Search

info:eu-repo/semantics/publishedVersion

Additional file 5: Rat ears. Figure S7. Standard curve of L. infantum DNA. Standard curve obtained from a series of dilutions of L. infantum DNA (108 to 101 parasites). Each point was tested in triplicate. Slope = -3.47; efficacy = 94.1%; R2 = 0.998. Figure S8. Amplification curves. The plot showing the dilution of DNA concentrations (8 to 8 × 10-7 ng).

Additional file 4: Rat spleens. Figure S5. Standard curve of L. infantum DNA. Standard curve obtained from a series of dilutions of L. infantum DNA (108 to 101 parasites). Each point was tested in triplicate. Slope = -3.367; efficacy = 98.2%; R2 = 0.998. Figure S6. Amplification curves. The plot showing the dilution of DNA concentrations (8–8 × 10-7 ng).

Additional file 3: Sand flies. Figure S3. Standard curve of L. infantum DNA. Standard curve obtained from serial dilutions of L. infantum DNA (108 to 101 parasites). Each point was tested in triplicate. Slope = — 3.70; efficacy = 98 %; R2 = 0.991. Figure S4. Amplification curves. The plot showing the dilution of DNA concentrations (8 to 8 × 10-7 ng).

Additional file 1: Sequence of the 3'-UTR region. Figure S1. The 3'-UTR region of the HSP70 gene was amplified with primers 70-IR-D (5'- CCAAGGTCGAGGAGGAGGTCGAC TA-3') and 70-IR-M (5'-ACGGGTAGGGGGGGAGGAAAGA-3').

Additional file 2: Phylogenetic analysis. Figure S2. Phylogenetic tree using 3'-UTR sequences of the HSP70 gene.

El territorio madrileño —a pesar de su pequeñez— presenta unas características ambientales interesantes: gradiente altitudinal, litología compleja, lugares naturales de mucho interés y otros apenas conocidos, muchos ambientes artificiales, intensos impactos antrópicos... Un mundo limnológico pequeño, pero muy variado. El libro describe qué cosas se saben y cuáles no sobre la ecología acuática en la Comunidad de Madrid. Por lo tanto, tiene en cuenta el ambiente abiótico, los organismos y los procesos ecológicos, además de los aspectos aplicados. Respecto a los seres vivos, un rasgo fundamental es la riqueza de especies, a la que presta atención especial para inventariar lo conocido y sugerir qué habríamos de conocer. Los acelerados cambios que están generando las técnicas moleculares aplicadas a la taxonomía harán que las especies y su nomenclatura muten en poco tiempo, lo cual supondrá una novedad radical en los conocimientos sobre la diversidad de organismos en pocas décadas. Obviamente también, las nuevas técnicas ecológicas y los nuevos conceptos y teorías harán que la disciplina ecológica cambie y aumente en un futuro próximo. Este texto es fruto del trabajo de una generación de investigadores, buena parte de los cuales iniciaron sus estudios en la década de 1980. Algunos de ellos ya se han jubilado, y bastantes más están a punto de hacerlo. El libro ofrece, por tanto, un aspecto generacional que da cuenta, asimismo, de una manera de abordar la investigación.

Alien mosquito and vertebrate host species may create novel epidemiological scenarios for the transmission of pathogens naturally circulating in the invaded area. The exotic Monk parakeet (Myiopsitta monachus) has established populations in Europe and is currently considered an invasive pest. Due to their high abundance in urban areas, Monk parakeets could be involved in the transmission of pathogens, potentially affecting wildlife and livestock. To test this hypothesis, we determined the prevalence and diversity of three vector-borne parasites, namely Plasmodium, Haemoproteus and Leucocytozoon, in Monk parakeets from Barcelona. Many areas of southern Europe shelter high densities of the invasive Asian tiger mosquito Aedes albopictus, which in addition to native mosquito species could affect the transmission of mosquito-borne parasites, such as avian Plasmodium. Thus, we also sampled mosquitoes in the area to trace their blood-feeding hosts and determine the presence of Plasmodium parasites. Monk parakeets were neither infected by Plasmodium nor by Haemoproteus parasites, and only five individuals (3.13%; n = 160) were infected by Leucocytozoon. Monk parakeets were bitten by Culiseta longiareolata and represented 9.5% of Culex pipiens blood meals. The invasive Ae. albopictus showed a clear anthropophilic feeding pattern, with humans dominating its diet. Three Plasmodium lineages were detected in pools of Cx pipiens. These results suggest that Plasmodium circulating in the area cannot develop in the invasive Monk parakeet, in spite of the relatively high fraction of native mosquito vectors feeding on this species in its invaded distribution range. Alien mosquito and vertebrate host species may create novel epidemiological scenarios for the transmission of pathogens naturally circulating in the invaded area. The exotic Monk parakeet (Myiopsitta monachus) has established populations in Europe and is currently considered an invasive pest. Due to their high abundance in urban areas, Monk parakeets could be involved in the transmission of pathogens, potentially affecting wildlife and livestock. To test this hypothesis, we determined the prevalence and diversity of three vector-borne parasites, namely Plasmodium, Haemoproteus and Leucocytozoon, in Monk parakeets from Barcelona. Many areas of southern Europe shelter high densities of the invasive Asian tiger mosquito Aedes albopictus, which in addition to native mosquito species could affect the transmission of mosquito-borne parasites, such as avian Plasmodium. Thus, we also sampled mosquitoes in the area to trace their blood-feeding hosts and determine the presence of Plasmodium parasites. Monk parakeets were neither infected by Plasmodium nor by Haemoproteus parasites, and only five individuals (3.13%; n = 160) were infected by Leucocytozoon. Monk parakeets were bitten by Culiseta longiareolata and represented 9.5% of Culex pipiens blood meals. The invasive Ae. albopictus showed a clear anthropophilic feeding pattern, with humans dominating its diet. Three Plasmodium lineages were detected in pools of Cx pipiens. These results suggest that Plasmodium circulating in the area cannot develop in the invasive Monk parakeet, in spite of the relatively high fraction of native mosquito vectors feeding on this species in its invaded distribution range. Alien mosquito and vertebrate host species may create novel epidemiological scenarios for the transmission of pathogens naturally circulating in the invaded area. The exotic Monk parakeet (Myiopsitta monachus) has established populations in Europe and is currently considered an invasive pest. Due to their high abundance in urban areas, Monk parakeets could be involved in the transmission of pathogens, potentially affecting wildlife and livestock. To test this hypothesis, we determined the prevalence and diversity of three vector-borne parasites, namely Plasmodium, Haemoproteus and Leucocytozoon, in Monk parakeets from Barcelona. Many areas of southern Europe shelter high densities of the invasive Asian tiger mosquito Aedes albopictus, which in addition to native mosquito species could affect the transmission of mosquito-borne parasites, such as avian Plasmodium. Thus, we also sampled mosquitoes in the area to trace their blood-feeding hosts and determine the presence of Plasmodium parasites. Monk parakeets were neither infected by Plasmodium nor by Haemoproteus parasites, and only five individuals (3.13%; n = 160) were infected by Leucocytozoon. Monk parakeets were bitten by Culiseta longiareolata and represented 9.5% of Culex pipiens blood meals. The invasive Ae. albopictus showed a clear anthropophilic feeding pattern, with humans dominating its diet. Three Plasmodium lineages were detected in pools of Cx pipiens. These results suggest that Plasmodium circulating in the area cannot develop in the invasive Monk parakeet, in spite of the relatively high fraction of native mosquito vectors feeding on this species in its invaded distribution range.

Se presentan los procedimientos de vigilancia y control diseñados e implementados por los servicios municipales de control de plagas del Ayuntamiento de Madrid, ante la comunicación de un foco privado de una cucaracha exótica, Periplaneta australasiae (Fabricius, 1775), en la ciudad en abril de 2018. La exhaustiva monitorización llevada a cabo en áreas públicas de titularidad municipal, ha permitido la captura de una hembra adulta de la especie en un pozo de alcantarillado en el período comprendido entre mayo y septiembre 2018 en el que se desarrolló el estudio. Los resultados de los tratamientos de control efectuados, la importancia de la colaboración público-privada en la gestión de la especie y la discusión acerca de las posibles dificultades que pueda encontrar el insecto para colonizar y expandirse a gran escala a través de la red de alcantarillado municipal a tenor de las variables ambientales recopiladas y analizadas de estos enclaves del subsuelo de la ciudad, se discuten con detalle en el artículo. After the presence of the exotic Australian cockroach species Periplaneta australasiae (Fabricius, 1775) was detected in a private building in Madrid and reported in April 2018, the city council’s pest control services designed and implemented a comprehensive surveillance and control program to identify potentially infested public areas and eradicate the species in the said areas.The exhaustive monitoring carried out in public areas under city management led to the capture of an adult P. australasiae female inside a sewer manhole during the study period (May-September 2018).This paper discusses in detail the results of the pest control treatments that have been carried out, the significance of public-private collaboration for properly managing this species, and the difficulties this insect may encounter in colonizing and expanding widely throughout the municipal sewer system based on the analysis of the values of various environmental variables that were measured at these locations of the city’s underground. Apresentam-se os procedimentos de vigilância e controlo desenhados e implementados pelos serviços municipais de controlo de pragas do Município de Madrid, face à comunicação de um foco infestante de uma barata exótica, Periplaneta australasiae (Fabricius, 1775), na cidade em abril de 2018. A exaustiva monitorização levada a cabo em áreas públicas de domínio municipal, permitiram a captura de uma fêmea adulta da espécie numa caixa de visita do sistema de drenagem de águas residuais, no período em que se desenvolveu o estudo, compreendido entre maio e setembro de 2018. São discutidos em detalhe neste artigo os resultados dos procedimentos de controlo efetuados, a importância da colaboração público-privada na gestão da espécie e a discussão sobre as possíveis dificuldades que o inseto pode encontrar para colonizar e expandir em larga escala através da rede municipal de esgotos de acordo com as variáveis ambientais, recolhidas e analisadas, nesses enclaves do subsolo da cidade.