Search

Total lymphoid irradiation (TLI) is an alternative treatment for chronic lung allograft dysfunction (CLAD). However, data regarding its efficacy and tolerance are scarce. This study included patients with CLAD treated with TLI at our center between 2011 and 2018. Clinical characteristics before and after TLI and related complications were analyzed. Forty patients with CLAD [29 bronchiolitis obliterans syndrome (BOS), 9 restrictive allograft syndrome (RAS), and 2 mixed] were included. Significant attenuation of the forced expiratory volume in one-second (FEV1) decline slope was observed in all phenotypes, in both the BOS and RAS. The median FEV1 12, 6, and 3 months pre-TLI were as follows: 1980 (IQR 1720-2560), 1665 (IQR 1300-2340) and 1300 (IQR 1040-1740) mL (p0.001), while the median FEV1 at 3, 6, and 12 months post-TLI was 1110 (IQR 810-1440), 1130 (IQR 860-1470) and 1115 (IQR 865-1490) mL (p = 0.769). No dropouts due to radiation toxicity were observed. The mean survival according to the Karnofsky Performance Status Scale (KPS)70 or ≤70 at baseline was 1837 (IQR 259-2522) vs. 298 (IQR 128-554) days (p0.0001). In conclusion, TLI may stop FEV1 decline in both BOS and RAS. Moreover, a good KPS score may be an important prognostic factor. This article is protected by copyright. All rights reserved.

Background In lung transplantation (LT), the length of ischemia time is controversial as it was arbitrarily stablished. We ought to explore the impact of extended cold-ischemia time (CIT) on ischemia-reperfusion injury in an experimental model. Methods Experimental, randomized pilot trial of parallel groups and final blind analysis using a swine model of LT. Donor animals (n = 8) were submitted to organ procurement. Lungs were subjected to 6 h (n = 4) or 12 h (n = 4) aerobic hypothermic preservation. The left lung was transplanted and re-perfused for 4 h. Lung biopsies were obtained at (i) the beginning of CIT, (ii) the end of CIT, (iii) 30 min after reperfusion, and (iv) 4 h after reperfusion. Lung-grafts were histologically assessed by microscopic lung injury score and wet-to-dry ratio. Inflammatory response was measured by determination of inflammatory cytokines. Caspase-3 activity was determined as apoptosis marker. Results We observed no differences on lung injury score or wet-to-dry ratio any given time between lungs subjected to 6 h-CIT or 12h-CIT. IL-1β and IL6 showed an upward trend during reperfusion in both groups. TNF-α was peaked within 30 min of reperfusion. IFN-γ was hardly detected. Caspase-3 immunoexpression was graded semiquantitatively by the percentage of stained cells. Twenty percent of apoptotic cells were observed 30 min after reperfusion. Conclusions We observed that 6 and 12 h of CIT were equivalent in terms of microscopic lung injury, inflammatory profile and apoptosis in a LT swine model. The extent of lung injury measured by microscopic lung injury score, proinflammatory cytokines and caspase-3 determination was mild.

Background Tuberculosis (TB) represents a diagnostic and therapeutic challenge for solid organ transplant recipients, particularly after lung transplant (LT). Our aim was to determine the impact of TB in LT patients in Spain, considering prevalence, clinical presentation, prevention and therapeutic management. In addition, differences in outcome between rifampicin (RIF) versus non-RIF containing regimens were analyzed. Methods Multicenter, observational retrospective study, including all cases of TB diagnosed in recipients after LT, in five pulmonary transplant units in Spain, between January 1990 and December 2017. Results Among 2962 LT recipients, 45 cases of TB were diagnosed, resulting in a prevalence of 1.52%. Most of them (88.89%) were diagnosed during the first year posttransplantation, 86.67% with pulmonary presentation. Screening for latent TB infection (LTBI) was done in 36 of the 45 patients and LTBI was detected pretransplant in 12 (33.33%). Less than half of the patients with disease (42.22%) received rifampicin (RIF). Lower probability of TB worsening was found in RIF-containing regimens (p = 0.049), as well as longer survival (p = 0.001). RIF use was not associated with an increased risk in rejection (p = 0.99), but doses of calcineurin inhibitors (CNI) had to be raised an average of 215%. Conclusions Risk of TB after LT was lower in our series than previously reported. TB should be searched during the first year posttransplant in patients with TB risk factors. Pulmonary presentation was predominant. More sensitive algorithms for detecting LTBI before LT are crucial. It is reasonable to use RIF-containing regimens over non-RIF regimens based on the tendency toward better outcome in our series. RIF regimen requires close monitoring of CNI trough level for 2–3 weeks, until stability is achieved.

This research was supported by Asociacion Espanola de LAM; The LAM Foundation Seed Grant 2019; Carlos III Institute of Health grants PI18/01029, PI21/01306 and ICI19/00047 (co-funded by European Regional Development Fund (ERDF), "A way to build Europe"); Ministry of Economy and Competitivity grant SAF2017-88457-R; the Generalitat de Catalunya SGR 2017-449 and 2017-529; PERIS PFI-Salut SLT017-20-000076; and the CERCA Program to IDIBELL and Institut Germans Trias i Pujol. X. Farre is supported by the VEIS project (001-P-001647, ERDF Operational Programme of Catalonia 2014-2020; co-funded by ERDF, "A way to build Europe"). Funding information for this article has been deposited with the Crossref Funder Registry., Introduction Lymphangioleiomyomatosis (LAM) is a rare low-grade metastasising disease characterised by cystic lung destruction. The genetic basis of LAM remains incompletely determined, and the disease cell-of-origin is uncertain. We analysed the possibility of a shared genetic basis between LAM and cancer, and LAM and pulmonary function. Methods The results of genome-wide association studies of LAM, 17 cancer types and spirometry measures (forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), FEV1/FVC ratio and peak expiratory flow (PEF)) were analysed for genetic correlations, shared genetic variants and causality. Genomic and transcriptomic data were examined, and immunodetection assays were performed to evaluate pleiotropic genes. Results There were no significant overall genetic correlations between LAM and cancer, but LAM correlated negatively with FVC and PEF, and a trend in the same direction was observed for FEV1. 22 shared genetic variants were uncovered between LAM and pulmonary function, while seven shared variants were identified between LAM and cancer. The LAM-pulmonary function shared genetics identified four pleiotropic genes previously recognised in LAM single-cell transcriptomes: ADAM12, BNC2, NR2F2 and SP5. We had previously associated NR2F2 variants with LAM, and we identified its functional partner NR3C1 as another pleotropic factor. NR3C1 expression was confirmed in LAM lung lesions. Another candidate pleiotropic factor, CNTN2, was found more abundant in plasma of LAM patients than that of healthy women. Conclusions This study suggests the existence of a common genetic aetiology between LAM and pulmonary function., Asociacion Espanola de LAM, LAM Foundation Seed Grant 2019, Instituto de Salud Carlos III PI18/01029 PI21/01306 ICI19/00047, European Regional Development Fund (ERDF), "A way to build Europe", Ministry of Economy and Competitivity SAF2017-88457-R, Generalitat de Catalunya, General Electric SGR 2017-449 2017-529, PERIS PFI-Salut SLT017-20-000076, CERCA Program, VEIS project 001-P-001647, ERDF, "A way to build Europe" ERDF Operational Programme of Catalonia 2014-2020

Introduction: While European health policies do frequently take into consideration the ideas and experiences of their users, the voices of minority and marginalized communities are not often heard. European healthcare services must address this issue as the number of healthcare users with an MM background increases. Aim: To explore the perspectives of key stakeholders and healthcare users with an MM background on transcultural care in four European countries. Design: Qualitative phenomenological study. Methods: Semi-structured, individual interviews were conducted with stakeholders and MM users. Interviews were translated and transcribed verbatim and were carried out from February to May 2021. Descriptive statistics was used to describe the characteristics of the sample, qualitative data were analyzed thematically following Braun and Clarke’s phases, resulting in 6 themes and 18 subthemes. Results: For stakeholders and MM users with long-established residence in their respective countries, cultural differences involve different family and community norms, religious beliefs, lifestyles, and habits. These components are perceived as in tension with healthcare norms and values, and they mediate in two key and related aspects of the relationship between MM users and healthcare providers: accessibility and communication. Conclusions: Communication and access to healthcare are key to MM health service users, and they are the most frequent sources of misunderstanding and conflict between them and healthcare professionals. Impact: It is important to extend the investigation of cultural issues in healthcare to stakeholders and MM users. There is no doubt that healthcare professionals should be trained in cultural competence, however, cultural competence training is not the only area for improvement. There should be a change in paradigm in healthcare services across Europe: from individual to organizational integration of culture and diversity.

Resumen Introduccion La supervivencia del trasplante pulmonar (TP) viene condicionada fundamentalmente por el desarrollo de disfuncion cronica del injerto (DCI). El retrasplante pulmonar (RP) es una alternativa para una poblacion seleccionada con DCI. El objetivo del estudio fue revisar la experiencia de RP en nuestro centro. Pacientes y metodos Se ha realizado un estudio retrospectivo de los pacientes sometidos a RP entre agosto de 1990 y julio de 2017. Resultados Se realizaron 14 RP de un total de 998 (1,4%) TP. Doce RP se dieron por causa de DCI: 10 (71,4%) por sindrome de bronquiolitis obliterante y 2 (14,3%) por sindrome restrictivo del injerto. En 2 pacientes el RP se realizo en los 30 dias siguientes al primer TP. En el RP por DCI el tiempo medio entre el TP y el RP fue de 48 meses. Tras el RP el tiempo medio de ventilacion mecanica fue de 32 dias. El incremento del FEV1 tras el RP fue del 24 ± 18%. Los mejores valores en la espirometria se observaron a los 7,3 meses. La supervivencia media de la serie fue de 43,8 meses, en los pacientes con sindrome de bronquiolitis obliterante fue de 63,4 meses mientras que en los pacientes con sindrome restrictivo del injerto fue de 19,5 meses. Solo un paciente de los 2 RP precoces sobrevivio a este. Conclusion El RP es una opcion terapeutica en pacientes seleccionados con DCI. Sin embargo, estos resultados no son reproducibles si el RP se realiza en los primeros dias.

Background Venous thromboembolism (VTE) is a major complication after lung transplantation (LT). However, its pathophysiology remains unknown, and coagulation profiles have yet to be described. Objective The aim of this study was to longitudinally assess coagulation status after LT. Methods We performed a prospective study and described the coagulation profiles of 48 patients at 5 different time-points: before LT and at 24–72 h, 2 weeks, 4 months, and 1 year after LT. Results At baseline, almost all analyzed coagulation factors were within the normal range, except for FVIII, which was above the normal range. Von Willebrand factor (vWF) and FVIII were increased after LT and remained high at 1 year after transplantation. The cumulative incidence of VTE was 22.9%. Patients who developed VTE had higher FVIII activity 2 weeks after LT. Conclusions This is the first study to describe coagulation profiles up to 1 year after LT. We show that most markers of a procoagulant state normalize at 2 weeks after LT, but that values of FVIII and vWF remain abnormal at 1 year. This problem has received little attention in the literature. Larger studies are necessary to confirm the results and to design appropriate prophylactic strategies.

Diagnòstic; Farmacoteràpia; Malalties del tracte respiratori Diagnóstico; Farmacoterapia; Enfermedades del tracto respiratorio Diagnosis; Drug therapy; Respiratory tract diseases There are few published data on long-term treatment with sirolimus in lymphangioleiomyomatosis (LAM). The objective of this study was to describe the long-term effect of sirolimus in a series of LAM patients followed up in a referral centre, focusing on pulmonary function. We retrospectively reviewed a series of 48 patients with LAM diagnosed, followed up and treated with sirolimus in a single centre. Response to sirolimus was evaluated at 1 and 5 years. A negative sirolimus response was defined as an FEV1 decline greater than − 75 ml/year. A mixed-effects model was used to estimate the longitudinal changes in FEV1 (average slope), both as absolute (ml/year) and as predicted values (%predicted/year). From a total of 48 patients, 9 patients underwent lung transplantation and 4 died during the study. Mean (95% CI) FEV1 slope over 5 years was − 0.14 (− 26.13 to 25.85) ml/year in the whole LAM group, 42.55 (14.87 to 70.22) ml/year in the responder group, − 54.00 (− 71.60 to − 36.39) ml/year in the partial responder group and − 84.19 (− 113.5 to − 54.0) ml/year in the non-responder group. After 5 years of sirolimus treatment 59% had a positive response, 30% had a partial response and 11% had a negative response. Our study found that sirolimus treatment had a positive long-term effect on most LAM patients. E.R.L. received a pre-doctoral Grant from the Spanish Society of Pulmonology and Thoracic Surgery.

This study describes the clinical presentation, treatment, and outcomes of SARS-CoV-2 infection in lung transplant recipients (LTRs). This is a multicenter, retrospective study of all adult LTRs with confirmed SARS-CoV-2 infection from March 4 until April 28, 2020 in six Spanish reference hospitals for lung transplantation. Clinical and radiological data, treatment characteristics, and outcomes were reviewed. Forty-four cases were identified in that period. The median time from transplantation was 4.2 (interquartile range: 1.11-7.3) years. Chest radiography showed acute parenchymal abnormalities in 32 (73%) cases. Hydroxychloroquine was prescribed in 41 (93%), lopinavir/ritonavir (LPV/r) in 14 (32%), and tocilizumab in 19 (43%) patients. There was a strong interaction between tacrolimus and LPV/r in all cases. Thirty-seven (84%) patients required some degree of respiratory support and/or oxygen therapy, and 13 (30%) were admitted to intermediate or intensive critical care units. Seventeen (39%) patients had died and 20 (45%) had been discharged at the time of the last follow-up. Deceased patients had a worse respiratory status and chest X-ray on admission and presented with higher D-dimer, interleukin-6, and lactate dehydrogenase levels. In this multicenter LTR cohort, SARS-CoV-2 presented with high mortality. Additionally, the severity of disease on presentation predicted subsequent mortality.

Background: Cytomegalovirus (CMV) infection remains a prevalent problem in lung transplantation (LT) despite prophylaxis use in seropositive (R+) patients. CMV-specific cell-mediated immunity (CMI) might predict patients at risk. Methods: 60 consecutive R+ LT patients were included. CMV-specific CMI against IE-1 and pp65 was assessed with an ELISPOT assay during prophylaxis and upon its completion. Patients were divided into high (HR) and low risk (LR) according to CMI ROC curves. The primary endpoint was late-onset infection. Results: 31 (52%) patients developed CMV viremia and 1 (2%) developed CMV disease. CMV-specific CMI to IE-1 was significantly lower in those developing CMV infection (120.3±29.3 vs 262.8±313.3, p=0.045). HR patients ( 10000 copies), CMI differences increased (Log-rank=0.012, HR 4.23) (Figure 1). HR patients also showed a higher CMV replication load (62378±76862 vs 8510±12367, p=0.005). Sensitivity, specificity, PPV and NPV of CMV-specific CMI predicting clinically relevant CMV infection was 80%, 56%, 38% and 89% respectively. Conclusions: CMV-specific CMI after prophylaxis withdrawal can discriminate R+ LT patients at different risk of late-onset CMV infection.

Objectives: After a lung transplant (LT), infections due to multiresistant bacteria and mold may require an increase in treatments, which can lead to more side effects, resistance and a potential increase in the incidence of chronic graft dysfunction. The aim of this study is to describe the use of antimicrobials which are usually administered orally or intravenously, and their response. Methods: Observational study of patients with LT who were started on non conventional nebulized antimicrobials in 2018-2019. We analyzed culture results, lung function and the presence of exacerbations. Results: Micafungin, voriconazole, linezolid and vancomycin were given to 6 patients with persistent fungal infections who had not responded to usual treatments. Two of the patients received nebulized micafungin for Scopulariopsis spp tracheobronchitis. Nebulized voriconazole was used in 2 patients with tracheobronchitis due to Lomentospora prolificans and Aspergillus flavus and one of these patients also had infection due to Corynebacterium spp, so he and another patient received nebulized linezolid. Another patient with Corynebacterium spp infection was started on nebulized vancomycin. The median (p25-p75) for time of treatment was 9 (6-32) months and only one patient stopped treatment due to poor tolerance. In four patients, the cultures were negative after a month and all patients had fewer exacerbations. Conclusions: The use of nebulized antimicrobials such as micafungin, voriconazole, linezolid and vancomycin seems to be safe and could be beneficial in some infections.

Background Venous thromboembolism (VTE) is a frequent complication after solid organ transplantation (SOT) and, specifically, after lung transplantation (LT). The objectives of this study were to evaluate prophylaxis with enoxaparin and to describe risk factors for VTE after LT. Methods We retrospectively reviewed the clinical records of 333 patients who underwent LT in our institution between 2009 and 2014. We compared 2 consecutive cohorts, one that received enoxaparin only during post-transplant hospital admissions and a second cohort that received 90-day extended prophylaxis with enoxaparin. Cumulative incidence function for competing risk analysis was used to determine incidence of VTE during the first year after transplantation. Risk factors were analyzed using a Cox proportional hazards regression model. Results The cumulative incidence of VTE was 15.3% (95% CI: 11.6-19.4). Median time from transplant to the event was 40 (p25-p75, 14-112) days. Ninety-day extended prophylaxis did not reduce the incidence of VTE. In the present study, the risk factors associated with VTE were male gender and interstitial lung disease. Conclusions VTE is a major complication after LT, and 90-day extended prophylaxis was not able to prevent it. Large, multicenter, randomized clinical trials should be performed to define the best strategy for preventing VTE. This article is protected by copyright. All rights reserved.

The epidemiology of respiratory viruses (RVs) in lung transplant recipients (LTRs) and the relationship of RVs to lung function, acute rejection (AR) and opportunistic infections in these patients are not well known. We performed a prospective cohort study (2009–2014) by collecting nasopharyngeal swabs (NPSs) from asymptomatic LTRs during seasonal changes and from LTRs with upper respiratory tract infectious disease (URTID), lower respiratory tract infectious disease (LRTID) and AR. NPSs were analyzed by multiplex polymerase chain reaction. Overall, 1094 NPSs were collected from 98 patients with a 23.6% positivity rate and mean follow‐up of 3.4 years (interquartile range 2.5–4.0 years). Approximately half of URTIDs (47 of 97, 48.5%) and tracheobronchitis cases (22 of 56, 39.3%) were caused by picornavirus, whereas pneumonia was caused mainly by paramyxovirus (four of nine, 44.4%) and influenza (two of nine, 22.2%). In LTRs with LRTID, lung function changed significantly at 1 mo (p = 0.03) and 3 mo (p = 0.04). In a nested case–control analysis, AR was associated with RVs (hazard ratio [HR] 6.54), Pseudomonas aeruginosa was associated with LRTID (HR 8.54), and cytomegalovirus (CMV) replication or disease was associated with URTID (HR 2.53) in the previous 3 mo. There was no association between RVs and Aspergillus spp. colonization or infection (HR 0.71). In conclusion, we documented a high incidence of RV infections in LTRs. LRTID produced significant lung function abnormalities. Associations were observed between AR and RVs, between P. aeruginosa colonization or infection and LRTID, and between CMV replication or disease and URTID., A large prospective study of the epidemiology of respiratory viruses in lung transplant recipients using molecular assays demonstrates a very high incidence of respiratory viral infection and an association between respiratory virus infectious diseases, immediate allograft dysfunction, and the development of acute rejection and opportunistic infection.

Background: Long-term survival with good allograft function (LTS) after lung transplantation (LT) is mainly limited by the development of chronic lung allograph dysfunction (CLAD). The objective of this study was to identify genes and miRNAs which might contribute to a better understanding of the molecular mechanisms influencing LTS after LT. Methods: The mRNA and miRNAs expression profiles were determined in blood samples from LTS (n=30) and CLAD patients (n=30) by microarray technology. Gene Ontology was used for enrichment analysis and the interactions between miRNAs and genes were studied by network analysis with the mixOmics R package. Results: The analysis of mRNA expression revealed that 458 genes were differentially expressed between LTS versus CLAD patients. Genes related to neutrophil-granulocyte activation and neutrophil degranulation were downregulated in LTS, suggesting a dysregulation of the innate immune system in CLAD patients. Regarding miRNAs expression analysis, 36 mature miRNAs were differentially expressed between both groups. Of these 36 elements, 30 miRNAs had experimentally validated target genes enriched in the set of 458 differentially expressed genes. Biological significance analysis showed that miRNA target genes differentially expressed between LTS and CLAD patients were related to neutrophil degranulation. Conclusion: Differences in both mRNA expression and upstream miRNA regulators have been found between LTS and CLAD patients. These results suggest that innate immune system may play a role in long-term survival after LT. Study financed by ISCIII (PI13/01076), FEDER, FUCAP, SEPAR (138/2016), Astellas, Novartis and Chiesi.

Introduction: Lymphangioleiomyomatosis (LAM) is a rare slowly progressive neoplasic disease that leads to respiratory failure. Short-term treatment with siroliumus has shown to stabilize pulmonary function but data on long-term results lack. The aim of this study was to describe the long-term impact of sirolimus treatment. Methods: From November 2007 to October 2018, 46 LAM patients treated with sirolimus from a tertiary referral centre were retrospectively included. Sirolimus response at 1 year was evaluated. A negative response was defined as a decrease in FEV1 greater than 20 mL/year considered to be the physiological age-related decline. The response was revaluated after 5 years of treatment. Results: 11 (24%) from 46 patients were treated with sirolimus for less than 1 year, 35 (76%) for more than 1 year and 24 (52%) for at least 5 years. A positive response to sirolimus at first year was observed in 21 (60%) patients. Mean pulmonary function test values after one year of sirolimus treatment were FVC 3377 (SD 864) mL, FEV1 2221 (SD 862) mL, and DLCO 56% (SD 21), in the responder group and FVC 2763 (SD 960) mL, FEV1 1736 (743) mL and DLCO 47% (SD 16) in the non-responder group (p Conclusion: Our study supports the idea that sirolimus treatment has a positive long-term impact in nearly half of LAM patients. This is the first study that provides pulmonary function values at 1 and 5 years in LAM patients treated with sirolimus.

Purpose Chronic lung allograft dysfunction (CLAD) is the main limiting factor for long-term survival after lung transplantation (LT). However, there is a small number of LT patients which are long-term survivors with good allograft function (LTS). The aim of the present study was to compare the gene expression profile of CLAD and LTS patients and performing an enrichment analysis by using Reactome annotation database. Methods We analyzed whole-blood gene expression profiles of 60 double lung transplant recipients who were included in this multicenter cross-sectional study: 30 patients with CLAD and 30 patients with a stable allograft function 10 years after lung transplantation (LTS). Expression analysis were performed by microarray technology (ClariomTM D Arrays). Results We identified 458 differentially expressed genes (DEGs) between LTS and CLAD patients. Among them, 201 genes were up-regulated and 257 genes were down-regulated. Differentially expressed genes included MMP-8, LTF, TCN1 and OLFM4. Enrichment analysis showed involvement of neutrophil degranulation, class A/1 (Rhodopsin-like receptors), cell surface interaction at the vascular wall, antimicrobial peptides, interleukin-4 and 13 signaling, role of phospholipids in phagocytosis and activation of matrix metalloproteinases pathways. Conclusion It seems that neutrophil degranulation, matrix metalloproteinases and antimicrobial peptides gene expression pathways within others could be involve in differences between CLAD and LTS patients. Study financed by Instituto de Salud Carlos III (PI13/01076); the European Regional Development Fund (FEDER), FUCAP, Astellas, Novartis and Chiesi.

We describe two cystic fibrosis patients infected with pandrug-resistant Burkholderia cepacia complex, with the exception of ceftazidime–avibactam, who received prophylaxis with this antibiotic during lung transplantation. Although both patients had a post-operative relapse of respiratory infection, one with positive blood cultures, ceftazidime–avibactam treatment yielded a favourable outcome. 12 months after transplantation, one patient presented an excellent clinical outcome. However, the other patient died 10 months later due to severe B. cepacia sinusitis with intracranial invasion.

The aim of this study was to compare the pharmacokinetic profile, tolerability, and safety of a novel once-daily extended-release formulation of tacrolimus (LCPT) with that of once-daily prolonged-release tacrolimus (ODT) in stable adult lung transplant (LT) recipients.Phase II, open-label, single-arm, single-center, prospective pilot pharmacokinetic study. Study population comprised 20 stable LT recipients receiving ODT, mean age 55.9 years (range, 38-67 years), 13 (65%) men. Patients were switched to LCPT in a 1:0.7 (mg/mg) conversion dose. Follow-up was 6 months, and cystic fibrosis patients were excluded. Two 24-hour pharmacokinetic profiles were obtained for each patient, the first on day -14 and the second on day +14 after switching to LCPT. Pharmacokinetic parameters and safety were compared.Mean (SD) area under the concentration-time curve from 0 to 24 hours was 253.97 (61.90) ng/mL per hour for ODT and 282.44 (68.2) ng/mL per hour for LCPT. Systemic exposure was similar in both (Schuirmann two 1-sided test). Mean (SD) dose was 5.05 (1.67) mg in ODT and 3.36 (1.03) mg in LCPT (P = 0.0002). Time to maximum concentration was 125 minutes for ODT and 325 minutes for LCPT (P0.001). Correlation between area under the concentration-time curve from 0 to 24 hours and C24 was 0.896 (r) for ODT and 0.893 (r) for LCPT. There were no differences in adverse effects. At 6 months, conversion dose was 1:0.59 (mg/mg) in patients with unchanged minimum plasma concentration target levels.Switching from ODT to LCPT was safe and well tolerated in stable LT recipients without cystic fibrosis. A significantly lower dose of LCPT allows similar bioavailability. A conversion ratio 1:0.6 could be enough to maintain similar target levels.

Introduction Long-term survival of lung transplantation (LT) patients is mainly limited by the development of chronic lung allograft dysfunction (CLAD). Lung retransplantation (LR) is an alternative for a selected population. The aim of this study was to review the LR experience in our center. Patients and methods We conducted a retrospective study of patients undergoing LR between August 1990 and July 2017. Results Fourteen LR out of a total of 998 (1.4%) LT were performed. Twelve patients (85.7%) underwent LR due to CLAD: 10 (71.4%) because of bronchiolitis obliterans syndrome and 2 (14.3%) due to restrictive allograft syndrome. LR was performed in 2 patients within 30 days of the first LT. In those who underwent LR due to CLAD, mean time between the first LT and LR was 48 months, and mean duration of invasive mechanical ventilation was 32 days. The increase in FEV1 after LR was 24±18%. The best spirometry values were observed after 7.3 months. Mean survival of the cohort was 43.8 months. In patients with bronchiolitis obliterans syndrome, mean survival was 63.4 months, while in those with restrictive allograft syndrome, it was 19.5 months. Only 1 of the 2 early LR patients survived. Conclusion LR is a therapeutic option in selected patients with CLAD, with acceptable survival. Indication for LR early after LT shows poor outcomes.

The aim of this study was to assess the outcome and tolerability of prophylactic nebulized liposomal amphotericin B (n-LAB) in lung transplant recipients (LTR) and the changing epidemiology of Aspergillus spp. infection and colonization. We performed an observational study including consecutive LTR recipients (2003-2013) undergoing n-LAB prophylaxis lifetime. A total of 412 patients were included (mean postoperative follow-up 2.56 years; IQR 1.01-4.65). Fifty-three (12.8%) patients developed 59 Aspergillus spp. infections, and 22 invasive aspergillosis (overall incidence 5.3%). Since 2009, person-time incidence rates of Aspergillus spp. colonization and infection decreased (2003-2008, 0.19; 2009-2014, 0.09; P = 0.0007), but species with reduced susceptibility or resistance to amphotericin significantly increased (2003-2008, 38.1% vs 2009-2014, 58.1%; P = 0.039). Chronic lung allograft dysfunction (CLAD) was associated with Aspergillus spp. colonization and infection (HR 24.4, 95% CI 14.28-41.97; P = 0.00). Only 2.9% of patients presented adverse effects, and 1.7% required discontinuation. Long-term administration of prophylaxis with n-LAB has proved to be tolerable and can be used for preventing Aspergillus spp. infection in LTR. Over the last years, the incidence of Aspergillus spp. colonization and infection has decreased, but species with reduced amphotericin susceptibility or resistance are emerging. CLAD is associated with Aspergillus spp. colonization and infection.

Cancer is the third most common cause of death among lung transplant (LT) recipients who survive for more than 1 year. The purpose of this study was to analyze the incidence and risk factors for cancer after LT in a Spanish cohort. The epidemiology and risk factors for cancer were retrospectively analyzed in LT recipients from 2 cities in Spain, Madrid and Barcelona. Of the 1353 LT patients initially included in the study, 125 (9.2%) developed cancer after a mean of 3.7 years. This frequency was 5-fold higher than in the general population. The most prevalent tumors were skin cancer (32%), lymphoproliferative disease (18%), and lung cancer (16.5%). In 4 patients, lung cancer was diagnosed on the day of the operation. The risk of cancer increased with age55 year (hazard ratio [HR] 2.89 [1.64-5.09]; P .001), in men (HR 2.8 [1.4-5.6]; P = .004), and in heavy smokers (20 pack-years) (HR 2.94 [1.64-5.27]; P .001). Other factors such as sun exposure were not found to be risk factors. In conclusion, prevalence of cancer is high in LT recipients in a Mediterranean country. Skin tumors, lymphoproliferative disease, and lung cancer are the most prevalent cancers. Age, male sex, and smoking were the main risk factors for cancer in this population.

Introduction: Cardiovascular disease (CD) has an impact on the evolution and prognosis in patients with COPD. The aim of our study was to determine the prevalence of cardiovascular comorbidities in severe COPD patients. Methods: We included patients with COPD evaluated for lung transplant (LT) at the Hospital Universitari Vall D´Hebron Barcelona Spain, from January 2015 to September 2016. All patients underwent echocardiogram, blood analysis, respiratory lung function tests, and cardiac catheterism (CC) as part of the LT protocol. Results: Ninety-two patients with COPD were evaluated for LT during that period. 60.9% were men with a mean age of 48.9 years (SD=29.9). Mean tobacco exposure was 50 pack-years (SD=21,7) and 8.7% were current smokers. 40 patients (43.5%) had a BODE index ≥ 7 points and 63% were on long-term oxygen therapy. 23 patients (25%) had arterial hypertension and 21 (22.8%) had dyslipidemia. Up to 10% had a previous diagnosis of a CD: 4 (4.4%) patients had arrhythmia, 2 (2.2%) heart failure and 3 (3.2%) ischemic heart disease. The echocardiogram showed right ventricle dilatation in 9 patients (10.2%), and 4 had a left ventricle ejection fraction Conclusions: In this selective population of young and severe COPD patients evaluated for LT, the most frequent CD was PH followed by right heart failure and there was a low incidence of ACD.

Introduction: Infections are the main cause of morbi-mortality in lung transplant recipients (LT). The hypogammaglobulinemia (HGG) after lung transplantation has been related to an increased frequency and severity of these infections. Objective: to assess the incidence and severity of HGG in LT candidates. Material and methods: Prospectively, from January 2014 until September 2015 a determination of serum globulin (SGG) was performed (IgG, IgM, IgA) on all LT candidates and their medical records were reviewed. We considered normal IgG levels > 700 mg/dl; mild HGG IgG 600-700mg/dl; moderate HGG IgG 400-600mg/dl and severe HGG IgG> 400 ml/ dl. Results: There were 99 LT candidates. 63 were male (63.6%) with a mean age of 54.1 years (range 27-66). The predominant lung diseases were chronic obstructive pulmonary disease (COPD) and interstitial lung disease (ILD) with 45.4% both. 18 patients (18.1%) had HGG (IgG): 2/18 patients (11.1%) had mild HGG; 12/18 (66.6%) moderate HGG and 4/18 (22.2%) severe HGG. 4 of these patients had a combined form of HGG (IgG and IgM). Thirteen patients with HGG were COPD (13/18, 72.2%): mild HGG 1/13, moderate HGG 8/13 and severe HGG 4/13. Four patients with ILD had HGG, one mild and three moderate. During the study 5/18 patients (27.7%) with HGG were transplanted. Two of them received replacement therapy while were in active list; only one of them had improved GGS levels without reaching normal level Conclusions: 18/99 (18.1%) LT candidates had HGG which was moderate-severe in the most cases 16/18 (88%). The COPD patients had the highest prevalence of HGG 13/18 (72.2%) (p = 0.012), being in 12/13 patients moderate-severe type.

Chronic allograft dysfunction (CLAD) is the main limitation for Lung Transplantation (LT) survival. There is known 2 forms of CLAD: obliterative bronchiolitis syndrome (BOS) and restrictive allograft syndrome (RAS). The detection of the glycoprotein KL-6 in bronchoalveolar lavage (BAL) or serum in LT population may discriminate between both. The objective of the study was to analyse KL-6 levels in BAL and in serum from LT population in differents situations : stable (ST) , infection (LTI), BOS and RAS. Patients and methods - Forty four patients with bilateral LT and who survived more than 3 months were included. The population were divided in 4 groups : 14 ST patients, 10 LTI patients, 12 BOS patients and 8 patients with RAS. BAL and serum samples from the 44 patients were analysed with the Kit KL-6 ( Eidia Co.,Ltd.,Tokyo, Japan). U Mann Whitney were used to analysed differences between groups Results - KL-6 levels in serum were higher in RAS patients at a median of 1042 [IQR 504,9 to 1592]. Significant differences were shown between RAS vs ST, LTI and BOS patients with p-value of 0,0001, 0,0031 and 0,0055 respectively. KL-6 levels in BAL were higher in ST patients at a median of 262,3 [ IQR 117,9 to 661,8 ]. Significant differences were only shown between ST vs LTI patients (p=0,0088) and LTI vs BOS patients ( p=0,0168). Conclusion - KL-6 measured in serum from LT population with RAS are the highest values compared with the rest. KL-6 in serum seems to be better biomarker for RAS than in BAL.

Cancer therapy has been characterized throughout history by ups and downs, not only due to the ineffectiveness of treatments and side effects, but also by hope and the reality of complete remission and cure in many cases. Within the therapeutic arsenal, alongside surgery in the case of solid tumors, are the antitumor drugs and radiation that have been the treatment of choice in some instances. In recent years, immunotherapy has become an important therapeutic alternative, and is now the first choice in many cases. Nanotechnology has recently arrived on the scene, offering nanostructures as new therapeutic alternatives for controlled drug delivery, for combining imaging and treatment, applying hyperthermia, and providing directed target therapy, among others. These therapies can be applied either alone or in combination with other components (antibodies, peptides, folic acid, etc.). In addition, gene therapy is also offering promising new methods for treatment. Here, we present a review of the evolution of cancer treatments, starting with chemotherapy, surgery, radiation and immunotherapy, and moving on to the most promising cutting-edge therapies (gene therapy and nanomedicine). We offer an historical point of view that covers the arrival of these therapies to clinical practice and the market, and the promises and challenges they present.

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P

OBJECTIVES Our aim was to assess the impact of positive cultures for non-Aspergillus molds on the risk of progression to invasive fungal infection (IFI), and the effect of prophylactic nebulized liposomal amphotericin B (n-LAB) on these pathogens. METHODS This was an observational study (2003-2013) including lung transplant recipients (LTR) receiving lifetime n-LAB prophylaxis, in whom non-Aspergillus molds were isolated on respiratory culture before and after transplantation (minimum 1-year follow-up). RESULTS We studied 412 patients, with a mean postoperative follow-up of 2.56 years (interquartile range 1.01-4.65). Pre- and post-transplantation respiratory samples were frequently positive for non-Aspergillus molds (11.9% and 16.9% of LTR respectively). Post transplantation, 10 (2.42%) patients developed non-Aspergillus mold infection (4 Scedosporium species, 4 Purpureocillium species, 1 Penicillium species, and 1 Scopulariopsis species); 5 (1.21%) had IFI, with 60% IFI-related mortality. Non-Aspergillus molds with intrinsic amphotericin B (AB) resistance were more commonly isolated in bronchoscopy samples than AB-variably sensitive or AB-sensitive molds (54.5% vs. 25%, P = 0.04) and were associated with a higher risk of infection (56.3% vs. 1.3%%, P < 0.01). CONCLUSIONS In LTR undergoing n-LAB prophylaxis, pre- and post-transplantation isolation of non-Aspergillus molds is frequent, but IFI incidence (1.21%) is low. Purpureocillium is an emerging mold. AB-resistant non-Aspergillus species were found more often in bronchoscopy samples and were associated with a higher risk of infection.

Preventing influenza infection early after transplantation is essential, given the disease's high mortality. A multicentre prospective cohort study in adult solid organ transplant recipients (SOTR) receiving the influenza vaccine during four consecutive influenza seasons (2009–2013) was performed to assess the immunogenicity and safety of influenza vaccination in SOTR before and 6 months after transplantation. A total of 798 SOTR, 130 of them vaccinated within 6 months of transplantation and 668 of them vaccinated more than 6 months since transplantation. Seroprotection was similar in both groups: 73.1% vs. 76.5% for A/(H1N1)pdm (p 0.49), 67.5% vs. 74.1% for A/H3N2 (p 0.17) and 84.2% vs. 85.2% for influenza B (p 0.80), respectively. Geometric mean titres after vaccination did not differ among groups: 117.32 (95% confidence interval (CI) 81.52, 168.83) vs. 87.43 (95% CI 72.87, 104.91) for A/(H1N1)pdm, 120.45 (95% CI 82.17, 176.57) vs. 97.86 (95% CI 81.34, 117.44) for A/H3N2 and 143.32 (95% CI 103.46, 198.53) vs. 145.54 (95% CI 122.35, 174.24) for influenza B, respectively. After adjusting for confounding factors, time since transplantation was not associated with response to vaccination. No cases of rejection or severe adverse events were detected in patients vaccinated within the first 6 months after transplantation. In conclusion, influenza vaccination within the first 6 months after transplantation is as safe and immunogenic as vaccination thereafter. Thus, administration of the influenza vaccine can be recommended as soon as 1 month after transplantation.

Venous thromboembolism (VTE) is a major complication after solid organ transplantation (SOT), with an incidence that ranges from 2 to 34%. Besides genetic risk factors such as inherited thrombophilia, other specific risk factors for VTE in SOT recipients include impairment of fibrinolysis produced by corticosteroids, in vitro procoagulant effects of calcineurin inhibitors, endothelial damage due to cytomegalovirus infection, and specific surgical factors. Prevention strategies have not been systematically studied. Therefore, it is mandatory for the international scientific community to conduct large, multicenter, randomized clinical trials to define strategies for the prevention of VTE in SOT recipients.

Chemically unmodified sodium hyaluronate has been crosslinked by photoinduced decomposition of a trifunctional diazonium salt to generate new biomaterials. In addition, the photocrosslinking process does not require a photoinitiator. Thin films of formulations of sodium hyaluronate and the photocrosslinker at different percentages have been processed. Cytotoxicity has been explored and toxicity was not observed with the selected cell lines. 2D patterns of controlled geometry have been generated by direct laser writing to perform cell adhesion studies. Different adhesion behavior of the cell lines, as assessed by vinculin immunostaining and scanning electron microscopy, has been observed in the polymeric films depending on the degree of photocrosslinking. © 2012 Elsevier Ltd., This work was supported by the Spanish MEC project MAT2011-27978-C02 and MAT2011-26851-C02-01, ARAID project for young scientists, ERC-Starting Grant NANOPUZZLE and FEDER funding (EU). M. Lomba thanks the Gobierno de Aragón (Spain) for a PhD. Grant. JM de la Fuente thanks ARAID for financial support. B. Saez Gutiérrez thanks ISCIII for financial support (Sara Borrell CD09/00174).