Search

Abstract Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Osteosarcoma is the most common primary malignancy of bones and primarily occurs in adolescents and young adults. However, a second smaller peak of osteosarcoma incidence was reported in the elderly aged more than 60. Elderly patients with osteosarcoma exhibit different characteristics compared to young patients, which usually results in a poor prognosis. The mechanism underlying osteosarcoma development in elderly patients is intriguing and of significant value in clinical applications. Senescent cells can accelerate tumor progression by metabolic reprogramming. Recent research has shown that methylmalonic acid (MMA) was significantly up-regulated in the serum of older individuals and played a central role in the development of aggressive characteristics. We found that the significant accumulation of MMA in elderly patients imparted proliferative potential to osteosarcoma cells. The expression of MAFB was excessively up-regulated in osteosarcoma specimens and was further enhanced in response to MMA accumulation as the patient aged. Specifically, we first confirmed a novel molecular mechanism between cellular senescence and cancer, in which the MMA-driven transcriptional reprogramming of the MAFB-NOTCH3 axis accelerated osteosarcoma progression via the activation of PI3K-AKT pathways. Moreover, the down-regulation of the MAFB-NOTCH3 axis increased the sensitivity and effect of AKT inhibitors in osteosarcoma through significant inhibition of AKT phosphorylation. In conclusion, we confirmed that MAFB is a novel age-dependent biomarker for osteosarcoma, and targeting the MAFB-NOTCH3 axis in combination with AKT inhibition can serve as a novel therapeutic strategy for elderly patients with osteosarcoma in experimental and clinical trials.