Search

PDF file - 3024K, Time- and dose-dependent effects of KG-501 on the CREB expression and activity of HER-2/neu+ cells. (A) mRNA expression of CREB, CBP, bcl2 and bcl-xL was determined over time upon treatment with 10 �M KG-501 using RT-PCR followed by agarose electrophoresis as described in Materials and Methods. Expression of β-actin served as control. (B) HER-2/neu+ cells were incubated with KG-501 for 48 h at 37{degree sign}C and analysed as described in Materials and Methods. Western blotting using a phospho(Ser-133) mAb was performed and Beta-actin mAb served as the control. The right panel demonstrate the quantified densitometry data (right) are means �SD (n = 3). (C) CFSE-labeled HER-2/neu+ cells were incubated with KG-501 and fluorescence was determined 48 h later on a FACsCalibur. Red line, untreated cells.

Supplementary Methods, Figure Legends and Tables Supplementary Table I: Inhibitors used in this study Supplementary Table II: Summary of primers used for murine (m) and human (h) samples Supplementary Table III: Primer for murine promoter constructs and mutagenesis primer

Supplementary Figure 3: Altered phenotype and growth properties of RAS transformants by CREB silencing

The cyclic (c)AMP responsive element binding protein (CREB) plays a key role in many cellular processes, including differentiation, proliferation, and signal transduction. Furthermore, CREB overexpression was found in tumors of distinct origin and evidence suggests an association with tumorigenicity. To establish a mechanistic link between HER-2/neu–mediated transformation and CREB protein expression and function, in vitro models of HER-2/neu–overexpressing and HER-2/neu–negative/silenced counterparts as well as human mammary carcinoma lesions with defined HER-2/neu status were used. HER-2/neu overexpression resulted in the induction and activation of CREB protein in vitro and in vivo, whereas short hairpin RNA (shRNA)–mediated inhibition of HER-2/neu correlated with downregulated CREB activity. CREB activation in HER-2/neu–transformed cells enhanced distinct signal transduction pathways, whereas their inhibition negatively interfered with CREB expression and/or activation. CREB downregulation in HER-2/neu–transformed cells by shRNA and by the inhibitors KG-501 and lapatinib caused morphologic changes, reduced cell proliferation with G0–G1 cell-cycle arrest, which was rescued by CREB expression. This was accompanied by reduced cell migration, wound healing, an increased fibronectin adherence, invasion, and matrix metalloproteinase expression. In vivo shCREB-HER-2/neu+ cells, but not control cells, exerted a significantly decreased tumorgenicity that was associated with decreased proliferative capacity, enhanced apoptosis, and increased frequency of T lymphocytes in peripheral blood mononuclear cells. Thus, CREB plays an important role in the HER-2/neu–mediated transformation by altering in vitro and in vivo growth characteristics.Implications: These data suggest that CREB affects tumor immunogenicity and is a potential target for cancer therapy. Mol Cancer Res; 11(11); 1462–77. ©2013 AACR.

PDF file - 6761K, Correlation of HER-2/neu with pCREB expression. (A) shHER-2 transfection strongly down-regulates HER-2/neu expression in MCF-7 cells. (B) shHER-2/neu-mediated down-regulation of HER-2/neu in HER-2/neu+ MCF-7 cells results in a reduced in CREB phophorylation. (C) Representative immunohistochemical staining and grading from breast cancer tumor lesions are shown.

Supplementary Figure 6: Histology, immunohistochemistry and morphology of murine tumors

PDF file - 8658K, Immunohistochemical analysis of HER-2/neu+ cells and shCREB-HER-2/neu+ cells following in-vivo tumorigenicity. (A) Representative images from organs of tumor-bearing mice injected with HER-2/neu+ cells and shCREB-HER-2/neu+ cells are shown. The tumors were fixed, embedded in paraffin, and 5 �m slices were stained as indicated. Magnification, 20�. (B) Tumor slices were stained with hematoxylin-eosin and analyzed for apoptosis (TUNEL), proliferation (Ki-67) and CREB expression. Following incubation with a horse-radish-peroxidase-linked antibody, the slices were stained with diaminobenzidine and counterstained with methylene blue. Arrows (apoptosis staining), blood vessels; arrowheads, apoptotic cells. Magnification, 20�.

PDF file - 1836K, Effects of shCREB constructs on CREB protein expression. (A) Efficacy of shCREB knock-down (shCREB-HER-2/neu+ cells) was analyzed using an NC control plasmid and four different shRNA plasmid contructs targeting murine CREB1. The following shRNA sequences were amplified and cloned into a pClip plasmid construct containing a puromycin resistance gene: plasmid #1: TCAGCCGGGTACTACCATTCT; plasmid #2: ACAGGGAGGCAGCAAGAGAAT, plasmid #3: AAGTCCAAACAGTTCAGATTT and plasmid #4: TGCTCCCACTGTAACCTTAGT. Plasmid NC (GGAATCTCATTCGATGCATAC) served as a nonsense control. These plasmids were transfected into HER-2/neu+ cells and CREB protein expression was determined by Western blotting as described in Materials and Methods using an anti-CREB-specific antibody. Arrows point to plasmid constructs that were further used in this study. (B) mRNA expression of ATF-1 and CREM was analyzed in HER-2/neu+ cells and shCREB-HER-2/neu+ cells using q-PCR. Data are means plus-minus SD (n = 3).

Supplementary Figure 4: Distinct adhesion capacities of RASV12 transformants

PDF file - 88K

Supplementary Figure 5: Influence of CREB on MMP promoter activity

Supplementary Figure 2: p-CREB Ser133 expression in colorectal carcinoma lesions with known K-RAS mutation status

PDF file - 101K, Supplementary Table 1. Summary of primers used Supplementary Table 2. Patients and tumor characteristics (n = 112) Supplementary Table 3. pCREB(ser133) status according to clinico-pathological parameters in T1-T2, N0 breast cancer patients (n = 112).

The pig is the most widely used large animal model in Europe, with cardiovascular research being one of the main areas of application. Adequate refinement of interventional studies in this field, meeting the requirements of Russel and Burchs’ 3 R concept, can only be performed if blood-contacting medical devices are hemocompatible. Because most medical devices for cardiovascular interventional procedures are developed for humans they are tested mostly for compatibility with human blood. The aim of this study was therefore to determine whether there are differences in behavior of porcine and human platelets when they come into contact with glass, which was used as an exemplary thrombogenic material. For this purpose changes of platelet count, platelet volume and platelet expression of the activation markers CD61, CD62P and CD63 were measured using a modified chandler loop-system simulating the fluidic effects of the blood flow. Minipig and human platelets showed significant differences in number and volume, but not in activation after 4–8 min exposure to glass.

Engineered heart tissue (EHT) transplantation represents an innovative, regenerative approach for heart failure patients. Late preclinical trials are underway, and the first clinical trial has started in 2021. Preceding studies revealed functional recovery after implantation of in vitro-matured EHT in the subacute stage while transplantation in a chronic injury setting was less efficient. We hypothesized that the use of immature EHT patches (EHTIm) could improve cardiomyocytes (CM) engraftment. Chronic myocardial injury was induced in a guinea pig model (n=14). EHTIm (15×106 cells) were transplanted directly after casting. Functional consequences were assessed by serial echocardiography. Animals were sacrificed four weeks after transplantation and hearts were excised for histological analysis. Cryo-injury lead to large transmural scars amounting to 26% of the left ventricle. Grafts were identified by a positive staining for human Ku80 and dystrophin, remuscularizing 9% of the scar area on average. The CM density in the graft was higher compared to previous studies with in vitro-matured EHTs and showed a greater population of immature CM. Echocardiographic analysis showed a small improvement of left ventricular function after EHTIm transplantation. In a small translational proof-of-concept study human scale EHTIm patches (4.5×108 cells) were epicardially implanted on healthy pig hearts (n=2). In summary, we provide evidence that transplantation of immature EHT patches without pre-cultivation results in better cell engraftment.

Research on animals is essential for science and medical progress. While it is still necessary to conduct this research, it is essential to apply the highest standards in animal welfare, including animal husbandry and care. Furthermore, it is important to recognize the special relationship between research animals and the people who care for them. Caring for research animals can be extremely fulfilling and meaningful, but it also comes with challenges, particularly when caring for animals experiencing pain or distress. These challenges can lead to work-related mental stress. To get more insight into the challenges of working in animal research, we organized a panel discussion at the GV-SOLAS (German Society for Laboratory Animal Science) and IGTP (Interest Group Animal Caretakers) conference 2021 about work wellbeing. This discussion was the first of its kind in Germany. The active panel contributions included the view of an ethical philosopher, a scientist, a lecturer for laboratory animal science, an animal facility manager and an animal caretaker. They gave insights from their perspective into key factors that can affect human wellbeing in animal research. Keys ideas included stigmatization of work, tension between research aims and animal wellbeing, and the importance of supportive culture to overcome work-related strains, as well as lack of education and supportive environments to cope with emotional stress in the workplace. Overall, the discussion has shown that we must also promote human wellbeing when promoting culture of care in animal research, because there is strong relationship between culture of care and individual performance.

In patients with peripheral arterial occlusive disease (PAOD) a restricted circulation in cutaneous microvessels has been reported. In this study the velocity of erythrocytes (very) in finger nailfold capillaries - a vascular area without upstream macroangiopathy - and also in toe nailfold capillaries - a post-stenotic area –was investigated using capillary microscopy in apparently healthy subjects and patients with PAOD. Already in finger nailfold capillaries very of patients with PAOD under resting conditions was significantly lower than in capillaries of healthy subjects. This was also true for the circulation in toe capillaries. In addition, the erythrocyte velocities under resting conditions in the toe capillaries were significantly lower than in the finger capillaries. Similar results were found for the duration and the maximum velocity of postocclusive hyperemia. It is concluded that the resting blood flow in the skin microcirculation is impaired in PAOD patients, both under resting conditions and during postocclusive hyperemia in finger as well in toe nailfold capillaries.

Background Blood supply is an important factor for the normal function of the equine hoof, but earlier studies present conflicting data on functional characteristics of its angioarchitecture. Objective Emphasis was laid on demonstration of the microvascularisation in the different hoof wall regions, aiming at assessment of specialised vascular structures, e.g. vascular sphincter mechanisms and arteriovenous anastomoses. Methods The angioarchitecture of the adult pododerma in the equine hoof wall was examined by scanning electron microscopy of micro-corrosion casts assisted by exemplary histological and immuno-histochemical characterisation of the pododermal vasculature. Results The microvasculature of the lamellae and terminal papillae in all hoof wall regions was described in detail. Focal dilations and microvascular sphincters were a common feature. In contrast to former investigations, true arteriovenous anastomoses were detected at the base of the primary lamellae and the terminal papillae only, while thoroughfare channels proved a regular element within the microvasculature of the wall proper. Bicuspid venous valves were detected as regular feature. For the first time, the alpha-smooth muscle actin-reactivity of the microvascularisation in the hoof wall was systematically assessed, verifying its specialised vasomotor devices. Conclusions The vasculature of the hoof wall displays specific angio-adaptations to high pressure and tensile load.

Background In cardiovascular research small pigs breeds like Gottingen® minipigs (GM) are established animal models, but systematic data about the micromorphology of the GM vasculature at different ages are scarce. Objective The study was aimed at gaining knowledge about the micromorphology of the femoral artery (FA) from German Landrace pigs (DL) and GM during the period of growth over a body weight range of 10-40 kg. Methods FA samples from DL aged two or three months were compared to GM ones, aged 18 or 40 months using transmitted light microscopy. Results All FA samples showed typical characteristics of muscular arteries. Growth was associated with increased vessel wall thickness. In the GM this resulted in a slight decrease of the luminal diameter (LD), while in the DL pigs, an increase of the LD and smooth muscle cell content (10%) with decreased elastic fiber content (10%) has been detected. In contrast, within the 22 months lasting growth period of the GM, the tunica media content of smooth muscle cells and elastic fibers remained stable. Conclusions FA maturation strongly depends on the pig breed and age. It can be different from what is described in humans.

In human cardiovascular research, sheep in particular are used as a large animal model in addition to pigs. In these animals, medical products, developed and tested for human medical purposes, are almost exclusively used in interventional studies. Therefore, the extent to which platelets from human and ovine blood differ in terms of adherence, aggregation and activation after a 4- or 8-minutes exposure to glass was investigated. Testing was performed with platelet-rich plasma (PRP) and a modified chandler loop-system, with 4- and 8-minute blood-material exposure times corresponding to 20 and 40 test cycles, respectively, through the entire silicone tube loop of the test system. In sheep and human PRP, contact with the silicone tubing resulted in a decrease in platelet count after 4 minutes and 20 test cycles, respectively. Four more minutes (20 additional test cycles) caused a further decrease of the platelet count only in sheep PRP. When the silicon tube was partly filled with glass beads, these effects were more pronounced and stronger in sheep then in human PRP. The mean platelet volume, which was used as parameter for platelet aggregation, did not change over time in human PRP without glass exposure. With glass exposure in human and sheep PRP the mean platelet volume increased within 40 test cycles, but this increase was stronger in sheep than in human PRP. Regarding activation behavior, the activation markers CD62P and CD63 were detectable only in

Myocardial injury leads to an irreversible loss of cardiomyocytes (CM). The implantation of human engineered heart tissue (EHT) has become a promising regenerative approach. Previous studies exhibited beneficial, dose-dependent effects of human induced pluripotent stem cell (hiPSC)-derived EHT patch transplantation in a guinea pig model in the subacute phase of myocardial injury. Yet, advanced heart failure often results from a chronic remodeling process. Therefore, from a clinical standpoint it is worthwhile to explore the ability to repair the chronically injured heart. In this study human EHT patches were generated from hiPSC-derived CMs (15 × 10

The aim of this study was to investigate whether the accuracy of multislice contrast-enhanced computed tomography (MS-CECT) may be improved by performing additional subtraction CT.Thirty-five microwave ablations were performed under CT guidance in 12 healthy and anesthetized pigs. Preablation and postablation MS-CECT scans were obtained in arterial and venous contrast phases. These scans were reconstructed and subtracted from each other. Lesion size was measured in a region of interest drawn around the ablation area. Computed tomography measurements were compared with standardized macroscopic images of explanted liver tissue, obtained immediately after ablation. Paired correlation and Bland-Altman analyses were performed for assessing agreement between modalities and ratings.The correlation between lesion size measured in CT and histology was very strong for subtracted images (r = 0.91; 95% confidence interval [CI], 0.8-0.96) and strong for standard MS-CECT images (r = 0.85; 95% CI, 0.68-0.93). Interrater agreement for all measurements was excellent (intraclass correlation coefficient, 0.99; 95% CI, 0.98-0.99 for subtraction and intraclass correlation coefficient, 0.99; 95% CI, 0.98-1.00 for MS-CECT). All differences were statistically significant (P0.05).Subtraction CT was superior to nonsubtracted MS-CECT in measurement of liver lesion size after microwave ablation in a porcine model, achieving a very strong correlation with pathologic measurement and a significantly lower overestimation of lesion size compared with MS-CECT.

Background Radiofrequency ablation (RFA) is an important treatment option for hepatic tumors and metastases. Post-ablation recurrence rates are reported up to 36.5 percent and seem to depend on tumor size, intrahepatic localization of tumors and adjacent hepatic vessels. Multipolar RFA has the potential to overcome/reduce these limitations. Experimental and standardized data on achievable lesion sizes, influence of hepatic vessels and non-invasive evaluation of complete ablation is still insufficient. Objectives The aim of this study was to evaluate the influence of intrahepatic vessels on shape and size of multipolar RF-ablation zones in healthy porcine liver and to evaluate the appropriateness of immediate post-ablation contrast-enhanced computed tomography (CECT) in detecting RF-ablation dimensions. Material and methods We conducted multipolar RFAs in each of the livers of 10 healthy, narcotized and laparotomized domestic pigs by inserting three parallel probes with a constant probe distance and a constant energy supply. In 4 ablations we interrupted hepatic blood flow using Pringle's maneuver. Immediate post-ablation CECT scans were acquired. After euthanasia the livers were sliced perpendicularly to the probes at the probes' active centers. CECT scans were reconstructed equivalently in order to compare RF-lesion size and shape to the macroscopic sections. Results In total, 19 RF-lesions were analyzed. Every RF-lesion that was ablated during physiological liver perfusion showed an irregular and cloverleaf-like shape (n = 15). Interrupting the hepatic blood flow during RFA led to well-defined, round and homogeneous ablation zones which were 3.8 times larger compared to RF-lesions ablated during continuous hepatic perfusion (n = 4). We found an excellent correlation between immediate post-ablation CECT slices and macroscopic sections when comparing RF-lesion diameters and area, although CECT tended to overestimate ablation dimensions. Conclusions The interruption of hepatic blood flow using Pringle's maneuver during multipolar RFA with three applicators significantly reduces heat sink effects of hepatic vessels and generates large and coherent ablation zones. This approach should be considered in each case of ablation planning adjacent to larger hepatic vessels or when ablating larger tumor volumes. Immediate post-ablation CECT has limited value in detecting incomplete RFA periprocedurally.

Background: After application of iodinated contrast media (CM), a pronounced deterioration of the microcirculation in skin and myocardium was reported. Clinically, the repeated application of CM, especially, led to an increase of the renal resistance index (RRI). With respect to the transiency of the RRI increase, it is reasonable to assume that the deterioration of blood flow could be due to transient blood stasis caused by reversible morphologic cell alterations due to osmotic discrepancies between CM and human blood. Therefore, the hypothesis was investigated whether CM are able to induce in vivo such blood stasis and cell deformations in the renal vasculature of well-hydrated pigs. Methods: The in vivo study was performed as a prospective randomized examination to compare the effects of two different CM in 16 pigs (German Landrace). Pigs were randomized to receive either Iodixanol (n = 8), or Iopromide (n = 8). Each animal received 10 injections separated by 5-min intervals via the suprarenal aorta at a rate of 10 mL/s according to the usual procedure during a cardiac catheter examination. Finally, the kidneys were explanted and processed for histology (H & E staining and fibrin staining according to Weigert) as well as for scanning electron microscopy (SEM) with regards to morphologic correlates explaining the changes in the microcirculation. Results: In each of the predefined four categories of vascular diameters, blood stasis were found, but clearly more often after application of Iopromide than after application of Iodixanol (p < 0.001). In addition, Iopromide induced more blood stasis in all of the examined kidney regions compared to Iodixanol (p = 0.0001). There were no obstructive events in the middle cortex following the application of Iodixanol. Except for the region around a puncture channel of a placed-in catheter probe, no fibrin was detected in Weigert’s fibrin-stained samples, neither around the histologically assessed thrombi nor in vessels with blood stasis. Complementary SEM analyses revealed in a few cases only a slight generation of fibrin and thrombi and deformations, such as echinocyte and “box-like” deformations. Conclusions: According to previous in vitro studies, pathological erythrocyte deformations, such as echinocyte and box-like formation of erythrocytes, were observed also in vivo. In addition, blood stasis and/or thrombi could be detected in histological samples from explanted kidneys from young pigs after repeated in vivo administration of CM. In only a few cases, mural platelet aggregates within minimal fibrin meshes occurred only after the application of Iopromide.

The purpose of this study was to gain knowledge about the micromorphology of the porcine common carotid artery (CCA) during the period of growth over the bodyweight range of 10-40 kg. CCA samples from German landrace pigs (DL) aged either 2 or 3 months (DL-2 and DL-3) were compared with samples from Göttingen minipigs (GM) aged either 18 or 40 months (GM-18 and GM-40) using transmitted light (phase-contrast mode) and transmission electron microscopy. The GM-18, GM-40 and the DL-3 groups had typical muscular artery histological characteristics. Contrasting to this, the 2-month-old DL pigs had a transitional artery type being characterized by a significantly higher proportion of elastic fibres and a significantly lower number of smooth muscle cells than did the 1 month older DL-3. During the period of maturation, the tunica media of the CCA in GM animals thickened by 1.3× and in DL animals by 2.5× resulting in an overall increased vessel wall thickness. The cumulated thickness of the tunica interna (endothelium, stratum subendotheliale and internal elastic lamina) and the tunica media (including the external elastic lamina) of DL-3 and GM-40 pigs were similar to each other and comparable to that of humans. With an increasing vessel wall thickness, the luminal diameter decreased in GM by 19% and in DL by 11%. Additionally, in the older age groups, GM-40 and DL-3, the internal elastic lamina principally was continuous, but there were also interrupted large segments of elastic lamina separated by gaps. In addition, the principal internal elastic lamina was duplicated in several places.

In drug eluting stents the cytostatic drugs Sirolimus or Tacrolimus are used to inhibit blood vessel restenosis by limiting the proliferation of smooth muscle cells. However, the cytostatic activity of both drugs was shown to be not cell specific and could also affect the stent endothelialisation, respectively. Currently, only limited in vitro data are available about the impact of Sirolimus and Tacrolimus on endothelial cell proliferation over a broad concentration range. To answer this question the following study was performed.Commercially obtained HUVEC were expanded with DMEM cell culture medium (GIBCO, Germany) supplemented with 5 vol% fetal calf serum on non-coated regular polystyrene-based 24-multiwell plates. For drug testings 2×104 cells/cm2 were seeded and grown for 24 h until 30-40% of the multiwell surfaces were covered and then exposed to Sirolimus (1.0×10-11 - 1.0×10-5 mol/l) or Tacrolimus (2.0×10-8 - 6.2×10-5 mol/l), both dissolved in DMSO. 12, 24 and 48 h after adding the drugs cell numbers per area were quantified by counting the cells in six wells with four fields of view per well, representing 0.6 mm2, using a confocal laser microscope.After 48 h of cell growth in the drug-free cell culture medium, the HUVEC number increased from 2.0×104 to 3.55×104 cells/cm2 (mean cell doubling time: 53.6 h, n = 6). At lower concentrations (≤2.0×10-6 mol/l) Tacrolimus reduced the number of adherent HUVEC significantly less than Sirolimus (p < 0.05). However, at higher concentrations (≥2.07×10-5 mol/l) the effect of Tacrolimus on the number of adherent endothelial cells was significantly greater than that of Sirolimus (p < 0.05). At the highest concentration applied (6.22×10-5 mol/l), Tacrolimus induced detachment of all HUVECs within 12 h after drug application. The number of adherent HUVEC decreased only slightly (about 9%) after Sirolimus application at the highest concentration (1.09×10-5 mol/l).These data show that in a non-flow model the cytostatic drug Tacrolimus reduced the number of adherent endothelial cells less than Sirolimus, as long as the drug concentration did not surpass 10-6 mol/l. At the limits of solubility, Sirolimus (1×10-5 mol/l) reduced the number of adherent endothelial cells less than Tacrolimus (6×10-5 mol/l), which induced detachment of endothelial cells.

BACKGROUND Continuing research ex vivo and in vivo with animal models is performed to advance the oncological safety of radiofrequency ablation (RFA) of liver tumors. In these experiments, frequently imaging modalities (e.g. MRI or CT) or macro-morphological measurements are used to determine the full extent of the different ablation zones inside of RFA lesions. However, no systematic study has been performed so far, which verified the accuracy of the macro-morphological findings. Therefore, the present study aimed to correlate histological and gross pathological findings of bipolar radiofrequency ablation zones of porcine livers with regard to cell viability in vivo. METHODS Bipolar RFA was performed in the liver of anaesthetized female domestic pigs under CT-guidance using an internally cooled 20 mm RFA applicator. Afterwards RFA cross sections of the liver were made in a perpendicular orientation to the applicator. Ablation zones were initially documented by photography and thereafter prepared for histological analysis. Latter was based on HE-staining and NADH-diaphorase cell viability staining. Micro- and macro-morphological sections were digitally analyzed along the cross-section area for statistical correlation. RESULTS Three different RF ablation zones could be differentiated. A central zone showing no cell viability (white zone) was surrounded by a red zone. The red zone could be divided into an inner zone of viable and non-viable cells (red zone 1), followed by a zone of edema with mostly viable cells (red zone 2).Micro- and macro-morphological data showed a strong correlation for the white zone (r = 0.95, p

Laboratory mice of both sexes having free access to running wheels are commonly used to study mechanisms underlying the beneficial effects of physical exercise on health and aging in human. However, comparative wheel-running activity profiles of male and female mice for a long period of time in which increasing age plays an additional role are unknown. Therefore, we permanently recorded the wheel-running activity (i.e., total distance, median velocity, time of breaks) of female and male mice until 9months of age. Our records indicated higher wheel-running distances for females than males which were highest in 2-month-old mice. This was mainly reached by higher running velocities of the females and not by longer running times. However, the sex-related differences declined in parallel to the age-associated reduction in wheel-running activities. Female mice also showed more variances between the weekly running distances than males, which were recorded most often for females being 4-6months old but not older. Additional records of 24-month-old mice of both sexes indicated highly reduced wheel-running activities at old age. Surprisingly, this reduction at old age resulted mainly from lower running velocities and not from shorter running times. Old mice also differed in their course of night activity which peaked later compared to younger mice. In summary, we demonstrated the influence of sex on the age-dependent activity profile of mice which is somewhat contrasting to humans, and this has to be considered when transferring exercise-mediated mechanism from mouse to human.

The cAMP-responsive element-binding protein (CREB) is involved in the tumorigenicity of HER-2/neu-overexpressing murine and human tumor cells, but a link between the HER-2/neu-mediated CREB activation, its posttranslational modification and localization and changes in the cellular metabolism, due to an altered (tumor) microenvironment remains to be established. The present study demonstrated that shRNA-mediated silencing of CREB in HER-2/neu-transformed cells resulted in decreased tumor formation, which was associated with reduced angiogenesis, but increased necrotic and hypoxic areas in the tumor. Hypoxia induced pCREBSer133, but not pCREBSer121 expression in HER-2/neu-transformed cells. This was accompanied by upregulation of the hypoxia-inducible genes GLUT1 and VEGF, increased cell migration and matrix metalloproteinase-mediated invasion. Treatment of HER-2/neu+ cells with signal transduction inhibitors targeting in particular HER-2/neu was able to revert hypoxia-controlled CREB activation. In addition to changes in the phosphorylation, hypoxic response of HER-2/neu+ cells caused a transient ubiquitination and SUMOylation as well as a co-localization of nuclear CREB to the mitochondrial matrix. A mitochondrial localization of CREB was also demonstrated in hypoxic areas of HER-2/neu+ mammary carcinoma lesions. This was accompanied by an altered gene expression pattern, activity and metabolism of mitochondria leading to an increased respiratory rate, oxidative phosphorylation and mitochondrial membrane potential and consequently to an enhanced apoptosis and reduced cell viability. These data suggest that the HER-2/neu-mediated CREB activation caused by a hypoxic tumor microenvironment contributes to the neoplastic phenotype of HER-2/neu+ cells at various levels.

The incidence of obesity is on the rise in most western countries and represents major risks to health. Obesity causes complex metabolic dysfunctions and can be associated with a large number of secondary diseases. To investigate causal mechanisms of obesity and develop better options for treatment, researchers study the condition in animal models. In addition to genetically engineered animal models, diet-induced obesity is often used because it occurs similarly in animals as it does in humans. For several types of investigations that use obesity models, investigators must carry out surgical interventions and they frequently encounter severe perioperative complications induced by anesthesia. In an example of this problem, we observed 100% mortality in obese BALB/c mice after ovariectomy, despite no obvious surgical complications. We supposed that a failure to recover from surgery was the primary cause of this increased mortality. Therefore, to support their recovery from surgery we administered atropine to obese mice in order to facilitate blood circulation, and we also increased the oxygen content of the ambient air. With this specific support before and after surgery, we increased the survival rate of obese ovariectomized mice up to 83%. These results confirm the assumption that obesity is a risk factor for the recovery of obese animal models after ovariectomy, and they highlight the need to provide additional interventions for such experimental animals.

Laser tissue soldering (LTS) based on indocyanine green (ICG)-mediated heat-denaturation of proteins might be a promising alternative technique for micro-suturing, but up to now the problem of too weak shear strength of the solder welds in comparison to sutures is not solved. Earlier reports gave promising results showing that solder supported by carrier materials can enhance the cohesive strength of the liquid solder. In these studies, the solder was applied to the carriers by dip coating. Higher reliability of the connection between the solder and the carrier material is expected when the solder is bound covalently to the carrier material. In the present study a poly(ether imide) (PEI) membrane served as carrier material and ICG-supplemented albumin as solder substrate. The latter was covalently coupled to the carrier membrane under physiological conditions to prevent structural protein changes. As laser source a diode continuous-wave laser emitting at 808 nm with intensities between 250 mW and 1500 mW was utilized. The albumin functionalized carrier membrane was placed onto the tunica media of explanted pig thoracic aortae forming an overlapping area of approximately 0.5×0.5 cm2. All tests were performed in a dry state to prevent laser light absorption by water. Infrared spectroscopy, spectro-photometrical determination of the secondary and primary amine groups after acid orange II staining, contact angle measurements, and atomic force microscopy proved the successful functionalization of the PEI membrane with albumin. A laser power of 450 mW LTS could generate a membrane-blood vessel connection which was characterized by a shear strength of 0.08±0.002 MPa, corresponding to 15% of the tensile strength of the native blood vessel. Theoretically, an overlapping zone of 4.1 mm around the entire circumference of the blood vessel could have provided shear strength of the PEI membrane-blood vessel compound identical to the tensile strength of the native blood vessel. These in-vitro results confirmed the beneficial effects of solder reinforcement by carrier membranes, and suggest LTS with covalently bound solders on PEI substrates for further studies in animal models.

Human microvascular ECs from the neonatal foreskin of two donors purchased from one distributor were used in an angiogenesis assay under the same culture conditions. Different angiogenic potency was apparent in these two batches (ECang and ECnon-ang). During the cultivation period of three weeks, ECang ran through all stages of angiogenesis starting from proliferation to migration up to the formation of three-dimensional capillary-like structures. Despite of expression of endothelial markers, ECnon-ang showed excessive intracellular storage of lipids in form of multilamellar bodies and decreased angiogenic potency in contrast to its counterpart, ECang. Results indicate that lipid metabolism differs in ECang versus ECnon-ang. This study points up that these differences are based on the different donors and presents a novel and valuable model for the study of mechanisms of atherosclerosis in endothelial cells in vitro.

BACKGROUND Radiofrequency ablation (RFA) is an evolving technique in treatment of hepatic malignant tumors. By heating local tissue it leads to coagulative necrotic areas around the ablation probe. Temperature falls with increasing distance to the probe, risking incomplete necrosis at the margins of the RFA-induced lesion. Therefore, immediate non-invasive and precise detection of incomplete ablation is necessary for early enlargement of the ablation if needed. OBJECTIVES This in vivo pig study compares early experiences of immediate post-interventional computed tomography (CT) perfusion volume analysis to macroscopic and CT image evaluation in healthy pig liver. MATERIAL AND METHODS RFA was performed in vivo in healthy pig livers. Different CT perfusion algorithms (Maximum slope analysis and Patlak plot) were used to quantify three different perfusion parameters. Data points were acquired from rectangular grids. These grids were semiautomatically overlayed to macroscopic images documented after liver explantation. Each data point was visually assigned to zones defined as "inner" and "outer necrotic zone", "margin" or "vital tissue". RESULTS Significant differences between necrotic zones and vital tissue are shown for equivalent blood volume (p < 0.0001), arterial flow (p < 0.01) and flow extraction product (p < 0.001). Looking at equivalent blood volume and flow extraction product, there were also significant differences (EquivBV: p < 0.0001, FE: p < 0.001) between margins, necrotic and vital areas. CONCLUSIONS In a porcine model these early results could show that all of the used CT perfusion parameters allowed discrimination of necrosis from vital tissue after RFA at high levels of significance. In addition, the parameters EquivBV and FE that give an estimate of the tissue blood volume and the permeability, were able to precisely discern different zones also seen macroscopically. From this data CT perfusion analysis could be precise tool for measurement and visualization of ablated liver lesions and for immediate detection of incomplete ablation areas.

Biomaterials made of zinc have been widely described to be antioxidative, hypothrombogenic, antiinflammatory and antiproliferative. Additionally in vivo zinc is toxic only in high concentrations and can completely be metabolized in vivo. Due to these properties zinc based vascular stents might be able to reduce the rate of restenosis in comparison to bare metal stents and zinc stents might be also able to limit the foreign body reaction. In the presented study we tested the biocompatibility and degradability of a stent made of zinc and characterized by a closed-cell-design to achieve high opening force and to increase stent stiffness. After 100 days of enzymatic and hydrolytic degradation in 15 ml blood serum (fetal calf serum) a significant loss of weight (1.72 wt% ) was measured. Zinc was compared to other metals in terms of degradation rates. After six weeks of incubation in physiologic sodium chloride solution zinc showed the slowest degradation time, 6 times less than stainless steel and 4 times less than magnesium. In the tests for cytotoxic effects the degraded zinc stent caused no changes in the LDH-release and cell membrane integrity (3T3 cells, mouse fibroblasts) respectively, in the cell activity/proliferation (MTS assay) and in the morphological characteristics of the cells and cell layers in comparison to the control material (polystyrene). Based on these results the tested zinc stent proved to be non-cytotoxic and to be characterized by degradation characteristics which might be advantageous in comparison to magnesium and stainless steel.

Oncogenic transformation is often associated with an increased expression of the cAMP response element binding (CREB) transcription factor controlling the expression of genes involved in cell proliferation, cell cycle, apoptosis, and tumor development, but a link between K-RASV12-induced transformation and CREB has not yet been determined. Therefore, the constitutive and/or inhibitor-regulated mRNA and protein expression of CREB and signal transduction components and growth properties of parental fibroblasts, K-RASV12-transformed counterparts, shCREB K-RASV12 transfectants and human colon carcinoma cells were determined. Increased CREB transcript and protein levels accompanied by an enhanced CREB activity was detected in K-RASV12-transformed murine fibroblasts and K-RASV12-mutated human tumor cells, which is dependent on the MAPK/MEK, PI3K, and/or PKC signal transduction. Immunohistochemical (IHC) staining of colorectal carcinoma lesions and murine tumors, with known KRAS gene mutation status, using antibodies specific for CREB and phospho-CREB, revealed a mechanistic link between CREB expression and K-RASV12-mutated colorectal carcinoma lesions when compared with control tissues. Silencing of CREB by shRNA and/or treatment with a CREB inhibitor (KG-501) reverted the neoplastic phenotype of K-RASV12 transformants as demonstrated by a more fibroblast-like morphology, enhanced apoptosis sensitivity, increased doubling time, decreased migration, invasion and anchorage-independent growth, reduced tumorigenesis, and enhanced immunogenicity in vivo . The impaired shCREB-mediated invasion of K-RASV12 transformants was accompanied by a transcriptional downregulation of different matrix metalloproteinases (MMP) coupled with their reduced enzymatic activity. Implications: CREB plays a key role in the K-RASV12-mediated neoplastic phenotype and represents a suitable therapeutic target for murine and human K-RASV12-induced tumors. Mol Cancer Res; 13(8); 1248–62. ©2015 AACR . This article is featured in Highlights of This Issue, [p. 1161][1] [1]: /lookup/volpage/13/1161?iss=8

The dental pulp is an important soft connective tissue which is able to produce dentin over time as a reaction on external stimuli. It also maintains the biological and physiological vitality of the dentin. Due to this the pulp is essential for teeth homeostasis. However, dental caries is still one of the most prevalent health problems in dentistry and therefore, one major cause for early loss of the dental pulp vitality and subsequent tooth extractions. Meanwhile the potential for successful pulp regeneration therapy is increasing due to advances in the field of regenerative endodontics. Thus, adequate experimental animal models are required for testing and validating these new regenerative therapies. Rodents and rats in particular, are relevant models for experimental periodontal research. The breeding and housing costs of rats are relatively low facilitating studies with sufficient numbers for statistical analysis in comparison to bigger sized mammals like beagle dogs, miniature pigs or monkeys. Additionally, rat molar teeth and pulps are characterized by similar anatomical, histological, biological and physiological features to human teeth. Essential biological reactions of the pulp tissue and the interaction during the different stages of wound healing of rat molar teeth are comparable to that of other mammals. However, despite of the multiple research activities in the field of regenerative endodontics and the above mentioned advantages of the rat model only rare in vivo studies are published. Therefore, the presented study aimed to introduce the rat molar teeth as a valid model for studying dental pulp stem cell based endodontic tissue regeneration. Human dental pulp stem cells were implanted into the pulp of immunodeficient rats (RNU rats). Cell growth was supported by a collagenous membrane, which was applied on top of the cells after implantation. After closing the pulpal cavity with a light-polymerisable resin human dental pulp stem cells were able to maintain cell viability in the rat molar pulp niche for at least three weeks. This demonstrated the suitability of immunodeficient RNU rats for non-autologous dental stem cell based endodontic tissue engineering approaches.

BACKGROUND: The “Isolated lung perfusion system” has been established to study lung physiological parameters of mice or other small animals, but little is known about the influence of age on the lung function in mice. METHODS:We used a buffer-perfused lung system with negative-pressure ventilation to study the effect of age on physiological parameters in the isolated mouse lung. Our study included C57BL/6N mice when they were young (3 to 4 months), adult (5 to 9 months) or old (24 months). RESULTS: The ex vivo data indicated that maximal function of the lung is achieved in the early adulthood (5 to 6 months of age). In this period, lung developed highest maximal expiratory flow rate which declined steadily with increasing age. After this age (>7 months) the dynamic lung compliance increased with significant changes in the 24-month-old mice. However, mouse age had no effect on airway resistance and pulmonary artery pressure. Moreover, we did not find an influence of age on the integrity of the endothelial-epithelial barrier. CONCLUSION: Our findings indicate the importance of age, in particular on the respiratory mechanics in isolated mouse lungs, which should be considered in the pulmonary research using the “Isolated lung perfusion system”.