Search

Non-alcoholic fatty liver disease (NAFLD) afflicts a significant percentage of the population; however, no effective treatments have yet been established because of the unsuitability of in vitro assays and animal experimental models. Here, we present an integrated-gut-liver-on-a-chip (iGLC) platform as an in vitro human model of the gut-liver axis (GLA) by co-culturing human gut and liver cell lines interconnected via microfluidics in a closed circulation loop, for the initiation and progression of NAFLD by treatment with free fatty acids (FFAs) for 1 and 7 days, respectively. Co-cultured Caco-2 gut-mimicking cells and HepG2 hepatocyte-like cells demonstrate the protective effects from apoptosis against FFAs treatment, whereas mono-cultured cells exhibit induced apoptosis. Phenotype and gene expression analyses reveal that the FFAs-treated gut and liver cells accumulated intracellular lipid droplets and show an increase in gene expression associated with a cellular response to copper ions and endoplasmic reticulum stress. As an in vitro human GLA model, the iGLC platform may serve as an alternative to animal experiments for investigating the mechanisms of NAFLD., 非アルコール性脂肪性肝疾患を再現した腸・肝連結臓器チップの開発. 京都大学プレスリリース. 2023-04-07., Two-organ chip to answer fatty liver questions. 京都大学プレスリリース. 2023-04-07.

Aptamers, due to their small size, strong target affinity, and ease of chemical modification, are ideally suited for molecular detection technologies. Here, we describe successful use of aptamer technology in a consumer device for the detection of peanut antigen in food. The novel aptamer-based protein detection method is robust across a wide variety of food matrices and sensitive to peanut protein at concentrations as low as 12.5 ppm (37.5 µg peanut protein in the sample). Integration of the assay into a sensitive, stable, and consumer friendly portable device will empower users to easily and quickly assess the presence of peanut allergens in foods before eating. With most food reactions occurring outside the home, the type of technology described here has significant potential to improve lives for children and families.

Preclinical cancer research ranges from in vitro studies that are inexpensive and not necessarily reflective of the tumor microenvironment to mouse studies that are better models but prohibitively expensive at scale. Chorioallantoic membrane (CAM) assays utilizing Japanese quail (Coturnix japonica) are a cost-effective screening method to precede and minimize the scope of murine studies for anti-cancer efficacy and drug toxicity. To increase the throughput of CAM assays we have built and optimized an 11-day platform for processing up to 200 quail eggs per screening to evaluate drug efficacy and drug toxicity caused by a therapeutic. We demonstrate ex ovo concordance with murine in vivo studies, even when the in vitro and in vivo studies diverge, suggesting a role for this quail shell-free CAM xenograft assay in the validation of new anti-cancer agents.

The progress of the SARS-CoV-2 pandemic requires the design of large-scale, cost-effective testing programs. Pooling samples provides a solution if the tests are sensitive enough. In this regard, the use of the gold standard, RT-qPCR, raises some concerns. Recently, droplet digital PCR (ddPCR) was shown to be 10–100 times more sensitive than RT-qPCR, making it more suitable for pooling. Furthermore, ddPCR quantifies the RNA content directly, a feature that, as we show, can be used to identify nonviable samples in pools. Cost-effective strategies require the definition of efficient deconvolution and re-testing procedures. In this paper we analyze the practical implementation of an efficient hierarchical pooling strategy for which we have recently derived the optimal, determining the best ways to proceed when there are impediments for the use of the absolute optimum or when multiple pools are tested simultaneously and there are restrictions on the throughput time. We also show how the ddPCR RNA quantification and the nested nature of the strategy can be combined to perform self-consistency tests for a better identification of infected individuals and nonviable samples. The studies are useful to those considering pool testing for the identification of infected individuals.

Cellular circulating biomarkers from the primary tumor such as circulating tumor cells (CTCs) and circulating hybrid cells (CHCs) have been described to harbor tumor-like phenotype and genotype. CHCs are present in higher numbers than CTCs supporting their translational potential. Methods for isolation of CHCs do not exist and are restricted to low-throughput, time consuming, and biased methodologies. We report the development of a label-free dielectrophoretic microfluidic platform facilitating enrichment of CHCs in a high-throughput and rapid fashion by depleting healthy peripheral blood mononuclear cells (PBMCs). We demonstrated up to 96.5% depletion of PBMCs resulting in 18.6-fold enrichment of cancer cells. In PBMCs from pancreatic adenocarcinoma patients, the platform enriched neoplastic cells identified by their KRAS mutant status using droplet digital PCR with one hour of processing. Enrichment was achieved in 75% of the clinical samples analyzed, establishing this approach as a promising way to non-invasively analyze tumor cells from patients., Montoya Mira & Sapre et al. design a microfluidic device utilizing dielectrophoresis for the enrichment of circulating neoplastic cells that possess both epithelial and immune-like characteristics. They optimized the device using in vitro models and then applied it to clinical samples for clinically relevant mutation analyses.

Conventional neuronal network pattern formation techniques cannot control the arrangement of axons and dendrites because network structures must be fixed before neurite differentiation. To overcome this limitation, we developed a non-destructive stepwise microfabrication technique that can be used to alter microchannels within agarose to guide neurites during elongation. Micropatterns were formed in thin agarose layer coating of a cultivation dish using the tip of a 0.7 $$\upmu \mathrm{m}$$ μ m -diameter platinum-coated glass microneedle heated by a focused 1064-nm wavelength infrared laser, which has no absorbance of water. As the size of the heat source was 0.7 $$\upmu \mathrm{m}$$ μ m , which is smaller than the laser wavelength, the temperature fell to 45 $$^\circ \hbox {C}$$ ∘ C within a distance of 7.0 $$\upmu \mathrm{m}$$ μ m from the edge of the etched agarose microchannel. We exploited the fast temperature decay property to guide cell-to-cell connection during neuronal network cultivation. The first neurite of a hippocampal cell from a microchamber was guided to a microchannel leading to the target neuron with stepwise etching of the micrometer resolution microchannel in the agarose layer, and the elongated neurites were not damaged by the heat of etching. The results indicate the potential of this new technique for fully direction-controlled on-chip neuronal network studies.

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

The need for rapid, accurate, and scalable testing systems for COVID-19 diagnosis is clear and urgent. Here, we report a rapid Scalable and Portable Testing (SPOT) system consisting of a rapid, highly sensitive, and accurate assay and a battery-powered portable device for COVID-19 diagnosis. The SPOT assay comprises a one-pot reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) followed by PfAgo-based target sequence detection. It is capable of detecting the N gene and E gene in a multiplexed reaction with the limit of detection (LoD) of 0.44 copies/μL and 1.09 copies/μL, respectively, in SARS-CoV-2 virus-spiked saliva samples within 30 min. Moreover, the SPOT system is used to analyze 104 clinical saliva samples and identified 28/30 (93.3% sensitivity) SARS-CoV-2 positive samples (100% sensitivity if LoD is considered) and 73/74 (98.6% specificity) SARS-CoV-2 negative samples. This combination of speed, accuracy, sensitivity, and portability will enable high-volume, low-cost access to areas in need of urgent COVID-19 testing capabilities., There is a clear need for rapid, accurate and scalable Covid-19 diagnostics. Here the authors use PfAgo to detect viral sequences amplified by RT-LAMP in a handheld battery-powered device.

Efforts to contain the spread of SARS-CoV-2 have spurred the need for reliable, rapid, and cost-effective diagnostic methods which can be applied to large numbers of people. However, current standard protocols for the detection of viral nucleic acids while sensitive, require a high level of automation and sophisticated laboratory equipment to achieve throughputs that allow whole communities to be tested on a regular basis. Here we present Cap-iLAMP (capture and improved loop-mediated isothermal amplification) which combines a hybridization capture-based RNA extraction of gargle lavage samples with an improved colorimetric RT-LAMP assay and smartphone-based color scoring. Cap-iLAMP is compatible with point-of-care testing and enables the detection of SARS-CoV-2 positive samples in less than one hour. In contrast to direct addition of the sample to improved LAMP (iLAMP), Cap-iLAMP prevents false positives and allows single positive samples to be detected in pools of 25 negative samples, reducing the reagent cost per test to ~1 Euro per individual., Current SARS-CoV-2 diagnostic methods are sensitive yet poorly suited to testing whole communities on a regular basis. Here the authors present Cap-iLAMP that tests gargle lavage samples with an improved colorimetric RT-LAMP.

Much effort has been expended on building cellular computational devices for different applications. Despite the significant advances, there are still several addressable restraints to achieve the necessary technological transference. These improvements will ease the development of end-user applications working out of the lab. In this study, we propose a methodology for the construction of printable cellular devices, digital or analogue, for different purposes. These printable devices are designed to work in a 2D surface, in which the circuit information is encoded in the concentration of a biological signal, the so-called carrying signal. This signal diffuses through the 2D surface and thereby interacts with different device components. These components are distributed in a specific spatial arrangement and perform the computation by modulating the level of the carrying signal in response to external inputs, determining the final output. For experimental validation, 2D cellular circuits are printed on a paper surface by using a set of cellular inks. As a proof-of-principle, we have printed and analysed both digital and analogue circuits using the same set of cellular inks but with different spatial topologies. The proposed methodology can open the door to a feasible and reliable industrial production of cellular circuits for multiple applications., Synthetic biology circuits are finding application in a wide range of computational devices, such as contaminant detection. Here, the authors design 2D paper circuits in which the spatial orientation of the cellular components specifies function.

On-chip glycan biosynthesis is an effective strategy for preparing useful complex glycan sources and for preparing glycan-involved applications simultaneously. However, current methods have some limitations when analyzing biosynthesized glycans and optimizing enzymatic reactions, which could result in undefined glycan structures on a surface, leading to unequal and unreliable results. In this work, a glycan chip is developed by introducing a pH-responsive i-motif DNA linker to control the immobilization and isolation of glycans on chip surfaces in a pH-dependent manner. On-chip enzymatic glycosylations are optimized for uniform biosynthesis of cancer-associated Globo H hexasaccharide and its related complex glycans through stepwise quantitative analyses of isolated products from the surface. Successful interaction analyses of the anti-Globo H antibody and MCF-7 breast cancer cells with on-chip biosynthesized Globo H-related glycans demonstrate the feasibility of the structure-switchable DNA linker-based glycan chip platform for on-chip complex glycan biosynthesis and glycan-involved applications., Current methods for on-chip glycan biosynthesis suffer from analysing products, often resulting in poor purity and yield. Here the authors report a glycan chip developed by introducing a pH-responsive i-motif DNA linker to control the immobilization and isolation of glycans on chips.

Surface plasmon resonance-based biosensors have been extensively applied to the characterization of the binding kinetics between purified (bio)molecules, thanks to robust data analysis techniques. However, data analysis for solutions containing multiple interactants is still at its infancy. We here present two algorithms for (1) the reliable and accurate determination of the kinetic parameters of N interactants present at different ratios in N mixtures and (2) the estimation of the ratios of each interactant in a given mixture, assuming that their kinetic parameters are known. Both algorithms assume that the interactants compete to bind to an immobilized ligand in a 1:1 fashion and necessitate prior knowledge of the total concentration of all interactants combined. The effectiveness of these two algorithms was experimentally validated with a model system corresponding to mixtures of four small molecular weight drugs binding to an immobilized protein. This approach enables the in-depth characterization of mixtures using SPR, which may be of considerable interest for many drug discovery or development applications, notably for protein glycovariant analysis.

Urine analysis via a toilet-based device can enable continuous health monitoring, a transformation away from hospital-based care towards more proactive medicine. To enable reliable sample collection for a toilet-attached analyzer, here a novel sample collector is proposed. The applicability of the proposed sample collector is validated for long-term use. Geometric parameters of the 3D-printed sample collector are optimized. The collected and leftover volumes are quantified for a range of urination speeds and design parameters. For long-term cyclic use, the protein concentrations of samples are quantified and the effectiveness of washing the sample collector is assessed., NA

Reporter gene assays are widely used to study cellular signaling and transcriptional activity. Few studies describe the use of reporter genes for studying cellular responses on complex body fluids, such as urine and blood. Selection of the optimal reporter gene is crucial for study outcome. Here, we compared the characteristics of five reporter genes (Firefly luciferase, stable- and unstable Nano luciferase, secretable Gaussia luciferase and Red Fluorescent Protein) to study complex body fluids. For this comparison, the NFκB Response Element (NFκB-RE) and Smad Binding Element (SBE) were identically cloned into the five different reporter vectors. Reporter characteristics were evaluated by kinetic and concentration–response measurements in SW1353 and HeLa cell lines. Finally, reporter compatibility with complex body fluids (fetal calf serum, knee joint synovial fluid and human serum) and inter-donor variation were evaluated. Red Fluorescent Protein demonstrated poor inducibility as a reporter gene and slow kinetics compared to luciferases. Intracellularly measured luciferases, such as Firefly luciferase and Nano luciferase, revealed good compatibility with complex body fluids. Secreted Gaussia luciferase appeared to be incompatible with complex body fluids, due to variability in inter-donor signal interference. Unstable Nano luciferase demonstrated clear inducibility, high sensitivity and compatibility with complex body fluids and therefore can be recommended for cellular signaling studies using complex body fluids.

To explore the effects of urea dissociation on reducing false-positive results of the Elecsys HIV combi PT assay. A retrospective analysis was used to evaluate the false-positive rate of the Elecsys HIV combi PT assay. Six false-positive sera, six positive sera and six sera from patients with early HIV infection were collected. Dissociation was performed using 1 mol/L, 2 mol/L, 4 mol/L, 6 mol/L, or 8 mol/L urea, and HIV screening assay were then detected to select the appropriate concentration of urea dissociation. Next, 55 false-positive sera and 15 sera from early HIV infection were used to verify the best concentration of urea to achieve dissociation. Retrospective analysis showed that the COI of the Elecsys HIV combi PT assay in false-positive sera ranged from 1.0 to 200.0, and approximately 97.01%(227/234) of false-positive sera were in the range of 1.0–15.0. The avidity index (AI) in positive and false-positive sera decreased as the urea dissociation concentration increased. When the dissociation concentration was 6 mol/L, the AI of false-positive serum was between 0.0234 and 0.2567, and the AI of early HIV infection sera was between 0.4325 and 0.5017. The difference in AI between false-positive and positive samples was significant. When negativity was defined as an AI of less than 0.3970, the sensitivity and specificity were 100.0% and 100.0%, respectively. Urea-mediated dissociation could significantly reduce the false-positive rate of the Elecsys HIV combi PT assay with a low COI. Our findings provided a reference for distinguishing positive and false-positive of the Elecsys HIV combi PT assay.

Saliva has been widely recognized as a non-invasive, painless and easy-to-collect bodily fluid, which contains biomarkers that can be used for diagnosis of both oral and systemic diseases. Under ambient conditions, salivary biomarkers are subject to degradation. Therefore, in order to minimize degradation during transport and storage, saliva specimens need to be stabilized. The aim of this study was to investigate the feasibility of preserving saliva samples by drying to provide a shelf-stable source of DNA. Human saliva was dried on filters under ambient conditions using sucrose as lyoprotective agent. Samples were stored under different conditions, i.e. varying relative humidity (RH) and temperature. In addition to assessment of different cell types in saliva and their DNA contents, Fourier transform infrared spectroscopy (FTIR) was used to evaluate the effects of storage on biomolecular structure characteristics of saliva. FTIR analysis showed that saliva dried without a lyoprotectant exhibits a higher content of extended β-sheet protein secondary structures compared to samples that were dried with sucrose. In order to evaluate differences in characteristic bands arising from the DNA backbone among differently stored samples, principal component analysis (PCA) was performed, allowing a clear discrimination between groups with/without sucrose as well as storage durations and conditions. Our results indicated that saliva dried on filters in the presence of sucrose exhibits higher biomolecular stability during storage.

Rapid, inexpensive, robust diagnostics are essential to control the spread of infectious diseases. Current state of the art diagnostics are highly sensitive and specific, but slow, and require expensive equipment. Here we report the development of a molecular diagnostic test for SARS-CoV-2 based on an enhanced recombinase polymerase amplification (eRPA) reaction. eRPA has a detection limit on patient samples down to 5 viral copies, requires minimal instrumentation, and is highly scalable and inexpensive. eRPA does not cross-react with other common coronaviruses, does not require RNA purification, and takes ~45 min from sample collection to results. eRPA represents a first step toward at-home SARS-CoV-2 detection and can be adapted to future viruses within days of genomic sequence availability., Current state-of-the-art diagnostics for infectious diseases are sensitive but require extensive equipment. Here the authors develop an enhanced recombinase polymerase amplification reaction for SARS-CoV-2 that allows for inexpensive and rapid testing with minimal equipment.

Aminoacyl-tRNA synthetase-interacting multifunctional protein 2 (AIMP2) is a non-enzymatic component required for the multi-tRNA synthetase complex. While exon 2 skipping alternatively spliced variant of AIMP2 (AIMP2-DX2) compromises AIMP2 activity and is associated with carcinogenesis, its clinical potential awaits further validation. Here, we found that AIMP2-DX2/AIMP2 expression ratio is strongly correlated with major cancer signaling pathways and poor prognosis, particularly in acute myeloid leukemia (AML). Analysis of a clinical patient cohort revealed that AIMP2-DX2 positive AML patients show decreased overall survival and progression-free survival. We also developed targeted RNA-sequencing and single-molecule RNA-FISH tools to quantitatively analyze AIMP2-DX2/AIMP2 ratios at the single-cell level. By subclassifying hematologic cancer cells based on their AIMP2-DX2/AIMP2 ratios, we found that downregulating AIMP2-DX2 sensitizes cells to anticancer drugs only for a subgroup of cells while it has adverse effects on others. Collectively, our study establishes AIMP2-DX2 as a potential biomarker and a therapeutic target for hematologic cancer., Ku, Kim et al develop a method to analyse the ratio of the alternatively spliced variant of AIMP2 to full length AIMP via single-molecule RNA-FISH. They can subclassify hematologic cancer based on AIMP2-DX2/AIMP2 ratio and find that cells with high AIMP2-DX2 ratio can be sensitized to chemotherapy drugs by depleting AIMP2-DX2.

It is important to determine the activation status of Rac and Cdc42 in cancer tissues for the prediction of metastasis and patient prognosis. However, it has been impossible to detect their spatial activation on formalin-fixed paraffin embedded (FFPE) surgical specimens thus far. Here, we established a novel detection technique for activated Rac/Cdc42 in human colon cancer FFPE tissues by using a p21-activated kinase (PAK)-Rac binding domain (RBD) detection probe fused with glutathione S-transferase (GST), designated GST-PAK-RBD, and novel rapid-immunohistochemistry (R-IHC) systems using noncontact alterating-current electric field mixing, although there is a technical limitation in that it may not distinguish between Rac members and Cdc42. In 50 cases of colon cancer, various activation patterns of Rac/Cdc42 were observed, which were designated plasma membrane, cytoplasm, mixed pattern, and polarized distribution. The activity was striking in the invasive fronts of tumors and significantly correlated with tumor invasion properties evaluated by TNM classification. Of note, in tissue microarray (TMA) samples, 29 of 33 cases demonstrated higher Rac1/Cdc42 activity in the tumor area than the corresponding normal mucosa. In addition, positive correlations were detected between Rac/Cdc42 activity and clinicopathological factors such as venous and lymphatic vessel invasion. These results suggest that understanding Rac and Cdc42 activations in cancer tissues would be valuable as an option for molecular therapy as personalized medicine.

Defective biosynthesis or function of proteoglycans causes pathological conditions in a variety of tissue systems. Osteoarthritis (OA) is a prevalent degenerative joint disorder characterized by progressive cartilage destruction caused by imbalanced proteoglycan synthesis and degradation. Identifying agents that regulate proteoglycan metabolism may benefit the development of OA-modifying therapeutics. High-throughput screening (HTS) of chemical libraries has paved the way for achieving this goal. However, the implementation and adaptation of HTS assays based on proteoglycan measurement remain underexploited. Using primary porcine chondrocytes as a model, we report a miniaturized dimethyl-methylene blue (DMMB) assay, which is commonly used to quantitatively evaluate sulfated glycosaminoglycan (GAG) content, with an optimized detection range and reproducibility and its integration with HTS. Treatment with TGF-β1 and IL1-α, known as positive and negative proteoglycan regulators, respectively, supported the assay specificity. A pre-test of chemical screening of 960 compounds identified both stimulators (4.48%) and inhibitors (6.04%) of GAG production. Fluorophore-assisted carbohydrate electrophoresis validated the activity of selected hits on chondroitin sulfate expression in an alginate culture system. Our findings support the implementation of this simple colorimetric assay in HTS to discover modifiers of OA or other diseases related to dysregulated proteoglycan metabolism.

Current methods used for diagnosis of acute infection of pathogens rely on detection of nucleic acids, antigens, or certain classes of antibodies such as IgM. Here we report a virus enzyme assay as an alternative to these methods for detection of acute viral infection. In this method, we used a luciferin derivative as the substrate for detection of the enzyme activity of influenza viral neuraminidase as a means for diagnosis of influenza. The resulting commercial test, the qFLU Dx Test, uses a different supply chain that does not compete with those for the current tests. The assay reagents were formulated as a master mix that accommodated both the neuraminidase and luciferase reactions, thereby enabling rapid and prolonged production of stable light signal in the presence of influenza virus in the sample. The assay was evaluated using depository throat swab specimens. As expected, the assay exhibited similar detection rates for all influenza types and subtypes except for A(H7N9), which exhibited lower detection rate due to lower viral titer in the specimens. When throat swab specimens were diluted with the sample buffer of the test kit and tested with the qFLU Dx Test. The sensitivity and specificity were 82.41% (95% confidence interval: 79.66–85.84%) and 95.39% (95% confidence interval: 94.32–96.46%), respectively, for these diluted specimens in comparison to a real-time polymerase chain reaction assay. The uniqueness of the qFLU Dx Test as an enzymatic assay makes it highly complementary with currently available methods.

This manuscript describes a new method for forming basal-in MCF10A organoids using commercial 384-well ultra-low attachment (ULA) microplates and the development of associated live-cell imaging and automated analysis protocols. The use of a commercial 384-well ULA platform makes this method more broadly accessible than previously reported hanging drop systems and enables in-incubator automated imaging. Therefore, time points can be captured on a more frequent basis to improve tracking of early organoid formation and growth. However, one major challenge of live-cell imaging in multi-well plates is the rapid accumulation of large numbers of images. In this paper, an automated MATLAB script to handle the increased image load is developed. This analysis protocol utilizes morphological image processing to identify cellular structures within each image and quantify their circularity and size. Using this script, time-lapse images of aggregating and non-aggregating culture conditions are analyzed to profile early changes in size and circularity. Moreover, this high-throughput platform is applied to widely screen concentration combinations of Matrigel and epidermal growth factor (EGF) or heparin-binding EGF-like growth factor (HB-EGF) for their impact on organoid formation. These results can serve as a practical resource, guiding future research with basal-in MCF10A organoids.

Multiplexed mRNA profiling in the spatial context provides new information enabling basic research and clinical applications. Unfortunately, existing spatial transcriptomics methods are limited due to either low multiplexing or complexity. Here, we introduce a spatialomics technology, termed Multi Omic Single-scan Assay with Integrated Combinatorial Analysis (MOSAICA), that integrates in situ labeling of mRNA and protein markers in cells or tissues with combinatorial fluorescence spectral and lifetime encoded probes, spectral and time-resolved fluorescence imaging, and machine learning-based decoding. We demonstrate MOSAICA’s multiplexing scalability in detecting 10-plex targets in fixed colorectal cancer cells using combinatorial labeling of five fluorophores with facile error-detection and removal of autofluorescence. MOSAICA’s analysis is strongly correlated with sequencing data (Pearson’s r = 0.96) and was further benchmarked using RNAscopeTM and LGC StellarisTM. We further apply MOSAICA for multiplexed analysis of clinical melanoma Formalin-Fixed Paraffin-Embedded (FFPE) tissues. We finally demonstrate simultaneous co-detection of protein and mRNA in cancer cells., Spatial-omics methods with ease-of-use and high multiplexing are in demand. Here the authors report Multi Omic Single-scan Assay with Integrated Combinatorial Analysis (MOSAICA) which uses Spectral and Fluorescence Lifetime Imaging and Microscopy; they apply this to co-detection of mRNA and protein.

Fast screening of enzyme variants is crucial for tailoring biocatalysts for the asymmetric synthesis of non-natural chiral chemicals, such as amines. However, most existing screening methods either are limited by the throughput or require specialized equipment. Herein, we report a simple, high-throughput, low-equipment dependent, and generally applicable growth selection system for engineering amine-forming or converting enzymes and apply it to improve biocatalysts belonging to three different enzyme classes. This results in (i) an amine transaminase variant with 110-fold increased specific activity for the asymmetric synthesis of the chiral amine intermediate of Linagliptin; (ii) a 270-fold improved monoamine oxidase to prepare the chiral amine intermediate of Cinacalcet by deracemization; and (iii) an ammonia lyase variant with a 26-fold increased activity in the asymmetric synthesis of a non-natural amino acid. Our growth selection system is adaptable to different enzyme classes, varying levels of enzyme activities, and thus a flexible tool for various stages of an engineering campaign.

Central management of electronic medical systems faces a major challenge because it requires trust in a single entity that cannot effectively protect files from unauthorized access or attacks. This challenge makes it difficult to provide some services in central electronic medical systems, such as file search and verification, although they are needed. This gap motivated us to develop a system based on blockchain that has several characteristics: decentralization, security, anonymity, immutability, and tamper-proof. The proposed system provides several services: storage, verification, and search. The system consists of a smart contract that connects to a decentralized user application through which users can transact with the system. In addition, the system uses an interplanetary file system (IPFS) and cloud computing to store patients’ data and files. Experimental results and system security analysis show that the system performs search and verification tasks securely and quickly through the network.

The CRISPR-Cas12a RNA-guided complexes have tremendous potential for nucleic acid detection but are limited to the picomolar detection limit without an amplification step. Here, we develop a platform with engineered crRNAs and optimized conditions that enabled us to detect various clinically relevant nucleic acid targets with higher sensitivity, achieving a limit of detection in the femtomolar range without any target pre-amplification step. By extending the 3′- or 5′-ends of the crRNA with different lengths of ssDNA, ssRNA, and phosphorothioate ssDNA, we discover a self-catalytic behavior and an augmented rate of LbCas12a-mediated collateral cleavage activity as high as 3.5-fold compared to the wild-type crRNA and with significant improvement in specificity for target recognition. Particularly, the 7-mer DNA extension to crRNA is determined to be universal and spacer-independent for enhancing the sensitivity and specificity of LbCas12a-mediated nucleic acid detection. We perform a detailed characterization of our engineered ENHANCE system with various crRNA modifications, target types, reporters, and divalent cations. With isothermal amplification of SARS-CoV-2 RNA using RT-LAMP, the modified crRNAs are incorporated in a paper-based lateral flow assay that can detect the target with up to 23-fold higher sensitivity within 40–60 min., CRISPR-Cas12a based detection systems can be sensitive down to the picomolar range. Here the authors modify the 3′- and 5′-ends of the crRNA and show this enhances trans-cleavage for improved sensitivity.

Avian influenza viruses (AIV) are negative sense RNA viruses posing a major threat to the poultry industry worldwide, with the potential to spread to mammals, including humans; hence, an accurate and rapid AIV diagnosis is essential. To date AIV detection relies on molecular methods, mainly RT-qPCR directed against AIV M gene segment. The evolution of AIV represents a relevant issue in diagnostic RT-qPCR due to possible mispriming and/or probe-binding failures resulting in false negative results. Consequently, RT-qPCR for AIV detection should be periodically re-assessed both in silico and in vitro. To this end, a specific workflow was developed to evaluate in silico the complementarity of primers and probes of four published RT-qPCR protocols to their target regions. The four assays and one commercially available kit for AIV detection were evaluated both for their analytical sensitivity using eight different viral dilution panels and for their diagnostic performances against clinical specimens of known infectious status. Differences were observed among the tests under evaluation, both in terms of analytical sensitivity and of diagnostic performances. This finding confirms the importance of continuously monitoring the primers and probes complementarity to their binding regions.

An excellent pre-column fluorescent derivatization reagent N-acetylhydrazine acridone for the quantitative determination of malondialdehyde was synthesized. Malondialdehyde was derivatized at 80 °C for 30 min in the presence of trichloroacetic acid. The separation of the derivative was performed on an Agilent ZORBAX SB-C18 column in conjunction with gradient elution. The excitation and emission wavelengths were 370 nm and 420 nm, respectively. The developed method demonstrated good linear relationship in the range of 0.02 pmol to 2.5 pmol (r = 0.9998). The calculated limit of detection and limit of quantification were 2.5 fmol and 8.3 fmol, respectively. The analytical precisions of the method were in the range of 1.36–2.27% (intra-day) and 2.36–3.92% (inter-day) respectively. The method was sensitive, specific and simple. It was successfully implemented to analysis the malondialdehyde in rat prostate.

An important sustainable development goal for any country is to ensure food security by producing a sufficient and safe food supply. This is the case for bovine milk where addition of non-dairy milks such as vegetables (e.g., soya or coconut) has become a common source of adulteration and fraud. Conventionally, gas chromatography techniques are used to detect key lipids (e.g., triacylglycerols) has an effective read-out of assessing milks origins and to detect foreign milks in bovine milks. However, such approach requires several sample preparation steps and a dedicated laboratory environment, precluding a high throughput process. To cope with this need, here, we aimed to develop a novel and simple method without organic solvent extractions for the detection of bovine and non-dairy milks based on lipids fingerprint by routine MALDI-TOF mass spectrometry (MS). The optimized method relies on the simple dilution of milks in water followed by MALDI-TOF MS analyses in the positive linear ion mode and using a matrix consisting of a 9:1 mixture of 2,5-dihydroxybenzoic acid and 2-hydroxy-5-methoxybenzoic acid (super-DHB) solubilized at 10 mg/mL in 70% ethanol. This sensitive, inexpensive, and rapid method has potential for use in food authenticity applications.

Systemic anaplastic large cell lymphoma (ALCL) is an aggressive T-cell lymphoma most commonly seen in children and young adults. The majority of pediatric ALCLs are associated with the t(2;5)(p23;q35) translocation which fuses the Anaplastic Lymphoma Kinase (ALK) gene with the Nucleophosmin (NPM) gene. The NPM-ALK fusion protein is a constitutively-active tyrosine kinase, and plays a major role in tumor pathogenesis. In an effort to advance novel diagnostic approaches and the understanding of the function of this fusion protein in cancer cells, we expressed in E. coli, purified and characterized human NPM-ALK fusion protein to be used as a standard for estimating expression levels in cultured human ALCL cells, a key tool in ALCL pathobiology research. We estimated that NPM-ALK fusion protein is expressed at substantial levels in both Karpas 299 and SU-DHL-1 cells (ca. 4–6 million molecules or 0.5–0.7 pg protein per cell; based on our in-house developed NPM-ALK ELISA; LOD of 40 pM) as compared to the ubiquitous β-actin protein (ca. 64 million molecules or 4.5 pg per lymphocyte). We also compared NPM-ALK/ β-actin ratios determined by ELISA to those independently determined by two-dimensional electrophoresis and showed that the two methods are in good agreement.

Extracellular vesicles (EVs) form an endogenous transport system for intercellular transfer of biological cargo, including RNA, that plays a pivotal role in physiological and pathological processes. Unfortunately, whereas biological effects of EV-mediated RNA transfer are abundantly studied, regulatory pathways and mechanisms remain poorly defined due to a lack of suitable readout systems. Here, we describe a highly-sensitive CRISPR-Cas9-based reporter system that allows direct functional study of EV-mediated transfer of small non-coding RNA molecules at single-cell resolution. Using this CRISPR operated stoplight system for functional intercellular RNA exchange (CROSS-FIRE) we uncover various genes involved in EV subtype biogenesis that play a regulatory role in RNA transfer. Moreover we identify multiple genes involved in endocytosis and intracellular membrane trafficking that strongly regulate EV-mediated functional RNA delivery. Altogether, this approach allows the elucidation of regulatory mechanisms in EV-mediated RNA transfer at the level of EV biogenesis, endocytosis, intracellular trafficking, and RNA delivery., Extracellular vesicles (EV) facilitate intercellular transfer of biological material including RNA, but the regulatory mechanisms for their formation and transfer are incompletely known. Here the authors develop a CRISPR-based reporting system to detect the transfer of guide RNAs and identify genes not previously linked to EV-mediated RNA delivery.

An ultrasensitive indirect competitive enzyme-linked immunosorbent assay (ic ELISA) using monoclonal antibodies (mAbs) was developed for the specific detection of diethylstilbestrol (DES) residues. To establish an ELISA based on mAbs, hapten diethylstilbestrol mono-carboxypropyl-ether (DES-MCPE) was chemically synthetized and then conjugated to bovine serum albumin (BSA) for immunization in mice. This ic ELISA was further optimized for DES determination. The sensitivity of the ic ELISA was found to be 0.49 μg/kg and the limit of detection was 0.075 μg/kg. DES residues in salmon meat and pork were tested with the recovery range from 74.0 to 85.2% and the coefficient of variation (CV) was less than 10%. Parallel analysis of DES samples from salmon meat showed comparable results from the ic ELISA with high-performance liquid chromatography. The ic ELISA provides a useful screening method for the quantitative detection of DES residues in animal-derived food.

We demonstrate that holographic particle characterization can directly detect binding of proteins to functionalized colloidal probe particles by monitoring the associated change in the particles’ size. This label-free molecular binding assay uses in-line holographic video microscopy to measure the diameter and refractive index of individual probe spheres as they flow down a microfluidic channel. Pooling measurements on 104 particles yields the population-average diameter with an uncertainty smaller than 0.5 nm, which is sufficient to detect sub-monolayer coverage by bound proteins. We demonstrate this method by monitoring binding of NeutrAvidin to biotinylated spheres and binding of immunoglobulin G to spheres functionalized with protein A.

Compared with traditional monolayer cell culture, the three-dimensional tumor spheroid has emerged as an essential in vitro model for cancer research due to the recapitulation of the architecture and physiology of solid human tumors. Herein, by implementing the rapid prototyping of a benchtop 3D printer, we developed a new strategy to generate and analyze tumor spheroids on a commonly used multi-well plate. In this method, the printed artifact can be directly mounted on a 96/384-well plate, enables hanging drop-based spheroid formation, avoiding the tedious fabrication process from micromechanical systems. Besides long-term spheroid culture (20 days), this method supports subsequent analysis of tumor spheroid by seamlessly dripping from the printed array, thereby eliminating the need for spheroids retrieval for downstream characterization. We demonstrated several tumor spheroid-based assays, including tumoroid drug testing, metastasis on or inside extracellular matrix gel, and tumor transendothelial (TEM) assay. Based on quantitative phenotypical and molecular analysis without any precarious retrieval and transfer, we found that the malignant breast cancer (MDA-MB-231) cell aggregate presents a more metastatic morphological phenotype than the non-malignant breast cancer (MCF-7) and colonial cancer (HCT-116) cell spheroid, and shows an up-regulation of epithelial-mesenchymal transition (EMT) relevant genes (fold change > 2). Finally, we validated this tumor malignancy by the TEM assay, which could be easily performed using our approach. This methodology could provide a useful workflow for expediting tumoroid modeled in vitro assay, allowing the “Lab-on-a-Cloud” scenario for routine study.

Clavibacter michiganensis subsp. sepedonicus (CMS) is an important bacterial plant pathogen causing potato ring rot disease. Rapid diagnosis of CMS is crucial because of the economic losses caused by serious harvest losses. Although there are serological tests used in the rapid diagnosis of CMS, they are not widely used because of their low sensitivity. The DNA-based PCR methods, which are highly sensitive, do not have the possibility of on-site diagnosis, especially since they require serious laboratory infrastructure. In recent years, scientists have been working on alternative amplification methods to develop DNA-based point of care (POC) diagnostic methods. Accordingly, the loop-mediated isothermal amplification (LAMP) method, which was developed in the early 2000s, provides an important convenience for DNA-based tests to use in the field. Due to the unique design of primers, more amplification products could be create in a shorter time than conventional amplification methods without needing a temperature cycle, and it can be applied with the aid of a simple heater without requiring a laboratory environment. In this study, efficient LAMP method for the detection of CMS has optimized. For device-independent detection of LAMP products, colorimetric method and LFD has used.

Throughout the last decade, the expansion of food testing has been gradually moving towards ordinary high throughput screening methods performed on-site. The demand for point-of-care testing, able to distinguish molecular signatures with high accuracy, sensitivity and specificity has been significantly increasing. This new requirement relies on the on-site detection and monitorization of molecular signatures suitable for the surveillance of food production and processing. The widespread use of antibiotics has contributed to disease control of livestock but has also created problems for the dairy industry and consumers. Its therapeutic and subtherapeutic use has increased the risk of contamination in milk in enough concentrations to cause economic losses to the dairy industry and have a health impact in highly sensitive individuals. This study focuses on the development of a simple Surface-Enhanced Raman Spectroscopy (SERS) method for fast high throughput screening of tetracycline (TET) in milk. For this, we integrate a paper-based low-cost, fully recyclable and highly stable SERS platform, with a minimal sample preparation protocol. A two-microliter sample of milk solutions spiked with TET (from 0.01 to 1000 ppm) is dried on a silver nanoparticle coated cardboard substrate and measured via a Raman spectrophotometer. The SERS substrate showed to be extremely stable with a shelf life of several months. A global spectrum principal component analysis approach was used to test all the detected vibrational modes and their correlation with TET concentration. Peak intensity ratios (455 cm−1/1280 cm−1 and 874 cm−1/1397 cm−1) were found to be correlated with TET concentrations in milk, achieving a sensitivity as low as 0.1 ppm. Results indicate that this SERS method combined with portable Raman spectrometer is a potential tool that can be used on-site for the monitoring of TET residues and other antibiotics.

Histamine produced by bacteria through decarboxylation of histidine in spoiled foods such as fish is known to cause food poisoning. Therefore, accurate and facile measurement of histamine is of practical importance. Using the recently discovered RNA aptamer that specifically recognizes histamine (A1-949 aptamer), we developed an aptasensor based on the structure-switching mechanism. Specifically, the aptamer A1-949 was fluorescently labeled at the 5′ end and hybridized with a short quencher DNA strand that is partially complementary to the aptamer. The quencher strand was modified with a fluorescence quencher at its 3′ terminus. Displacement of the quencher strand upon histamine binding results in an increased fluorescence. After optimizing the assay condition, the enantiomeric version of the aptasensor (L-RNA and L-DNA) was synthesized which could detect the achiral analyte with identical sensitivity and improved biochemical stability. The aptasensor performance was validated by measuring fish samples spiked with known concentrations of histamine. Finally, histamine content in spoiled fish samples was measured, and the results were compared with the measurements using a commercial enzymatic assay kit.

The aim of the present study was to compare the efficiency of vitrification and slow freezing techniques for the cryopreservation of zebrafish ovarian tissue containing immature follicles. In Experiment 1, assessment of cell membrane integrity by trypan blue exclusion staining was used to select the best cryoprotectant solution for each cryopreservation method. Primary growth (PG) oocytes showed the best percentage of membrane integrity (63.5 ± 2.99%) when SF4 solution (2 M methanol + 0.1 M trehalose + 10% egg yolk solution) was employed. The vitrification solution, which presented the highest membrane integrity (V2; 1.5 M methanol + 5.5 M Me2SO + 0.5 M sucrose + 10% egg yolk solution) was selected for Experiment 2. Experiment 2 aimed to compare the vitrification and slow freezing techniques in the following parameters: morphology, oxidative stress, mitochondrial activity, and DNA damage. Frozen ovarian tissue showed higher ROS levels and lower mitochondrial activity than vitrified ovarian tissue. Ultrastructural observations of frozen PG oocytes showed rupture of the plasma membrane, loss of intracellular contents and a large number of damaged mitochondria, while vitrified PG oocytes had intact mitochondria and cell plasma membranes. We conclude that vitrification may be more effective than slow freezing for the cryopreservation of zebrafish ovarian tissue.

Immunoassays are widely used for detection and quantification of analytes in biological samples, but are vulnerable to analytical errors caused by interfering sample substances. Of particular interest are endogenous anti-animal antibodies that may bind to the immunoassay antibodies and cause erroneous test results. This phenomenon is a hazard to patient safety in both human and veterinary medicine. Here, we demonstrate that anti-mouse antibodies in dogs bind selectively to different regions of the murine IgG molecule, cross-react with IgG from different species, and consist of all major antibody classes present in canine serum (IgA, IgG and IgM). The antibody characteristics varied among individuals and their prevalence differed between two dog breeds. The selective binding to different IgG regions suggests that the antibodies might not originate from immunization through exposure to mice or other species. These findings show that canine anti-mouse antibodies are highly heterogeneous in nature and therefore require a combination of strategies to be counteracted.

Heterogeneous immunoassays such as ELISA have become indispensable in modern bioanalysis, yet translation into point-of-care assays is hindered by their dependence on external calibration and multiple washing and incubation steps. Here, we introduce RAPPID (Ratiometric Plug-and-Play Immunodiagnostics), a mix-and-measure homogeneous immunoassay platform that combines highly specific antibody-based detection with a ratiometric bioluminescent readout. The concept entails analyte-induced complementation of split NanoLuc luciferase fragments, photoconjugated to an antibody sandwich pair via protein G adapters. Introduction of a calibrator luciferase provides a robust ratiometric signal that allows direct in-sample calibration and quantitative measurements in complex media such as blood plasma. We developed RAPPID sensors that allow low-picomolar detection of several protein biomarkers, anti-drug antibodies, therapeutic antibodies, and both SARS-CoV-2 spike protein and anti-SARS-CoV-2 antibodies. With its easy-to-implement standardized workflow, RAPPID provides an attractive, fast, and low-cost alternative to traditional immunoassays, in an academic setting, in clinical laboratories, and for point-of-care applications., Many current immunoassays require multiple washing, incubation and optimization steps. Here the authors present Ratiometric Plug-and-Play Immunodiagnostics (RAPPID), a generic assay platform that uses ratiometric bioluminescent detection to allow sandwich immunoassays to be performed directly in solution.

An overreliance on commercial, kit-based RNA extraction in the molecular diagnoses of infectious disease presents a challenge in the event of supply chain disruptions and can potentially hinder testing capacity in times of need. In this study, we adapted a well-established, robust TRIzol-based RNA extraction protocol into a high-throughput format through miniaturization and automation. The workflow was validated by RT-qPCR assay for SARS-CoV-2 detection to illustrate its scalability without interference to downstream diagnostic sensitivity and accuracy. This semi-automated, kit-free approach offers a versatile alternative to prevailing integrated solid-phase RNA extraction proprietary systems, with the added advantage of improved cost-effectiveness for high volume acquisition of quality RNA whether for use in clinical diagnoses or for diverse molecular applications.

[EN]In this work we studied the ability of polystyrene (PS) nanoplastics (NPs) and microplastics (MPs) to transfer benzo(a)pyrene (BaP) to mussel hemocytes and to produce toxic effects in vitro. For this, intracellular fate and toxicity of PS NPs (0.05 μm) and MPs (0.5 and 4.5 μm) alone or with BaP and of BaP alone were assessed. Particles of 0.05 and 0.5 µm largely aggregated in the exposure medium whereas presence of BaP reduced particle aggregation. Cells internalized PS NPs and MPs alone or with BaP and these were found inside and outside lysosomes, depending on their size. PS particles alone or with BaP were cytotoxic to hemocytes only at the highest concentrations tested. The same was true for most sublethal endpoints except for increased phagocytic activity provoked by NPs and 0.5 μm MPs at lower concentrations. Plastic particles appeared to be the main drivers for reduced plasma membrane integrity and increased phagocytic and lysosomal activities whereas BaP appeared to contribute more to reduced cell viability and phagocytosis and increased ROS production and genotoxicity. Overall, PS NPs and MPs can act as carriers of BaP to mussel hemocytes, rising concerns about risks plastics associated to pollutants may pose to aquatic organisms. This work was carried out within the EU Project PLASTOX (JPI Oceans 005/2015) and was funded by the Spanish MINECO (NACE Project, CTM2016-81130-R) and Basque Government (Consolidated Research Groups Grant IT1302-19).

Bioprinting is increasingly used to create complex tissue constructs for an array of research applications, and there are also increasing efforts to print tissues for transplantation. Bioprinting may also prove valuable in the context of drug screening for personalized medicine for treatment of diseases such as cancer. However, the rapidly expanding bioprinting research field is currently limited by access to bioprinters. To increase the availability of bioprinting technologies we present here an open source extrusion bioprinter based on the E3D motion system and tool changer to enable high-resolution multi-material bioprinting. As proof of concept, the bioprinter is used to create collagen constructs using freeform reversible embedding of suspended hydrogels (FRESH) methodology, as well as multi-material constructs composed of distinct sections of laminin and collagen. Data is presented demonstrating that the bioprinted constructs support growth of cells either seeded onto printed constructs or included in the bioink prior to bioprinting. This open source bioprinter is easily adapted for different bioprinting applications, and additional tools can be incorporated to increase the capabilities of the system.

Fluorescently labeled antibody and aptamer probes are used in biological studies to characterize binding interactions, measure concentrations of analytes, and sort cells. Fluorescent nanoparticle labels offer an excellent alternative to standard fluorescent labeling strategies due to their enhanced brightness, stability and multivalency; however, challenges in functionalization and characterization have impeded their use. This work introduces a straightforward approach for preparation of fluorescent nanoparticle probes using commercially available reagents and common laboratory equipment. Fluorescent polystyrene nanoparticles, Thermo Fisher Scientific FluoSpheres, were used in these proof-of-principle studies. Particle passivation was achieved by covalent attachment of amine-PEG-azide to carboxylated particles, neutralizing the surface charge from − 43 to − 15 mV. A conjugation-annealing handle and DNA aptamer probe were attached to the azide-PEG nanoparticle surface either through reaction of pre-annealed handle and probe or through a stepwise reaction of the nanoparticles with the handle followed by aptamer annealing. Nanoparticles functionalized with DNA aptamers targeting histidine tags and VEGF protein had high affinity (EC50s ranging from 3 to 12 nM) and specificity, and were more stable than conventional labels. This protocol for preparation of nanoparticle probes relies solely on commercially available reagents and common equipment, breaking down the barriers to use nanoparticles in biological experiments.

Dried blood samples (DBSs) have many advantages; yet, impediments have limited the clinical utilization of DBSs. We developed a novel volumetric sampling device that collects a precise volume of blood, which overcomes the heterogeneity and hematocrit issues commonly encountered in a traditional DBS card collection as well as allowing for more efficient extraction and processing procedures and thus, more efficient quantitation, by using the entire sample. We also provided a thorough procedure validation using this volumetric DBS collection device with an established quantitative proteomics analysis method, and then analyzed 1000 proteins using this approach in DBSs concomitantly with serum for future consideration of utility in clinical applications. Our data provide a first step in the establishment of a DBS database for the broad application of this sample type for widespread use in clinical proteomic and other analyses applications.

During circulation in humans and natural selection to escape antibody recognition for decades, A/H3N2 influenza viruses emerged with altered receptor specificities. These viruses lost the ability to agglutinate erythrocytes critical for antigenic characterization and give low yields and acquire adaptive mutations when cultured in eggs and cells, contributing to recent vaccine challenges. Examination of receptor specificities of A/H3N2 viruses reveals that recent viruses compensated for decreased binding of the prototypic human receptor by recognizing α2,6-sialosides on extended LacNAc moieties. Erythrocyte glycomics shows an absence of extended glycans providing a rationale for lack of agglutination by recent A/H3N2 viruses. A glycan remodeling approach installing functional receptors on erythrocytes, allows antigenic characterization of recent A/H3N2 viruses confirming the cocirculation of antigenically different viruses in humans. Computational analysis of HAs in complex with sialosides having extended LacNAc moieties reveals that mutations distal to the RBD reoriented the Y159 side chain resulting in an extended receptor binding site., Here, Broszeit et al. show that circulating A/H3N2 viruses have evolved binding specificity to α2,6-sialosides on extended LacNAc moieties and therefore cannot agglutinate erythrocytes. Applying glycan remodeling allows to install functional receptors on erythrocytes and promotes identification of newly circulating variants to facilitate vaccine design.