Search

Intracellular pathogens are challenged with limited space and resources while replicating in a single host cell. Mechanisms for direct invasion of neighboring host cells have been discovered in cell culture, but we lack an understanding of how bacteria directly spread between host cells in vivo. Here, we describe the discovery of intracellular bacteria that use filamentation for spreading between the intestinal epithelial cells of a natural host, the rhabditid nematode Oscheius tipulae. The bacteria, which belong to the new species Bordetella atropi, can infect the nematodes following a fecal-oral route, and reduce host life span and fecundity. Filamentation requires UDP-glucose biosynthesis and sensing, a highly conserved pathway that is used by other bacteria to detect rich conditions and inhibit cell division. Our results indicate that B. atropi uses a pathway that normally regulates bacterial cell size to trigger filamentation inside host cells, thus facilitating cell-to-cell dissemination., (© 2022. The Author(s).)

Bacterial contamination remains the most important infectious risk of platelet transfusion. After an initially positive result, a second test is performed on the blood products and the initial culture bottle to confirm the contamination. Based on the blood center's decision algorithm used, results can be either confirmed negative, positive, or indeterminate, or be unconfirmed or discordant. Here, we report the first cases of platelet concentrates contaminated with Bordetella holmesii The in vitro growth characteristics of this unusual contaminant in platelet concentrate were investigated. Two B. holmesii strains isolated from platelet concentrates, as well as a control strain ( Serratia marcescens ), were spiked into platelet concentrates (PCs) at 1 and 10 CFU/ml. PCs were stored at 20 to 24°C under agitation. Samples were collected on days 2, 3, 4, and 7 for colony count and for bacterial screening using the BacT/Alert 3D system. Two PCs were detected as being positive for B. holmesii However, recultures were negative. In vitro , B. holmesii did not grow but remained detectable in PCs. Its viability diminished rapidly in contact with human plasma. Upon screening using the BacT/Alert 3D system, the majority of products spiked with B. holmesii were negative. This is the first description of PCs contaminated with B. holmesii This bacterium survives in blood products and remains dormant at low concentrations in blood products stored at room temperature, thus making difficult its detection with the BacT/Alert 3D system. The present definition of a true-positive culture of PCs may be overly restrictive for certain bacterial strains., (Copyright © 2018 American Society for Microbiology.)

Poly-β(1,6)-N-acetyl-D-glucosamine (PNAG) is a major biofilm component of many pathogenic bacteria. The production, modification, and export of PNAG in Escherichia coli and Bordetella species require the protein products encoded by the pgaABCD operon. PgaB is a two-domain periplasmic protein that contains an N-terminal deacetylase domain and a C-terminal PNAG binding domain that is critical for export. However, the exact function of the PgaB C-terminal domain remains unclear. Herein, we show that the C-terminal domains of Bordetella bronchiseptica PgaB (PgaBBb) and E. coli PgaB (PgaBEc) function as glycoside hydrolases. These enzymes hydrolyze purified deacetylated PNAG (dPNAG) from Staphylococcus aureus, disrupt PNAG-dependent biofilms formed by Bordetella pertussis, Staphylococcus carnosus, Staphylococcus epidermidis, and E. coli, and potentiate bacterial killing by gentamicin. Furthermore, we found that PgaBBb was only able to hydrolyze PNAG produced in situ by the E. coli PgaCD synthase complex when an active deacetylase domain was present. Mass spectrometry analysis of the PgaB-hydrolyzed dPNAG substrate showed a GlcN-GlcNAc-GlcNAc motif at the new reducing end of detected fragments. Our 1.76 Å structure of the C-terminal domain of PgaBBb reveals a central cavity within an elongated surface groove that appears ideally suited to recognize the GlcN-GlcNAc-GlcNAc motif. The structure, in conjunction with molecular modeling and site directed mutagenesis led to the identification of the dPNAG binding subsites and D474 as the probable catalytic acid. This work expands the role of PgaB within the PNAG biosynthesis machinery, defines a new glycoside hydrolase family GH153, and identifies PgaB as a possible therapeutic agent for treating PNAG-dependent biofilm infections.

Introduction: Mixed-species biofilms constitute a reservoir of infection for a group of bacteria and yeasts that coexist on the same support. Peripheral venous catheters make up a good surface for the attachment of microorganisms that promote biofilm formation and this requires complex strategies for antimicrobial treatments., Objective: No such studies on formation mixed biofilms have ever been conducted in Algeria. Therefore, we evaluated the potential for the formation of mixed-species biofilms by Candida albicans and some bacterial species isolated from peripheral vascular catheters at the University Hospital of Tlemcen, in Algeria., Results: The results obtained showed that C. albicans have the potential to form mixed biofilms with three bacteria (Enterobacter cloacae, Bordetella spp. and Serratia liquefaciens) isolated from the same catheter as the yeasts. The amount of biofilms produced varies depending on the species and the composition of the growth medium. Observations by scanning electron microscopy showed that the structure of the mixed biofilm depends on the surface support the biofilm was formed on, and varies with the species., Conclusion: A competition was noted between bacteria and yeasts; it depends on the composition of the medium and its pH, which both play an important role in promoting the dominance of one over the other., (Copyright © 2015. Published by Elsevier Masson SAS.)

Pathogens evolve in specific host niches and microenvironments that provide the physical and nutritional requirements conducive to their growth. In addition to using the host as a source of food, bacterial pathogens must avoid the immune response to their presence. The mammalian upper respiratory tract is a site that is exposed to the external environment, and is readily colonized by bacteria that live as resident flora or as pathogens. These bacteria can remain localized, descend to the lower respiratory tract, or traverse the epithelium to disseminate throughout the body. By virtue of their successful colonization of the respiratory epithelium, these bacteria obtain the nutrients needed for growth, either directly from host resources or from other microbes. This chapter describes the upper respiratory tract environment, including its tissue and mucosal structure, prokaryotic biota, and biochemical composition that would support microbial life. Neisseria meningitidis and the Bordetella species are discussed as examples of bacteria that have no known external reservoirs but have evolved to obligately colonize the mammalian upper respiratory tract.

A putative operon encoding an uncharacterized ferrous iron transport (FtrABCD) system was previously identified in cDNA microarray studies. In growth studies using buffered medium at pH values ranging from pH 6.0 to 7.6, Bordetella pertussis and Bordetella bronchiseptica FtrABCD system mutants showed dramatic reductions in growth yields under iron-restricted conditions at pH 6.0, but had no growth defects at pH 7.6. Supplementation of culture medium with 2 mM ascorbate reductant was inhibitory to alcaligin siderophore-dependent growth at pH 7.6, but had a neglible effect on FtrABCD system-dependent iron assimilation at pH 6.0 consistent with its predicted specificity for ferrous iron. Unlike Bordetella siderophore-dependent and haem iron transport systems, and in agreement with its hypothesized role in transport of inorganic iron from periplasm to cytoplasm, FtrABCD system function did not require the TonB energy transduction complex. Gene fusion analysis revealed that ftrABCD promoter activity was maximal under iron-restricted growth conditions at acidic pH. The pH of human airway surface fluids ranges from pH 5.5 to 7.9, and the FtrABCD system may supply ferrous iron necessary for Bordetella growth in acidic host microenvironments in which siderophores are ineffective for iron retrieval., (© 2012 Blackwell Publishing Ltd.)

We analyzed the microbial diversity and quantity of nitrifying bacteria in the enrichment reactor by Terminal Restriction Fragment Length Polymorphism (T_RFLP), a cultured-independent molecular technique. The result indicated that nitrobacteria enriched the best, and the diversity index decreased 62.80% compared with the initial data. Nitrobacteria were predominant in the reactor. Meanwhile, we studied the microbial diversity before and after adding Nitrobacteria into shrimp ponds, and analyzed several major bacterial species that existed stably in the pond. According to the analysis by T_RFLP program, species including Brevibacillus brevis, Microbacterium lactium, Azoarcus indigens and Bordetella holmesii were the dominant bacteria in the ponds.

We previously showed that the Bvg virulence control system regulates biofilm formation in Bordetella bronchiseptica (Y. Irie, S. Mattoo, and M. H. Yuk, J. Bacteriol. 186:5692-5698, 2004). Analyses of the extracellular components of B. bronchiseptica biofilm matrix revealed that the major sugar component in the matrix was xylose, and linkage analysis indicated a majority of it to be in a 4-linked polymeric form. The production of xylose was independent of Bvg regulation but instead was dependent on bacterial growth phase. In addition, N-acetyl-glucosamine in the matrix was found to be important for the initial development of the biofilm. These results suggest that B. bronchiseptica biofilm formation is growth phase dependent in addition to being regulated by the Bvg virulence system.

Apparent competition between species is believed to be one of the principal driving forces that structure ecological communities, although the precise mechanisms have yet to be characterized. Here we develop a model system that isolates phage-mediated interactions by neutralizing resource competition with a large excess of nutrients, and consists of two genetically identical Bordetella strains that differ only in that one is the carrier of phage and the other is susceptible to the phage. We observe and quantify the competitive advantage of the bacterial strain bearing the prophage in both invading and in resisting invasion by the bacterial strain sensitive to the phage, and use our experimental measurements to develop a mathematical model of phage-mediated competition. The model predicts, and experimental evidence confirms, that the competitive advantage conferred by the lysogenic phage depends only on the phage pathology on the sensitive bacterial strain and is independent of other phage and host parameters, such as the infection-causing contact rate, the spontaneous and infection-induced lysis rates and the phage burst size. This work combines experimental and mathematical approaches to the study of phage-driven competition, and provides an experimentally tested framework for evaluation of the effects of pathogens/parasites on interspecific competition.

A cellulose-degrading defined mixed culture (designated SF356) consisting of five bacterial strains (Clostridium straminisolvens CSK1, Clostridium sp. strain FG4, Pseudoxanthomonas sp. strain M1-3, Brevibacillus sp. strain M1-5, and Bordetella sp. strain M1-6) exhibited both functional and structural stability; namely, no change in cellulose-degrading efficiency was observed, and all members stably coexisted through 20 subcultures. In order to investigate the mechanisms responsible for the observed stability, "knockout communities" in which one of the members was eliminated from SF356 were constructed. The dynamics of the community structure and the cellulose degradation profiles of these mixed cultures were determined in order to evaluate the roles played by each eliminated member in situ and its impact on the other members of the community. Integration of each result gave the following estimates of the bacterial relationships. Synergistic relationships between an anaerobic cellulolytic bacterium (C. straminisolvens CSK1) and two strains of aerobic bacteria (Pseudoxanthomonas sp. strain M1-3 and Brevibacillus sp. strain M1-5) were observed; the aerobes introduced anaerobic conditions, and C. straminisolvens CSK1 supplied metabolites (acetate and glucose). In addition, there were negative relationships, such as the inhibition of cellulose degradation by producing excess amounts of acetic acid by Clostridium sp. strain FG4, and growth suppression of Bordetella sp. strain M1-6 by Brevibacillus sp. strain M1-5. The balance of the various types of relationships (both positive and negative) is thus considered to be essential for the stable coexistence of the members of this mixed culture.

Bioremediation of toluene and naphthalene in liquid cultures of bacteria grown in the presence of these aromatic compounds as unique sources of carbon was investigated by gas chromatography (GC). For this purpose, a method based on the use of GC with flame ionization detection was developed and validated. Validation was carried out in terms of limit of detection (LOD), limit of quantitation (LOQ), linearity, precision and trueness. In the case of naphthalene, LOD and LOQ values of 0.43 and 0.72 mg kg(-1) were achieved. Linearity was established over one order of magnitude in the range of interest, i.e. 10-100 mg kg(-1). Excellent precision was obtained both in terms of intra-day repeatability and between-day precision on two concentration levels (RSD% lower than 0.5%). A recovery of 97.9 +/- 0.2% (n=3) was calculated by addition of 640 mg kg(-1) of naphthalene to the Bushnell & Haas mineral salts basal solution containing the micro-organisms. Findings clearly showed a reduction of the naphthalene content equal to 50% and 75% after two and four weeks of contact with the micro-organisms, whereas a lower degradation was shown in the case of toluene. Finally bioremediation activity was ascribed to two different microbial populations, Bordetella Petrii and Bacillus Sphericus, which survived in the polluted medium.

Pertussis vaccine development has mainly focused on Bordetella pertussis, and consequently these vaccines contain B. pertussis antigens only. However, the related species Bordetella parapertussis can also cause pertussis, although symptoms associated with the disease are generally considered to be milder. Recent field studies have shown that in some outbreaks B. parapertussis can prevail. Using a mouse model we compared the efficacy against B. parapertussis of two commercially available acellular vaccines and two whole cell vaccines, used in The Netherlands and Finland, respectively. The efficacies of the two whole cell vaccines against B. parapertussis were similar, but much lower compared to the efficacy against B. pertussis. Although, the acellular vaccines conferred some protection against B. parapertussis early in infection, the values were not significant. Later in infection, a highly significant enhancement of colonisation by B. parapertussis was observed in mice vaccinated with acellular vaccines. The whole cell vaccines protected significantly better than the acellular vaccines against B. parapertussis. The possible consequences of a switch from whole cell to acellular vaccines was discussed in the light of our findings.

Genes involved in iron (Fe) acquisition often are regulated in response to the local availability of Fe. In many bacteria, Fe-dependent responsiveness is mediated by Fur, a global Fe-dependent transcriptional repressor. Tighter regulatory control of Fur-responsive genes is afforded by incorporating additional regulators into Fur-dependent regulatory cascades. RhuI, a Fur-dependent extracytoplasmic function sigma factor of Bordetella avium, in response to the dual stimulation of Fe starvation and the presence of heme (or hemoproteins), regulates P(bhuR), a heme-responsive promoter which directs expression of the bhuRSTUV heme utilization operon. While BhuR, the outer membrane heme receptor, and RhuI have been shown to be indispensable for heme-dependent activation of P(bhuR), collateral components of the regulatory cascade have not been described. In this investigation, RhuR, an integral cytoplasmic membrane protein with homology to anti-sigma factors, is shown to be an essential activator of P(bhuR) expression. The functional domain of RhuR required for heme-dependent activation of P(bhuR) expression was mapped to the N-terminal 97 amino acids of the protein by use of a chimeric RhuR-BlaM fusion. Expression of the chimera in a rhuR mutant rendered P(bhuR) constitutive, thereby decoupling the promoter from heme dependency. Growth studies confirmed that B. avium requires RhuR for optimal utilization of hemoglobin, but not hemin, as a sole source of nutrient Fe. These data imply that B. avium expresses, in addition to the BhuR heme/hemoprotein utilization system, an alternative RhuR-independent heme utilization mechanism. A model is proposed in which RhuR is the functional bridge between BhuR and RhuI in a heme-dependent regulatory cascade.

The genomes of three closely related bordetellae are currently being sequenced, thus providing an opportunity for comparative genomic approaches driven by an understanding of the comparative biology of these three bacteria. Although the other strains being sequenced are well studied, the strain of Bordetella parapertussis chosen for sequencing is a recent human clinical isolate (strain 12822) that has yet to be characterized in detail. This investigation reports the first phenotypic characterization of this strain, which will likely become the prototype for this species in comparison with the prototype strains of B. pertussis (Tohama I), B. bronchiseptica (RB50), and other isolates of B. parapertussis. Multiple in vitro and in vivo assays distinguished each species. B. parapertussis was more similar to B. bronchiseptica than to B. pertussis in many assays, including in BvgS signaling characteristics, presence of urease activity, regulation of urease expression by BvgAS, virulence in the respiratory tracts of immunocompromised mice, induction of anti-Bordetella antibodies, and serum antimicrobial resistance. In other assays, B. parapertussis was distinct from all other species (in pigment production) or more similar to B. pertussis (by lack of motility and cytotoxicity to a macrophage-like cell line). These results begin to provide phenotypes that can be related to genetic differences identified in the genomic sequences of bordetellae.

We isolated two insertion mutants of Bordetella avium that exhibited a peculiar clumped-growth phenotype and found them to be attenuated in turkey tracheal colonization. The mutants contained transposon insertions in homologues of the wlbA and wlbL genes of Bordetella pertussis. The wlb genetic locus of B. pertussis has been previously described as containing 12 genes involved in lipopolysaccharide (LPS) biosynthesis. Polyacrylamide gel analysis of LPS from B. avium wlbA and wlbL insertion mutants confirmed an alteration in the LPS profile. Subsequent cloning and complementation of the wlbA and wlbL mutants in trans with a recombinant plasmid containing the homologous wlb locus from B. avium eliminated the clumped-growth phenotype and restored the LPS profile to that of wild-type B. avium. Also, a parental level of tracheal colonization was restored to both mutants by the recombinant plasmid. Interestingly, complementation of the wlbA and wlbL mutants with a recombinant plasmid containing the heterologous wlb locus from B. pertussis, B. bronchiseptica, or Bordetella parapertussis eliminated the clumped-growth phenotype and resulted in a change in the LPS profile, although not to that of wild-type B. avium. The mutants also acquired resistance to a newly identified B. avium-specific bacteriophage, Ba1. Complementation of both wlbA and wlbL mutants with the homologous wlb locus of B. avium, but not the heterologous B. pertussis locus, restored sensitivity to Ba1. Complementation of the wlbL mutant, but not the wlbA mutant, with the heterologous wlb locus of Bordetella bronchiseptica or B. parapertussis restored partial sensitivity to Ba1. Comparisons of the LPS profile and phage sensitivity of the mutants upon complementation by wlb loci from the heterologous species and by B. avium suggested that phage sensitivity required the presence of O-antigen. At the mechanistic level, both mutants showed a dramatic decrease in serum resistance and a decrease in binding to turkey tracheal rings in vitro. In the case of serum resistance, complementation of both mutants with the homologous wlb locus of B. avium restored serum resistance to wild-type levels. However, in the case of epithelial cell binding, only complementation of the wlbA mutant completely restored binding to wild-type levels (binding was only partially restored in the wlbL mutant). This is the first characterization of LPS mutants of B. avium at the genetic level and the first report of virulence changes by both in vivo and in vitro measurements.

Iron starvation of Bordetella avium induced expression of five outer membrane proteins with apparent molecular masses of 95, 92, 91.5, 84, and 51 kDa. Iron-responsive outer membrane proteins (FeRPs) of similar sizes were detected in six of six strains of B. avium, suggesting that the five FeRPs are common constituents of the outer membrane of most, if not all, strains of B. avium. Iron-regulated genes of B. avium were targeted for mutagenesis with the transposon TnphoA. Two mutants with iron-responsive alkaline phosphatase activities were isolated from the transposon library. The transposon insertion did not alter the iron-regulated expression of the five FeRPs in mutant Pho-6. The mutant Pho-20 exhibited a loss in expression of the 95-kDa FeRP and the 84-kDa FeRP. Both Pho-6 and Pho-20 were able to use free iron as a nutrient source. However, Pho-20 was severely compromised in its ability to use iron present in turkey serum. The data indicated that the mutation in Pho-20 affected expression of one or more components of an uptake machinery that is involved in acquisition of iron from organic ferricomplexes.

LPSs play an important role in bacterial pathogenesis. In this study, the LPS expression of the seven known Bordetella species and its dependency on growth temperature was analysed by oxidative silver staining of proteinase-K-treated whole bacteria separated by Tricine-SDS-PAGE. The bordetellae were found to have extensively variable LPS in a species-specific way. In addition, the human and ovine Bordetella parapertussis strains exhibited host-specific LPS expression. LPSs from human B. parapertussis strains grown at 37 and 25 degrees C were distinct. Growth temperature also affected LPS production by several Bordetella bronchiseptica strains. In some of these cases, BvgAS, the global regulator of virulence factors, was involved in this regulation of LPS biosynthesis. In contrast, no evidence was found for the involvement of the Bordetella pertussis BvgAS system in regulation of LPS synthesis. The obligate human pathogens B. pertussis and Bordetella holmesii are closely related but were shown to produce immunologically distinct LPSs. These species are isolated from the upper respiratory tract and blood, respectively. This raises several interesting questions concerning the potential role of LPS as a virulence factor in the infection processes.

Siderophores selectively bind ferric iron and are involved in receptor-specific iron transport into bacteria. Several types of siderophores were synthesized, and growth-promoting or inhibitory activities when they were conjugated to carbacephalosporin, erythromycylamine, or nalidixic acid were investigated. Overall, 11 types of siderophores and 21 drug conjugates were tested against seven different bacterial species: Escherichia coli, Bordetella bronchiseptica, Pasteurella multocida, Pasteurella haemolytica, Streptococcus suis, Staphylococcus aureus, and Staphylococcus epidermidis. In some species, the inhibitory activities of the drug conjugates were associated with the ability of the bacteria to use the siderophore portion of the molecules for growth promotion in disc diffusion tests (0.04 mumol of conjugate or siderophore per disc). E. coli used catechol-based siderophore portions as well as hydroxamate-based tri-delta-OH-N-OH-delta-N-acetyl-L-ornithine ferric iron ligands for growth under iron-restricted conditions achieved by supplemental ethylenediamine di (O-hydroxyphenylacetic acid) (100 micrograms/ml) and was sensitive to carbacephalosporin conjugated to these siderophore types (up to a 34-mm-diameter inhibition zone). B. bronchiseptica used desferrioxamine B and an isocyanurate-based or trihydroxamate in addition to catechol-based siderophore portions for promotion but was not inhibited by beta-lactam conjugates partly because of the presence of beta-lactamase. P. multocida and P. haemolytica did not use any of the synthetic siderophores for growth promotion, and the inhibitory activities of some conjugates seemed partly linked to their ability to withhold iron from these bacteria, since individual siderophore portions showed some antibacterial effects. Individual siderophores did not promote S. suis growth in restrictive conditions, but the type of ferric iron ligands attached to beta-lactams affected inhibitory activities. The antibacterial activities of the intracellular-acting agents erythromycylamine and nalidixic acid were reduced or lost, even against S. aureus and S. epidermidis, when the agents were conjugated to siderophores. Conjugate-resistant E. coli mutants showed the absence of some iron-regulated outer membrane proteins in gel electrophoresis profiles and in specific phage or colicin sensitivity tests, implying that the drugs used outer membrane receptors of ferric complexes to get into cells.

Bordetella species are respiratory pathogens that infect humans and other animals. A majority of the virulence factors expressed by these bacteria are regulated by a master control locus, BvgAS, a member of the two-component family of signal transduction systems. BvgAS senses environmental signals and mediates signal transduction by a phosphorylation cascade that leads to a biphasic transition between the Bvg+ and Bvg- phases. From natural host studies using Bordetella bronchiseptica, we have found that expression of Bvg+ phase factors, which include adhesins and toxins, is required for successful colonization of the mammalian respiratory tract. Suppression of the Bvg- phase motility phenotype is necessary for a successful interaction with the host. Although the Bvg- phase does not appear to be required in vivo, it does confer the ability to survive under conditions of severe nutrient deprivation. We hypothesize that the Bvg+ phase is necessary and sufficient for respiratory tract colonization and the Bvg- phase is adapted for survival in environments encountered during transmission between hosts.

Extended incubation of culture plates was studied to see if the recovery of Bordetella spp. from nasopharyngeal swabs could be improved. Forty-eight Bordetella isolates were recovered from 103 children (overall positive-culture rate, 46.6%) who met the clinical case definition of pertussis. Seven of 44 (16%) B. pertussis isolates and 2 of 4 (50%) B. parapertussis isolates were recovered only after extended incubation of nasopharyngeal cultures up to 12 days.

The possible relationship between antibiotic sensitivity of B. bronchiseptica isolates and host species was examined. Growth inhibition of 11 B. bronchiseptica isolates from guineapigs, 7 from rabbits and 3 from rats by a variety of antibiotics incorporated in paper disks, was tested. To seek possible relationships among the various antibiotic sensitivities, we submitted our datamatrix to principal component analysis and subsequently to cluster analysis. This approach showed the existence of close clustering as well as highly specific antibiotic sensitivities. In order to test the presumed relationship between antibiotic sensitivity profiles of the B. bronchiseptica isolates and host species of origin, the same datamatrix was submitted to discriminant analysis. Antibiotic sensitivity profiles of the isolates were not clearly related to host species.

The four species of Bordetella differed in their ability to grow at 37 degrees C in membrane-filtered tracheobronchial washings (TBW) from seven vertebrate species, including their natural hosts. From washed inocula of approximately 2 x 10(3) colony-forming units per ml (cfu ml-1), Bordetella bronchiseptica and B. avium grew much better than the other two bordetellae and yielded stationary-phase cultures containing 10(8)-10(9) cfu ml-1 in most of the TBW samples. These counts were only moderately lower than those attained in CL medium which contains about a 450-times higher concentration of amino acids. B. bronchiseptica and B. avium also grew to a limited extent in phosphate-buffered saline without nutrient supplements. B. parapertussis grew in TBW from man, sheep, rabbit, mouse and chicken, but not in TBW from a dog and a horse or in PBS. B. pertussis grew well in CL medium, but not in PBS or in any of 13 samples of TBW from the seven vertebrate species, which included three samples of lung lavage fluid from human patients. Analysis of the TBW samples for known Bordetella nutrients revealed concentrations of amino acids and nicotinic acid averaging 0.35 mM and 0.56 microgram ml-1 respectively.

Bordetella calmodulin-like protein was purified from culture supernatant fluid of B. pertussis, B. parapertussis and B. bronchiseptica by successive chromatography on hydroxyapatite, Toyopearl HW-50F and QAE-Toyopearl 550C columns. The purified calmodulin-like protein appeared to be homogeneous by SDS-polyacrylamide gel electrophoresis. The apparent molecular mass of calmodulin-like protein on SDS-polyacrylamide gel electrophoresis was 10 kDa, which was smaller than bovine brain calmodulin (17 kDa). The purified calmodulin-like protein activated both Bordetella adenylate cyclase and mammalian phosphodiesterase in a Ca(2+)-dependent manner. This activation was inhibited by calmodulin antagonists. The calmodulin-like protein, like calmodulin, was retained by a hydrophobic resin in the presence of Ca2+ and eluted by the addition of EDTA. These results indicated that the Bordetella calmodulin-like protein is closely related to calmodulin. As a putative calmodulin the extracellular calmodulin may be involved in Bordetella pathogenesis.

Bacteria resembling two Bordetella species were isolated from both normal and pneumonic ovine lungs using a selective charcoal agar. Twenty-eight of the 33 isolates showed similarities to stock NCTC B. parapertussis strains in their SDS-PAGE gel protein profiles, in their biochemical reactions and in causing browning on tyrosine agar. Five isolates behaved similarly to stock B. bronchiseptica strains, in being actively motile, in giving identical positive reactions in three out of four biochemical tests and in causing no colour change in tyrosine agar. Multilocus enzyme electrophoresis separated the isolates into two electrophoretic types distinguishable from those of stock B. parapertussis and stock B. bronchiseptica strains.

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzyme cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals approximately 30 bacteria). No false positives were found in clinical samples or among 18 other species. Treatment of 66 aspirates with a weak cation exchange resin increased the diagnostic sensitivity of PCR. Two culture-positive aspirates were negative by PCR, but grew with a single colony among contaminating flora and could be identified only after PCR analysis of the colony material. The amount of positive cases was increased from 13 by culture to 19 by the addition of PCR. Six samples positive by PCR were culture negative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCR increased the sensitivity of pertussis case finding with retained specificity and can be used for laboratory diagnosis of whooping cough.

Difficulties in preparing suitable antigen for the microagglutination (MA) test led to the discovery of a filamentous form of Bordetella avium. Broth media high in nutrients, vigorous shaking, and incubation at 37 C appeared to promote the development of filamentous forms of the organism. Peptone broth did not induce the development of filamentous forms. Eleven different isolates having both smooth and rough colony types were tested and observed to form filaments of various lengths. Filamentous forms of B. avium hemagglutinated guinea pig erythrocytes were motile, had pili and flagella, and were stable up to the fourth or fifth passage in broth media, at which time a predominance of typical coccobacillus organisms were observed. Filamentous forms of B. avium originating from smooth-colony types were pathogenic in turkey poults, whereas the filamentous forms of B. avium originating from rough-colony types were not pathogenic.

The outer membrane proteins of Bordetella avium were examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Sarkosyl-insoluble outer membrane protein-enriched profiles from 50 virulent B. avium isolates, containing major 21,000- and 37,000-molecular-weight proteins (21K and 37K proteins, respectively) and at least 13 less intensely stained proteins with molecular weights ranging from 13,500 to 143,000, were very similar. The 21K, 27K, 31K, and 37K outer membrane proteins were shown to be associated noncovalently with the underlying peptidoglycan layer. It was necessary to treat cell envelopes with 2% sodium dodecyl sulfate and at temperatures in excess of 60 degrees C for 15 min to release these proteins. Exposure of proteins on the cell surface of B. avium was assessed by labeling with 125I followed by electrophoresis. As many as 13 bands were present in profiles from labeled whole cells. Of the surface-labeled bands, eight corresponded to bands in a radiolabeled outer membrane preparation. The outer membrane protein profile of B. avium was compared with profiles from other Bordetella spp., including 20 B. avium-like and 16 B. bronchiseptica strains isolated from turkeys. The outer membrane protein profile of B. avium was distinctly different from those of the other bordetella. The effect of variations in the growth medium on the expression of outer membrane proteins of B. avium was examined. Expression of 22K, 26K, 56K, and 73K proteins was decreased or eliminated by addition of 50 mM MgSO4 to the medium.

Two forms of Bordetella avium colonial morphology on artificial media were observed. The smooth colonial morphology is convex, with an entire edge, and has a glistening mucoid appearance when cultured on 5% bovine blood agar or tryptic soy agar. On the same media, the rough morphology has a crenated edge, a flat surface, and sometimes a wrinkled or ground-glass appearance to the surface. Colonial morphology remained stable when cultures were passaged at 37 C every 48 hours. When different salts or crystal violet were added to the media, the colonial morphology of seven different isolates did not change. Following storage at 4 C on agar, B. avium isolates switched between the smooth and rough colonial morphology, indicating that this is a reversible process. Generally, bacteria with the smooth colonial morphology were motile on sulfide indole motility (SIM) media, whereas bacteria with the rough colonial morphology were non-motile. Only the isolates with the smooth colony type colonized the upper respiratory tract of turkeys, caused clinical signs of the disease, and elicited an agglutinating antibody titer by 21 days postexposure.

Bordetella bronchiseptica showed increases in viable count when incubated in phosphate-buffered saline (PBS), in reagent-grade water, and in local lake and pond waters, all without added nutrients. Within 48 to 72 h at 37 degrees C in PBS and in lake and pond waters, stationary-phase populations of around 2.7 x 10(6) CFU/ml developed from washed B. bronchiseptica inocula of around 2 x 10(3) CFU/ml. Increases in CFU on the order of five- and eightfold, respectively, were observed in reagent-grade water and in seawater from the same sizes of inocula. The organisms remained viable for at least 3 weeks in PBS and in lake waters at 37 degrees C. The possibility that carry-over of nutrients was responsible for growth was discounted by showing serial transfer of B. bronchiseptica in PBS under conditions in which Escherichia coli tested in parallel rapidly died out.

The viability of four strains of Bordetella bronchiseptica, two strains of B. pertussis and one strain of B. parapertussis exposed to hyperimmune and pre-colostrum porcine serum was examined. Viable cell numbers (cfu/ml) of the B. pertussis strains and a rough strain of B. bronchiseptica (CSU-P-1) decreased by 99% and 99.99%, respectively, after exposure for 1 h to porcine hyperimmune serum. In contrast, smooth B. bronchiseptica strains and the B. parapertussis strain showed no significant decrease in viable cell numbers after the same treatment. B. bronchiseptica strain CSU-P-1 also showed a 99% decrease in viable cell numbers after exposure to pre-colostrum porcine serum for 1 h whereas the other strains tested showed no decrease in viable numbers under the same conditions. Heating the hyperimmune and pre-colostrum serum at 56 degrees C for 30 min resulted in the loss of bactericidal activity suggesting the involvement of complement in both systems. Analysis of silver-stained SDS-PAGE profiles of lipopolysaccharide (LPS) extracted from the bacterial cells indicated that the smooth strains of B. bronchiseptica and the B. parapertussis strain possessed high mol. wt O-side chain-like material, whereas the B. pertussis strains and B. bronchiseptica strain CSU-P-1 did not. Gel filtration of acid-hydrolysed LPS samples indicated two distinct carbohydrate peaks for the strains with high mol. wt O-side chain-like material, whereas the other strains each yielded one distinct peak. Western-blot analysis indicated a positive reaction for anti-B. bronchiseptica antibodies to the high mol. wt O-side chain-like material of all serum-resistant strains used in this study.(ABSTRACT TRUNCATED AT 250 WORDS)

Two organ culture models have been adapted for porcine tracheae in order to study colonization by Bordetella bronchiseptica. Rings or segments excised from tracheae of newborn piglets were incubated overnight at 37 degrees C in a nutrient medium under 5% CO2-95% air conditions. Tracheal segments were infected with B bronchiseptica 276, and after different incubation times, bacterial counts were done. B. bronchiseptica adhered well to tracheae maintained in culture, and no statistically significant differences between the two models were observed. Noninfected tracheal mucosae maintained a normal appearance for several days, whereas infected mucosae showed typical damage caused by B. bronchiseptica, namely, loss of ciliary activity and cilia and sloughing of ciliated cells. Our data indicated that porcine tracheal organ culture could be advantageously used to study in vitro colonization by B. bronchiseptica.

Adherence of Bordetella avium to the tracheal mucosa of turkeys was evaluated, using bacteria grown under different culture conditions. Several solid and liquid media were used at incubation times of 12, 24, 36, or 48 hours with incubation temperatures of 18, 26.5, or 35 C. Adherence of B avium was greatest when the bacteria were grown on solid media at 35 C. Use of Bordet-Gengou or brain-heart infusion agar was associated with significantly greater (P less than 0.05) adherence compared with adherence of bacteria grown on other media. Adherence was greatest, using cultures in the stationary phase of growth; however, with some media, adherence diminished when incubation was extended beyond 36 hours. Adherence of B avium was reduced but not completely prevented when cultures were incubated at 18 C.

Thirty-six 1-day-old turkeys were inoculated intranasally with Bordetella avium (BA) strain 838. Noninoculated hatchmates (n = 36) were housed separately. At 2 and 4 weeks of age, 15 inoculated (BA+) and 15 noninoculated (BA-) turkeys were exposed to an aerosol of virulent Escherichia coli. The remaining six BA+ turkeys and six BA- turkeys were used as controls (ie, not exposed to E coli). Turkeys were necropsied on postaerosolization days 0 (immediately after aerosolization), 1, 3, 5, and 7. Lung and tracheal specimens were collected from each turkey for bacterial quantitation and histologic examination. A 1-ml blood sample was collected for detection of bacteremia. Numbers of E coli in lung specimens from 2- and 4-week-old turkeys were not significantly different between BA+ and BA- groups (pooled data over time); however, numbers of E coli isolated from tracheal specimens were significantly greater in BA+ turkeys than those in BA- turkeys. Although the incidence of pulmonary abcesses and E coli bacteremia was greater in 2-week-old turkeys than in 4-week-old turkeys, the incidence was not different between BA+ and BA- turkeys. At both ages, air sacculitis developed more often and was more severe in BA+ turkeys than in BA- turkeys. Hyperplastic bronchus-associated lymphoid tissue was found more often in BA+ turkeys than in BA- turkeys and appeared to be the first site of heterophil infiltration after E coli aerosolization.

In a field trial conducted in cooperation with pediatricians in private practice, 198 nasopharyngeal swabs from children with suspected whooping cough were placed into charcoal-horse-blood transport medium with cephalexin (40 mg/liter). After preincubation at 36 degrees C for 1 to 2 days, the transport systems were mailed to the laboratory. There, the swabs were plated onto charcoal-horse-blood agar with cephalexin and were subsequently incubated for 48 h in cephalexin-containing charcoal-horse-blood broth which was then subcultured onto the agar. Forty-six Bordetella pertussis strains and seven Bordetella parapertussis strains were isolated (Bordetella isolation rate, 26.8%). Only three (5.7%) of the 53 Bordetella strains were detected exclusively by use of the broth. This low rate of additional isolates is probably explained by the fact that the swabs had been submitted in charcoal-horse-blood transport medium which itself acts as an enrichment medium.

Natural transmission of atrophic rhinitis from pigs from a herd with an endemic atrophic rhinitis problem to pigs from a herd free of atrophic rhinitis was demonstrated. Six replicates each with five pigs from the endemic atrophic rhinitis herd (Group A) and five pigs from the atrophic rhinitis-free herd (Group B) were housed together from 5 wk of age, with each replicate kept in isolation rooms maintained at optimal and controlled environmental conditions. Three replicates each with six pigs/room from the atrophic rhinitis-free herd (Group C), served as nonexposed controls. Group C pigs remained healthy and had no turbinate atrophy at either 10 or 17 wk of study (atrophic rhinitis score = 0 on a 0 to 3 scale). Group A pigs had a mean atrophic rhinitis score of 1.85 +/- 0.84, and group B pigs developed atrophic rhinitis to a mean score of 1.57 +/- 0.70. The isolation rate and quantity of Pasteurella multocida found on nasal swabs was directly related to lesions while those for Bordetella bronchiseptica were inversely related to turbinate atrophy. Of the various types of P. multocida evaluated, nontoxigenic type A and toxigenic type D were both directly related to atrophic rhinitis while nontoxigenic type D strains were not. No toxigenic type A P. multocida strains were isolated.

A medium was developed that in most instances allowed the isolation from pigs of Bordetella (Alcaligenes) bronchiseptica in pure, or virtually pure, culture from such sites as the nasal cavity, which contains many other bacteria. If not suppressed, some of the latter can inhibit, sometimes completely, the growth of the bordetellae on artificial media. Besides being markedly selective, the new medium is simple to prepare, reasonably cheap and practically noninhibitory to B bronchiseptica. This organism produces a distinctive colony that is easily differentiated on morphological grounds from the few other bacteria (such as Alcaligenes faecalis and Pseudomonas spp) which also grow on this medium. Parallel examination of specimens from the nasal cavities of 219 pigs in the field in southern England confirmed that this medium was better than hitherto recommended for the detection of B bronchiseptica. This was particularly true when the organism occurred in small numbers only and/or when bacteria little affected by the inhibitors in the previously recommended media were present in the nasal flora.

The use of Stainer-Scholte broth supplemented with (2,6-O-dimethyl)beta-cyclodextrin (heptakis) for the isolation of Bordetella pertussis from clinical specimens was evaluated with 3,632 nasal swabs from children and adults with suspected whooping cough or from their family contacts. The liquid enrichment medium was subcultured on charcoal agar with 10% defibrinated horse blood. Charcoal agar and soft charcoal agar served as the standard procedure to detect B. pertussis. We isolated 772 strains of B. pertussis (21%). Charcoal agar alone detected 87% of all strains (n = 668), soft charcoal agar grew 78% (n = 602), and 637 strains (83%) were isolated when Stainer-Scholte broth with heptakis was used. We detected 590 isolates with all three media. Whereas 65 strains grew only on charcoal agar, 27 strains were detected by soft charcoal agar. Supplemented Stainer-Scholte broth allowed the isolation of an additional 77 strains which did not primarily grow on charcoal media (P less than 0.05). Our data indicate that Stainer-Scholte medium supplemented with heptakis can be effectively used as an enrichment medium for detection of B. pertussis in clinical specimens.

Mutant strains of Bordetella bronchiseptica, named B-42, B-76, B-84, and B-119, were obtained after serial passages of a parent strain, L3, on Bordet-Gengou agar plates containing 20% horse blood and 200 micrograms of nalidixic acid per ml (BGN-20 agar plates) at 42 degrees C. Mutant strains completely lacked dermonecrotic toxin-producing ability, and lethal activity of the strains for mice was apparently reduced compared with that of strain L3. Mutant strains were able to grow at 42 degrees C, and the strains were nalidixic acid resistant. The mutant strains showed domed (Dom+) colony morphology with smooth texture (Scs+) and no production of zone of hemolysis (Hly-), but the agglutinability of these strains to antiserum prepared with Dom+ Scs+ Hly+ organisms of strain L3 was the same as that of strain L3. When strain B-42 was inoculated intramuscularly or intranasally into guinea pigs, all the animals survived without manifesting clinical signs and produced a high-level of serum agglutination antibodies against strain L3. These inoculated animals were protected against intranasal challenge with strain L3. These properties of mutant strains are hereditarily stable after 50 subcultures on BGN-20 agar plates or 20 passages in mice. These data suggest that the mutant strains lacking dermonecrotic toxin-producing ability can be used as a live attenuated vaccine against swine atrophic rhinitis.

Effects of temperature on growth of three strains of Bordetella avium were determined in young turkeys and in vitro. Colonization of the tracheal mucosa by two virulent strains of B. avium was significantly greater in cold-stressed turkeys than in heat-stressed turkeys. The avirulent vaccine strain, ART-VAX, colonized tracheas of cold-stressed turkeys to a limited extent but failed to colonize heat-stressed turkeys. Growth rates of the three B. avium strains were determined in brain-heart infusion broth at 30, 35, 40, and 45 C. All three strains grew best at 35 C but were killed by 45 C. Compared with virulent strains, ART-VAX grew markedly less at all temperatures, and most cultures of ART-VAX grew at 40 C only after a variable period of declining numbers of viable bacteria. This study indicates that temperature affects growth of B. avium in vivo and in vitro and that growth of the ART-VAX strain is fundamentally different from growth of virulent strains.

The virulence of Bordetella bronchiseptica in gnotobiotic piglets was studied by intranasal infection with 11 cultures derived from eight strains isolated from pigs (4), dogs (2), a human subject and a monkey. Six of the cultures contained organisms in phase I and five contained phenotypically different phase-III or -IV organisms. Of the phase-III and -IV cultures, four were derived from strains that had been isolated in phase I. Colonisation of the nasal cavity was investigated by counting bacteria in nasal swabs and washings. The toxigenicity of cell extracts from each strain and variant was determined by tests of lethality in mice or of cytopathogenicity in cell cultures. The results showed that two phase-I cultures from pigs colonised the nasal cavity and respiratory tract of gnotobiotic piglets better than did four phase-I cultures from other species. Phase-I organisms invariably produced capsules, fimbriae and mannose-resistant haemagglutination of guinea-pig erythrocytes. Four of five cultures in phases III and IV consisted of organisms that did not produce capsules, fimbriae or haemagglutination and colonised the nasal cavity poorly. Phase variation from I to III occurred in culture and in vivo, but variation from III to I occurred in vivo only and was accompanied by enhanced colonisation. Gnotobiotic piglets infected with porcine phase-I organisms exhibited atrophy of the nasal turbinate bones after 28 days; these organisms produced significantly more toxin than did bacteria in phase I from other species, or those in phases III and IV.(ABSTRACT TRUNCATED AT 250 WORDS)

A modified-live intranasal (IN) canine parainfluenza (CPI)-virus Bordetella bronchiseptica vaccine was evaluated in dogs for efficacy against laboratory-induced canine infectious tracheobronchitis. The comparative efficacies of IN and parenteral administrations of the CPI virus fraction were also evaluated. The frequency and duration of clinical tracheobronchitis, blood serum agglutination titer, humoral antibody response, and duration of CPI virus and B bronchiseptica shedding were measured. Group A dogs were vaccinated subcutaneously or IM with an experimental CPI vaccine and challenge exposed with CPI virus. Group B dogs were vaccinated IN with avirulent CPI virus-B bronchiseptica live antigens and challenge exposed with virulent CPI virus and virulent B bronchiseptica. The IN vaccination (group B) significantly reduced (P less than or equal to 0.001) the occurrence of clinical tracheobronchitis by 96%. The combined challenge exposure of virulent CPI and virulent B bronchiseptica produced a synergistic enhancement of the clinical signs of kennel cough. The percentage of days after challenge exposure that virus shedding was detected for controls equaled 70% as compared with 50% and only 1% for parenterally and IN vaccinated dogs, respectively. Isolation of virulent B bronchiseptica microorganisms was reduced 89% in dogs vaccinated IN compared to controls. The geometric mean humoral antibody titers to CPI virus after 2 parenteral vaccinations and 1 IN vaccination were 1:43 and 1:34, respectively.

Culture and fluorescent-antibody methods for detection of Bordetella species were evaluated by two state public health laboratories. Field-inoculated plates of Regan-Lowe agar medium were most useful if incubation was initiated on the day of collection. Regan-Lowe and Bordet-Gengou media were comparable for subculturing nasopharyngeal specimens that were transported and enriched in half-strength Regan-Lowe agar. Maximum sensitivity was achieved when the media were used in parallel. Fluorescent-antibody-stained smears of nasopharyngeal specimens were more sensitive for detection of Bordetella pertussis than for detection of Bordetella parapertussis. The fluorescent-antibody method, however, was too insensitive for use without culture.

One-day-old turkeys were infected intranasally with Bordetella avium, and tracheas were examined by scanning and transmission electron microscopy at 1 to 5 weeks post-inoculation (PI). The predominant ultrastructural lesions were progressive loss of ciliated epithelium with replacement by nonciliated cells, bacterial colonization of ciliated cells, membrane-bound crystalline inclusions in cytoplasma of epithelial cells, depletion of mucous granules, and distortion of tracheal rings and the mucosal surface. Tracheal surface exudates consisted of mucus, necrotic cells, heterophils, and fibrin. Ciliated cells were replaced by immature cuboidal cells characterized by abundant rough endoplasmic reticulum with small numbers of electron-dense mucous granules in the apical cytoplasm. Bacterial surfaces were rough and contained numerous pleomorphic, knob-like structures, 20-50 nm in diameter. Other changes included enlarged mucosal gland openings, cell extrusion marks, pleomorphic microvilli, and cells with small numbers of short cilia.

To clarify the pathogenesis of Bordetella in vivo infection, the tracheal epithelia of mice were examined in detail by electron microscopy at various intervals after intranasal inoculation with graded doses of phase I Bordetella bronchiseptica. In mice infected with a lethal dose (6 to 7 x 10(7) CFU), a remarkable rupture of the cell membranes of cilia and microvilli of the middle trachea was found on day I postinfection. The rupture of the membrane was observed over the entire tracheal epithelia, on day 2 after infection. The affected cilia were constricted at the transitional region and were broken off. In the ciliated cells the adherence of organisms to ciliary apexes and colonization in the interciliary spaces were also remarkable. In both the ciliated and nonciliated epithelial cells, the cytoplasmic vacuolation and pyknosis or karyorrehexis were also notable. In mice infected with one-tenth of the lethal dose, similar findings were seen, but appeared more slowly and the bacteria were not seen attaching to ciliary apexes. In mice receiving one-hundredth of the lethal dose, only mild cilial abnormality such as aggregation of cilia, and slight cytoplasmic vacuolation were found 6 days postinfection. Based on these findings, a possible mechanism of the ciliary damages produced by B. bronchiseptica was postulated.