new miRNAs not detected in zefrafish database were found. Twenty-two miRNAs were tested by qPCR and five had their target candidate genes tested by luciferase reporter gene assay. The qPCR results showed that miR-10 family expression was high during the periods of 3 and 5dpf. Prediction software suggested that this family of miRNAs regulate the Hox genes family members. Therefore, were tested by qPCR and luciferase gene reporter assay, three Hox genes: Hoxa3a, HoxB3a and HoxD10a. The results showed that miR-10b have Hoxb3a and HoxD10a as target. In sex differentiation, the results of qPCR showed a high expression of miR-145-5p during the development of female embryos, while its possible target, Sox9, decreased. Moreover, the miR-181a expression decreased and his target gene, Cyp191a increased. The luciferase gene reporter assay validated the Cyp19a1 as a direct target of miR-181a, and Sox9 as a target of miR-145-5p. Our data suggest that, as in other vertebrates, Hox genes are extremely important in the development of Nile tilapia and are regulated by miR-10 ...

Made available in DSpace on 2016-01-13T13:27:06Z (GMT). No. of bitstreams: 0 Previous issue date: 2015-02-23. Added 1 bitstream(s) on 2016-01-13T13:31:24Z : No. of bitstreams: 1 000856253.pdf: 1905468 bytes, checksum: 0755320f6337b87f7cf9b15473ead258 (MD5) Polistes versicolor é uma das espécies mais estudadas e conhecidas do gênero no Brasil. Ocorre em todo o território nacional, é bem adaptada ao ambiente antropizado, não possui diferenciação morfológica de castas e por isso seu sistema de hierarquia é baseado principalmente em aspectos comportamentais, distinguidos por atos de dominância e subordinação. Por alimentar suas larvas principalmente com proteína animal (maioria oriunda de lagartas de lepidópteros), as vespas do gênero, inclusive da presente espécie apresentam um grande potencial promissor como controladores biológicos, muitas vezes de pragas de cultivos agrícolas economicamente importantes para o homem. Dessa forma, o presente trabalho visou acompanhar características da biologia e dos processos associados à construção da hierarquia dos indivíduos da colônia com a finalidade de relacioná-las com seu comportamento forrageiro e as principais espécies de presas utilizadas na sua alimentação. Os resultados encontrados corroboram observações de estudos já realizados de que ninhos de P. versicolor exibem ambas estratégias de fundação - haplo e pleometrose -, bem como a assincronia dessas fundações, que ocorreram ao longo de grande período do ano (agosto - abril). Foi constatada também a presença dos chamados agregados de inverno ao longo da estação fria (maio - agosto). Observações pontuais realizadas acerca da formação da hierarquia e do comportamento forrageiro em alguns ninhos possibilitaram inferir que a vespa dominante é um dos indivíduos que mais exibem comportamentos agressivos contra outros, bem como é o que passa quase todo o tempo no ninho, sem realizar atividades de campo. A idade relativa das poedeiras variou entre ninhos, ora sendo uma das mais velhas, ora a mais nova, ou em níveis intermediários. A análise das viagens executadas pelas forrageiras permitiu associar que os diferentes recursos tendem a ser explorados em... Polistes versicolor is one of the most studied and known species of its genus in Brazil. It occurs throughout the national territory, is well adapted to human environment, lacks morphological caste differences and thus its hierarchical system is mainly based on behavioral features, distinguished by dominance/subordination acts. For feeding their larvae mainly with animal protein (most of them Lepidoptera caterpillars), Polistes wasps show great potential in biological control programs, possibly preying on some pests that attack economically important crops to men. This way, this study aimed to assess some biological features and processes related to hierarchy formation on P. versicolor colonies as well, in order to see their relationship with foraging activities. This work's outcomes show what many other studies have seen; queens found their nests either alone or in groups, and nest foundations are asynchronic, which can occur from August to April. One winter aggregation was observed during the cold season (May - August). Data collection on hierarchy formation and foraging behavior in some nests ensured us to say that the dominant wasp is one of the most aggressive individuals, and also spends most of its time at the comb, without leaving it. Relative age of these queens varied between nests; in some cases they were the oldest, in some the youngest and in some they presented intermediate ages. The trips executed by foragers allowed us to affirm that each resource shows a trend to be collected in specific periods along the day, depending on the colony needs. In average, water trips lasted less than other materials, while returns with animal protein lasted longer. It was not found any kind of relation between the position on ranking of wasps and the type of resource explored by each one. Some prey samples were genetically identified, most of them belonging to order Lepidoptera (7 families). Moreover, other four orders were recognized, ...

[EN]Veronica subsection Pentasepalae is a diploid–polyploid complex of c. 20 species distributed in Eurasia and North Africa, in which species boundaries are difficult to determine. Here, we present the first comprehensive phylogenetic analysis of V. subsection Pentasepalae based on nucleotide sequences [internal transcribed spacer (ITS) and the plastid trnH-psbA and ycf6-psbM spacers] combined with ploidy estimations. Our results support the monophyly of the subsection. Five well-supported clades are recovered in the ITS sequence analyses, corresponding to broad geographical areas. The causes of the extensive incongruence found between the ITS and plastid DNA datasets, namely incomplete lineage sorting and/or hybridization and polyploidization, are discussed. Most of the diploids traditionally recognized based on morphological characters and one tetraploid are each recovered as monophyletic by the ITS sequence analyses. The Balkan species V. kindlii is resurrected. DNA ploidy level for V. teucrioides is reported here for the first time (2x). Diploid populations have been found for V. orbiculata, which was previously thought to be only tetraploid. Past contact in the amphi-Adriatic area between V. orsiniana and V. orbiculata is suggested. Finally, molecular analyses show that diploid V. jacquinii and diploid V. orbiculata are unrelated. This study contributes to our understanding of the evolutionary history of polyploid complexes, especially those in southern Europe, and highlights the importance of using multiple lines of evidence to investigate species boundaries in such actively diversifying groups.

Here we characterize the low-noise regime of a stochastic model for a negative self-regulating binary gene. The model has two stochastic variables, the protein number and the state of the gene. Each state of the gene behaves as a protein source governed by a Poisson process. The coupling between the two gene states depends on protein number. This fact has a very important implication: There exist protein production regimes characterized by sub-Poissonian noise because of negative covariance between the two stochastic variables of the model. Hence the protein numbers obey a probability distribution that has a peak that is sharper than those of the two coupled Poisson processes that are combined to produce it. Biochemically, the noise reduction in protein number occurs when the switching of the genetic state is more rapid than protein synthesis or degradation. We consider the chemical reaction rates necessary for Poisson and sub-Poisson processes in prokaryotes and eucaryotes. Our results suggest that the coupling of multiple stochastic processes in a negative covariance regime might be a widespread mechanism for noise reduction.

Mestrado em Biologia Molecular e Celular Submitted by Alexandra Bastos (alexandrabastos@ua.pt) on 2016-03-24T16:18:07Z No. of bitstreams: 1 tese.pdf: 2918242 bytes, checksum: 2565442cb502b49d68d65732a25a5287 (MD5) Made available in DSpace on 2016-03-24T16:18:07Z (GMT). No. of bitstreams: 1 tese.pdf: 2918242 bytes, checksum: 2565442cb502b49d68d65732a25a5287 (MD5) Previous issue date: 2014-12-18

Mestrado em Biologia Molecular e Celular Although the genetic code is generally viewed as immutable, alterations to its standard form occur in the three domains of life. A remarkable alteration to the standard genetic code occurs in many fungi of the Saccharomycotina CTG clade where the Leucine CUG codon has been reassigned to Serine by a novel transfer RNA (Ser-tRNACAG). The host laboratory made a major breakthrough by reversing this atypical genetic code alteration in the human pathogen Candida albicans using a combination of tRNA engineering, gene recombination and forced evolution. These results raised the hypothesis that synthetic codon ambiguities combined with experimental evolution may release codons from their frozen state. In this thesis we tested this hypothesis using S. cerevisiae as a model system. We generated ambiguity at specific codons in a two-step approach, involving deletion of tRNA genes followed by expression of non-cognate tRNAs that are able to compensate the deleted tRNA. Driven by the notion that rare codons are more susceptible to reassignment than those that are frequently used, we used two deletion strains where there is no cognate tRNA to decode the rare CUC-Leu codon and AGG-Arg codon. We exploited the vulnerability of the latter by engineering mutant tRNAs that misincorporate Ser at these sites. These recombinant strains were evolved over time using experimental evolution. Although there was a strong negative impact on the growth rate of strains expressing mutant tRNAs at high level, such expression at low level had little effect on cell fitness. We found that not only codon ambiguity, but also destabilization of the endogenous tRNA pool has a strong negative impact in growth rate. After evolution, strains expressing the mutant tRNA at high level recovered significantly in several growth parameters, showing that these strains adapt and exhibit higher tolerance to codon ambiguity. A fluorescent reporter system allowing the monitoring of Ser misincorporation showed that serine was indeed incorporated and possibly codon reassignment was achieved. Beside the overall negative consequences of codon ambiguity, we demonstrated that codons that tolerate the loss of their cognate tRNA can also tolerate high Ser misincorporation. This raises the hypothesis that these codons can be reassigned to standard and eventually to new amino acids for the production of proteins with novel properties, contributing to the field of synthetic biology and biotechnology. O código genético é geralmente visto como imutável, no entanto várias alterações à sua forma padrão são conhecidas. Uma das mais notáveis acontece em várias espécies do género Candida, onde o codão Leu-CUG é descodificado como serina por um novo RNA transferência (Ser-tRNACAG). O laboratório de acolhimento fez um grande progresso ao reverter a alteração atípica do código genético do fungo patogénico humano C. albicans, usando uma combinação de tRNAs mutantes, recombinação genética e evolução forçada. Estes resultados levantaram a hipótese que as ambiguidades sintéticas do codão, combinadas com evolução experimental, poderem libertar os codões do seu estado fixo. Nesta tese testamos esta hipótese usando S. cerevisiae como modelo biológico. Geramos ambiguidade em codões específicos, de forma bifásica, envolvendo a deleção de genes de tRNA, seguida pela expressão de tRNAs não-cognatos capazes de compensar o tRNA eliminado. Tendo como base a ideia que os codões raros são mais suscetíveis a alterações que aqueles usados frequentemente, usamos duas estirpes knock-out, nas quais não existem os tRNAs cognatos capazes de descodificar os codões raros CUC-Leu e AGG-Arg. Exploramos então a vulnerabilidade destes codões pela construção de tRNAs mutantes que incorporam erradamente Ser nestes locais. Estas estirpes recombinantes foram evoluídas ao longo do tempo, usando evolução experimental. Apesar de ter havido um forte impacto negativo na taxa de crescimento de estirpes que expressam o tRNA mutante a altos níveis, esta expressão a baixos níveis teve pouco impacto no fitness celular. Descobrimos que não só a ambiguidade do codão, mas também destabilizações da pool de tRNAs endógenos têm um impacto negativo na taxa de crescimento. Após a evolução, as estirpes com elevada expressão do tRNA mutante recuperaram significativamente em vários parâmetros de crescimento, o que mostra que estas adaptam-se e exibem maior tolerância à ambiguidade do codão. Através do sistema repórter fluorescente desenvolvido monitorizamos a incorporação errónea de Ser, o que nos indica que a Ser está de facto a ser incorporada e que, possivelmente, a alteração da identidade do codão foi atingida. Apesar das consequências negativas gerais da ambiguidade do codão, demonstramos que os codões capazes de tolerar a perda do seu tRNA cognato, conseguem também tolerar a incorporação elevada de Ser. Isto levanta a hipótese que estes codões podem ser recodificados para outros aminoácidos naturais e/ou artificiais para a produção de proteínas com novas propriedades, contribuindo assim para o campo da Biologia Sintética e Biotecnologia.

Made available in DSpace on 2014-11-10T11:09:42Z (GMT). No. of bitstreams: 0 Previous issue date: 2014-04-29Bitstream added on 2014-11-10T11:58:43Z : No. of bitstreams: 1 000785259_20151215.pdf: 449253 bytes, checksum: f4a6d6fe60441eb1ed52e51fc3d8994b (MD5) Bitstreams deleted on 2015-12-15T10:52:35Z: 000785259_20151215.pdf,. Added 1 bitstream(s) on 2015-12-15T10:53:21Z : No. of bitstreams: 1 000785259.pdf: 441624 bytes, checksum: 15f9d5f63f3443d00a9a26ba9b0cd319 (MD5) O desenvolvimento das plantas depende da atividade de um grupo de células em divisão chamado de meristema. Extensas análises genéticas identificaram os principais reguladores do meristema apical vegetativo (SAM), os quais controlam o desenvolvimento de todos os órgãos aéreos. Dentre eles, há um grupo de homeoproteínas denominadas TALE (three-amino-acid-loop- extension); esta família contém os membros KNOTTED-like homeodomain (KNOX) e BELL-like Homeodomain (BELL), que funcionam como homodímeros ou heterodímeros, para regular a expressão de seus genes alvos mediante sua ligação à sequências especificas no DNA. Em plantas com folhas compostas como o tomateiro (Solanum lycopersicum), genes KNOX da classe I (KNOX I) são expressos no meristema, assim como também em folhas, flores e frutos, sugerindo que eles podem exercer várias funções nestes órgãos. Esta hipótese é corroborada pelos fenótipos intrigantes encontrados em mutantes com ganho de função dos genes KNOX I, cuja expressão ectópica afeta a forma da folha, pétala e frutos. Um exemplo é o tomateiro mutante Mouse ear (Me), que superexpressa o gene TKN2 (KNOX I). Fenótipos semelhantes também foram observados em plantas transgênicas superexpressando o microRNA156 (miR156). Os MicroRNAs são uma nova classe de pequenas moléculas de RNA não codantes (20-25 nucleotídeos) que se encontram amplamente distribuídos no genoma de plantas e animais, regulando a expressão de seus genes alvos principalmente ao nível pós-transcricional. O miR156 regula pós-transcricionalmente membros da família gênica do tipo SQUAMOSA Promoter-Binding Protein-Like (SPL ou SBP-box), os quais codificam fatores de transcrição específicos de plantas. Tais genes desempenham papéis importantes em diferentes aspectos do desenvolvimento. Para analisar a possível interação molecular entre o fator de transcrição TKN2 e a via microRNA156/SQUAMOS Promoter-Binding ... Plant development depends on the activity of a group of dividing cells called meristem. Extensive genetic analyses have identified the major regulators of the shoot apical meristem (SAM), which control the development of all aerial organs. Among them, the three-amino-acid- loop-extension (TALE) class of homeoproteins; this family contains the KNOTTED-like homeodomain (KNOX) and BELL-like Homeodomain (BELL) members, which function as heterodimers or homodimers, to regulate expression of their target genes by binding to specific sequences in DNA. In plants with compound leaves as tomato (Solanum lycopersicum), KNOX I are expressed in the meristem, as well as on leaves, flowers and fruits, suggesting that they may play various roles in these organs. This hypothesis is supported by the intriguing phenotypes found in mutants with gain-of function of KNOX I genes, whose ectopic expression affects leaf, petal and fruit shape. An example, is the tomato mutant Mouse ear (Me), which overexpress the gene TKN2 (KNOX I). Similar phenotypes were also observed in transgenic plants overexpressing microRNA156 (miR156). MicroRNAs are a class of small no-coding RNAs (20-25 nucleotides) that are widely distributed in the genome of plants and animals, regulating the expression of their target genes by acting mainly at the post-transcriptional level. miR156 regulated post-transcriptionally most SQUAMOSA Promoter-Binding Protein-Like (SPL or SBP-box) genes, which encode plant-specific transcription factors. These genes play important roles in different aspects of development. To examine a possible molecular interaction between TKN2 transcription factor and microRNA156/SQUAMOSA Promoter-Binding Protein-Like module (miR156 node), it was evaluated the expression of miR156, its targets (SBP-box) and several genes downstream of miR156 node in different stages of the development of homozygous Me plants. Moreover, to evaluate the genetic interaction ...