Search

BACKGROUND Androgens influence the growth of terminal hair. The dermal papilla contains androgen receptors and the enzymes 5-alpha-reductase types 1 and 2. Both of these enzymes convert testosterone to the more active androgen, 5-alpha-dihydrotestosterone. The male distribution pattern of terminal hair in females is termed hirsutism. It is most common among women with hyperandrogenism; however, it may also affect patients with normal androgen levels (idiopathic hirsutism). OBJECTIVES The aim of this study was to assess the expression of 5-alpha-reductase types 1 and 2 mRNA in dermal papillae from the lower abdominal skin in women with hirsutism. METHODS The study included 42 subjects, 24 with a diagnosis of polycystic ovary syndrome (PCOS) and 18 with idiopathic hirsutism (IH). In all patients, free serum testosterone was measured. RESULTS The mean +/- SD concentration of free serum testosterone was 7.2 +/-5.3 pmol/L in the total group of patients, 10.8 +/- 4.0 pmol/L in patients with PCOS, and 2.5 +/- 1.7 pmol/L in patients with IH. Quantitative analysis was then performed for the mRNA of 5-alpha-reductase types 1 and 2, both of which were found within the dermal papillae from the lower abdominal skin region. The number of mRNA copies/microg of total RNA for 5-alpha-reductase type 1 was statistically significantly higher than that for type 2 in both groups of examined patients. We also demonstrated a positive correlation between the number of mRNA copies/microg of total RNA for 5-alpha-reductase types 1 and 2 and the concentration of free serum testosterone in women with PCOS and IH. Considering all patients together, we found a positive correlation between the number of mRNA copies/microg of total RNA for 5-alpha-reductase type 2 and the concentration of free serum testosterone. There was also a tendency towards a positive correlation between the number of mRNA copies/microg of total RNA for 5-alpha-reductase type 1 and the concentration of free serum testosterone. CONCLUSION The results of our study suggest that testosterone increases expression of 5-alpha-reductase types 1 and 2 in dermal papillae from the lower abdominal region in patients with hirsutism.

The rate of tumour growth is dependent on the balance between proliferation and apoptosis at all stages of carcinogenesis. Apoptosis inhibition, in turn, depends partly on the balance between expression of two cell death regulatory genes, Bcl-2 and Bax. Colon cancer has long been associated with disturbances in apoptosis regulation. The aim of our study was to determine the expression levels of Bcl-2 and Bax mRNAs in 1 μg sample of total RNA obtained from normal colon and colon adenocarcinoma. This study was intended to evaluate possible differences in Bcl-2 and Bax mRNA levels at particular stages of colon adenocarcinoma classified according to Duke's system. The apoptotic frequency (represented by Bax mRNA copy number) was inversely proportional to the decrease of Bcl-2 gene expression. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) was performed to confirm apoptosis.

Telomerase is a reverse transcriptase that adds repetitive telomere sequences to the end of chromosomes, which is thought to be essential for cellular immortality and oncogenesis. The enzyme consists of three subunits: human telomerase reverse transcriptase (hTERT), human telomerase RNA (hTR), and telomerase protein 1 (TP1). The hTERT subunit determines the activity of telomerase as an enzyme and is detected in most human tumors and regenerative cells. But many studies have revealed that hTR and TP1 are expressed constitutively. This resuts suggest that the hTR and TP1 subunits may be potentially good markers of endogenous RNA control. Endometrial dating was determined from the pathomorphology of the endometrium and classified into normal proliferative endometrium, endometrial hyperplasia (simple, complex, and atypical), and endometrial adenocarcinoma. The analysis of the expression of the hTERT, TP1, and hTR telomerase subunits was performed by a quantitative polymerase chain reaction method, based on fluorescent TaqMan methodology (ABI Prism 7 700 Sequence Detection System) capable of measuring fluorescence in real time. The aim of the study was an analysis of the expression profiles of genes encoding hTR and TP1 telomerase subunits in normal endometrium, endometrial hyperplasia, and adenocarcinoma forthe estimation of the possibility of once application in endogenous RNA control of gene analysis in the endometrium. The nonparametric Mann–Whitney U test and analysis of variance Friedman test were used to evaluate the variation in telomerase subunit mRNA level between normal endometrium, and endometrial hyperplasia and adenocarcinoma. The results confirm the hTR subunit expression as a good marker of endogenous control in quantitative analysis of gene transcription in endometrial tissue. TP1 subunit transcriptions have not been detected constitutively in our study.

The aim of this study was to investigate the expression of genes coding aromatase and 5-alpha-reductase type 1 and type 2 in endometrial adenocarcinoma, with parallel analysis of testosterone concentrations in serum isolated from blood of basilic and ovarian vein. A significant difference between the copy numbers of mRNA for 5-alpha-reductase type 1 and type 2 was disclosed. The content of the mRNA copies was higher for 5-alpha-reductase type 2 than for type 1. We noted a positive correlation between the mRNA copy number for aromatase and 5-alpha-reductase type 1 as well as between the mRNA copy number for aromatase and 5-alpha-reductase type 2. A positive correlation was disclosed between the mRNA copy number for 5-alpha-reductase type 1 and type 2. We concluded that in tissues of endometrial adenocarcinoma, there is expression of aromatase and 5-alpha-reductase type 1 and 2 genes, and that the expression of aromatase and 5-alpha-reductase genes in tissues of endometrial adenocarcinoma is not controlled by testosterone.

Monocyte chemoattractant protein-1(MCP-1) is secreted by activated macrophages and endothelial cells, and is involved in the pathogenesis of cardiovascular and neurodegenerative disorders. There is need to develop drugs that inhibit excessive infiltration of monocytes and lymphocytes to the arterial wall and central nervous system. The aim of this study was to evaluate the effect of apigenin on the synthesis and release of MCP-1 by J774.2 macrophages in vitro. Apigenin studied at higher doses (10 and 30 microM) diminished MCP-1 release in lipopolysaccharide activated J774.2 macrophages. Apigenin administered at lower doses (3.1 and 0.3 microM) did not change secretion of MCP-1 in LPS-stimulated macrophages. Apigenin treated at a dose of 30 microM strongly reduced the number of MCP-1 mRNA copies in J774.2 cells. These results suggest that apigenin possesses anti-inflammatory properties and that apigenin inhibited MCP-1 production at the transcriptional level.

Flavonoids have been reported to bring benefits in lowering inflammation, oxidative stress and exert positive effects in cancer and cardiovascular and chronic inflammatory diseases. Apigenin, kaempferol and resveratrol present in fruits, vegetables and grain were investigated for their effect on the synthesis of interleukin-1beta (IL-1beta) and tumor necrosis factor-alpha (TNF-alpha) at transcriptional level in lipopolysaccharide (LPS)-stimulated J774.2 macrophages. Apigenin (30 microM), kaempferol (30 microM) and resveratrol (50 microM) significantly decreased the number of TNF-alpha mRNA copies in LPS-activated J774.2 macrophages. Apigenin and kaempferol caused inhibition of IL-1beta gene expression in J774.2 macrophages, but resveratrol was ineffective. These results indicate that apigenin, kaempferol and resveratrol exert inhibitory effects on the TNF-alpha and except for of resveratrol on IL-1beta gene expression in J774.2 macrophages at the transcriptional level. In addition, the studied compounds may be the mediators responsible for protective role of a diet high in fruits and vegetables in the cardiovascular and inflammatory diseases.

P1 is a bacteriophage of Escherichia coli and other enteric bacteria. It lysogenizes its hosts as a circular, low-copy-number plasmid. We have determined the complete nucleotide sequences of two strains of a P1 thermoinducible mutant, P1 c 1-100. The P1 genome (93,601 bp) contains at least 117 genes, of which almost two-thirds had not been sequenced previously and 49 have no homologs in other organisms. Protein-coding genes occupy 92% of the genome and are organized in 45 operons, of which four are decisive for the choice between lysis and lysogeny. Four others ensure plasmid maintenance. The majority of the remaining 37 operons are involved in lytic development. Seventeen operons are transcribed from σ 70 promoters directly controlled by the master phage repressor C1. Late operons are transcribed from promoters recognized by the E. coli RNA polymerase holoenzyme in the presence of the Lpa protein, the product of a C1-controlled P1 gene. Three species of P1-encoded tRNAs provide differential controls of translation, and a P1-encoded DNA methyltransferase with putative bifunctionality influences transcription, replication, and DNA packaging. The genome is particularly rich in Chi recombinogenic sites. The base content and distribution in P1 DNA indicate that replication of P1 from its plasmid origin had more impact on the base compositional asymmetries of the P1 genome than replication from the lytic origin of replication.

Monocyte chemoattractant protein-1 (MCP-1) is produced by activated macrophages, and is involved in pathogenesis of cardiovascular and neurodegenerative disorders. There is a need to develop drugs that inhibit excessive infiltration of monocytes and lymphocytes to the arterial wall and central nervous system. The aim of this study was to evaluate the effect of kaempferol on the (MCP-1) gene expression and MCP-1 protein release by J774.2 macrophage cultures in vitro. Kaempferol given both before and after lipopolysaccharide (LPS) administration reduced secretion of MCP-1. Kaempferol administered before LPS stimulation significantly decreased the number of copies of MCP-1 mRNA. The results suggest that kaempferol inhibits MCP-1 production at the transcriptional level, and that this is an additional anti-inflammatory mechanism of action of this flavonoid.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Efficacy and safety of various treatments using fractional laser or radiofrequency depend, to a large extent, on precise movement of equipment head across the patient’s skin. In addition, they both depend on uniform distribution of emitted pulses throughout the treated skin area. The pulses should be closely adjacent but they should not overlap. Pulse overlapping results in amplification of irradiation dose and carries the danger of unwanted effects. Images obtained in infrared mode (Flir SC5200 thermovision camera equipped with photon detector) were entered into Matlab environment. Thermal changes in the skin were forced by CO2RE laser. Proposed image analysis and processing methods enable automatic recognition of CO2RE laser sites of action, making possible to assess the correctness of performed cosmetic procedures. 80 images were acquired and analyzed. Regions of interest (ROI) for the entire treatment field were determined automatically. In accordance with the proposed algorithm, laser-irradiated L i areas (ROI) were determined for the treatment area. On this basis, error values were calculated and expressed as percentage of area not covered by any irradiation dose (δ o ) and as percentage area which received double dose (δ z ). The respective values for the analyzed images were δ o =17.87±10.5% and δ z =1.97±1.5%, respectively. The presented method of verifying the correctness of performing low-invasive esthetic medical (cosmetic) procedures has proved itself numerous times in practice. Advantages of the method include: automatic determination of coverage error values δ o and δz, non-invasive, sterile and remote-controlled thermovisual mode of measurements, and possibility of assessing dynamics of patient’s skin temperature changes.