Search

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

Cellulose synthesis is precisely regulated by internal and external cues, and emerging evidence suggests that light regulates cellulose biosynthesis through specific light receptors. Recently, the blue light receptor CRYPTOCHROME 1 (CRY1) was shown to positively regulate secondary cell wall biosynthesis in Arabidopsis (Arabidopsis thaliana). Here, we characterize the role of FLAVIN-BINDING KELCH REPEAT, F-BOX 1 (FKF1), another blue light receptor and well-known photoperiodic flowering time regulator, in cellulose biosynthesis. A phenotype suppression screen using a cellulose deficient mutant cesa1aegeus,cesa3ixr1-2 (c1,c3), which carries nonlethal point mutations in CELLULOSE SYNTHASE A 1 (CESA1) and CESA3, resulted in identification of the phenotype-restoring large leaf (llf) mutant. Next-generation mapping using the whole genome resequencing method identified the llf locus as FKF1. FKF1 was confirmed as the causal gene through observation of the llf phenotype in an independent triple mutant c1,c3,fkf1-t carrying a FKF1 T-DNA insertion mutant. Moreover, overexpression of FKF1 in llf plants restored the c1,c3 phenotype. The fkf1 mutants showed significant increases in cellulose content and CESA gene expression compared with that in wild-type Columbia-0 plants, suggesting a negative role of FKF1 in cellulose biosynthesis. Using genetic, molecular, and phenocopy and biochemical evidence, we have firmly established the role of FKF1 in regulation of cellulose biosynthesis. In addition, CESA expression analysis showed that diurnal expression patterns of CESAs are FKF1 independent, whereas their circadian expression patterns are FKF1 dependent. Overall, our work establishes a role of FKF1 in the regulation of cell wall biosynthesis in Arabidopsis. [ABSTRACT FROM AUTHOR]

The plant GT43 protein family includes xylosyltransferases that are known to be required for xylan backbone biosynthesis, but have incompletely understood specificities. RT-q PCR and histochemical ( GUS) analyses of expression patterns of GT43 members in hybrid aspen, reported here, revealed that three clades of the family have markedly differing specificity towards secondary wall-forming cells (wood and extraxylary fibres). Intriguingly, GT43 A and B genes (corresponding to the Arabidopsis IRX9 clade) showed higher specificity for secondary-walled cells than GT43 C and D genes ( IRX14 clade), although both IRX9 and IRX14 are required for xylosyltransferase activity. The remaining genes, GT43 E, F and G ( IRX9- L clade), showed broad expression patterns. Transient transactivation analyses of GT43 A and B reporters demonstrated that they are activated by Ptxt MYB021 and PNAC085 (master secondary wall switches), mediated in Ptxt MYB021 activation by an AC element. The high observed secondary cell wall specificity of GT43 B expression prompted tests of the efficiency of its promoter ( p GT43 B), relative to the Ca MV 35 S ( 35 S) promoter, for overexpressing a xylan acetyl esterase ( CE5) or downregulating REDUCED WALL ACETYLATION ( RWA) family genes and thus engineering wood acetylation. CE5 expression was weaker when driven by p GT43 B, but it reduced wood acetyl content substantially more efficiently than the 35 S promoter. RNAi silencing of the RWA family, which was ineffective using 35 S, was achieved when using GT43 B promoter. These results show the utility of the GT43 B promoter for genetically engineering properties of wood and fibres. [ABSTRACT FROM AUTHOR]

Mass spectrometry is broadly employed to study complex molecular mechanisms in various biological and environmental fields, enabling 'omics' research such as proteomics, metabolomics, and lipidomics. As study cohorts grow larger and more complex with dozens to hundreds of samples, the need for robust quality control (QC) measures through automated software tools becomes paramount to ensure the integrity, high quality, and validity of scientific conclusions from downstream analyses and minimize the waste of resources. Since existing QC tools are mostly dedicated to proteomics, automated solutions supporting metabolomics are needed. To address this need, we developed the software PeakQC, a tool for automated QC of MS data that is independent of omics molecular types (i.e., omics-agnostic). It allows automated extraction and inspection of peak metrics of precursor ions (e.g., errors in mass, retention time, arrival time) and supports various instrumentations and acquisition types, from infusion experiments or using liquid chromatography and/or ion mobility spectrometry front-end separations and with/without fragmentation spectra from data-dependent or independent acquisition analyses. Diagnostic plots for fragmentation spectra are also generated. Here, we describe and illustrate PeakQC's functionalities using different representative data sets, demonstrating its utility as a valuable tool for enhancing the quality and reliability of omics mass spectrometry analyses.