Search

Copyright of Archives of Veterinary Science is the property of Archives of Veterinary Science and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Acta Veterinaria Brasilica is the property of Acta Veterinaria Brasilica and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Background: Urinary tract infection in dogs is usually associated with the presence of bacteria, with a higher prevalence of Gram-negative bacteria, represented mainly by enteric bacteria such as Escherichia coli and Proteus spp., followed by Gram-positive bacteria such as Staphylococcus spp., and Streptococcus spp. There are scant reports of Salmonella spp. as the causative agent of urinary tract infection in dogs. Indeed, the literature describes only a few cases, most of which involve the isolation of these bacteria in feces. This paper reports a case of canine cystitis caused by Salmonella enterica subsp. enterica in the northeast region of Brazil. Case: A female dog of the Fila Brasileiro breed, about 9 year-old, wormed but unvaccinated, was evaluated at the Veterinary Hospital of the Federal University of Pernambuco - UFRPE. The dog showed clinical signs of apathy, cachexia, polyphagia, polyuria and opacity of the crystalline lens. The dog's owner stated that the animal was fed with commercial dog food. In the clinical exam, the patient presented pale mucosa, cachexia, absence of ectoparasites, and her rectal temperature was 39.5°C. Moreover, cardiorespiratory auscultation of the patient revealed tachycardia (190 bpm) and tachypnea (36 bpm). The owner's main complaint was the clinical condition of frequent urination (polyuria). A urinalysis and urine culture with antibiogram were requested as complementary exams, after collecting the urine by cystocentesis. The volume obtained in the physical examination of urinalysis was 7 mL of yellow urine with a putrid smell, cloudy appearance and density of 1.024. The chemical examination revealed pH 6.5, protein (+++), bilirubin (+), normal urobilinogen and negative reactions for glycoses, ketone, nitrite and urine occult blood. Bacteriuria and pyuria were detected in a urine sediment test. Urine was cultured on blood agar and Levine agar in a bacteriological incubator at 37°C under aerobiosis, for 24 h. This culture produced an exuberant and pure growth of glossy grey bacterial colonies on blood agar and glossy colonies on Levine agar. The Gram test revealed gram-negative bacilli. The sample was subjected to biochemical tests to identify Gram-negative enterobacteria, whose results provided a presumptive identification of Salmonella species. The microbial species was identified using a VITEK 2 Compact®, and was followed by a serology test for the identification of the serogroup using a polyvalent serum, which enabled the identification of Salmonella enterica subsp. enterica. The antibiogram showed sensitivity to ciprofloxacin, gentamicin and penicillin, and resistance to amoxicillin and ampicillin. Discussion: Clinical signs of cachexia and polyuria may be related to canine urinary tract infection caused by Salmonella enterica subsp. enterica, since these symptoms had already been recorded previously in a case of a bacterial infection by the same serogroup. Isolation of Salmonella spp. in a non-selective medium was determinant in identifying these bacteria. Since these are not commensal bacteria of the canine urinary tract, their isolation in this tract indicates that they are responsible for the infection or disease, although such cases are rare. Another aspect that should be highlighted is the risk of human infection, because of the zoonotic potential of Salmonella spp., which may be transmitted by contact with dog urine. This is the first report of the isolation of Salmonella enterica subsp. enterica in a case of canine cystitis on the northeast region of Brazil, and underscores the importance of complementary diagnostic exams such as urine culture. [ABSTRACT FROM AUTHOR]

Copyright of Brazilian Journal of Veterinary Science / Revista Brasileira de Ciência Veterinária is the property of Revista Brasileira de Ciencia Veterinaria and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Pesquisa Veterinaria Brasileira is the property of Colegio Brasileiro de Patologia Animal - CBPA and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Background: Leptospirosis is a re-emergent contagious infectious disease, caused by pathogenic leptospires that are transmitted by the urine of infected animals or bacteria-contaminated water and mud. In tropical and subtropical countries it presents high prevalence due to the temperature and humidity conditions that favor the maintenance of the agent in the environment. This disease can affect several species, in Brazilian cattle is an endemic disease, and studies have shown a high occurrence of Leptospira spp. infection in beef and dairy herds. Domestic cats as well as other species of the Family Felidae seem to be resistant to leptospirosis. However, it has been demonstrated under experimental conditions that cats may become infected by ingestion of infected rodents and contaminated water. The present study investigated the occurrence of Leptospira spp. infection in cattle, feral cats and rodents of the Fernando de Noronha Island. Materials, Methods & Results: Fernando de Noronha Island is located 360 km far from Recife and Natal, capitals of the states of Pernambuco and Rio Grande do Norte, Brazil, respectively. It has an area of approximately 18.4 km2 and constitutes the submerged part of a volcanic edifice currently inactive, which base rests 4,000 m deep in the Atlantic Ocean. Blood samples were collected from all the cattle raised in the Island (n = 88), 200 feral cats and 150 rodents, and the sera were screened by MAT (Serogroups: Australis; Autumnalis; Ballum; Bataviae; Canicola; Cynopteri; Djasiman; Grippotyphosa; Hebdomadis; Icterohaemorrhagiae; Icterohaemorrhagiae; Panama; Pomona; Pyrogenes; Sejroe e Tarassovi) for detection of anti-Leptospira spp. antibodies. Initially all sera were screened at 1:100 dilution and those with 50% or more agglutination were titrated at two-fold geometric dilutions. The serum titer was defined as the reciprocal of the highest positive dilution. The plane coordinates obtained by Global Position System (GPS) were used for developing a spatial map of the Fernando de Noronha Island. The geo-referenced data were plotted in the ArcGIS 10.1 software. Approximately 22% (20/88) and 12% (19/150) of the cattle and rodents were serologically reactive against Leptospira spp. antigens, respectively. The antibody titers of cattle ranged from 100 to 800 as shown. All the rodents screened were reactive against only one serovar and their antibody titers ranged from 100 to 3200. None of the serum samples from cats was reactive against the serovars tested. The serogroup Icterohaemorrhagiae predominated among the seropositive cattle, being found in 100% of the reactive samples. In rodents, the serogroups Icterohaemorrhagiae, Djasiman and Australis were responsible for 73.7% (14/19), 21.0% (4/19) and 5.2% (1/19) of the infections, respectively. Discussion: We believe that rodents and cattle play an important role in the dissemination of this disease, thus, it is necessary adopting prophylactic measures aimed at leptospirosis in the study area, in view of the human cases of leptospirosis reported and confirmed in the Island. These results are unprecedented in an insular environment in Brazil. Strategies aimed at better sanitary management of the cattle herds as well as population control of rodents must be implemented in the Fernando de Noronha Island to secure a more sustainable animal production and minimize the risks to public health. [ABSTRACT FROM AUTHOR]

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil. Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5'CTTAGCAGTTTGCGATATTGCCATT3') and VENS2 (5'GCTTTTGAGATAACAATAAGAGCTT3') for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years. Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems. [ABSTRACT FROM AUTHOR]

Copyright of Pesquisa Veterinaria Brasileira is the property of Colegio Brasileiro de Patologia Animal - CBPA and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Background: In Brazil, studies on animals and humans in mainland areas have shown that most strains of Toxoplasma gondii are pathogenic to mice and exhibit great genetic variability. Results: In this study, using a set of 11 PCR-RFLP and 15 microsatellite markers, we isolated and genetically characterised T. gondii strains from one cat and three rats on Fernando de Noronha Island. The cat had antibodies to T. gondii, which were revealed using a modified agglutination test (MAT, cut-off 1:25) and the seroprevalence among the 46 rodents was 15.2%. Viable T. gondii was isolated from one cat (TgCatBrFN1), two brown rats (TgRatnoBrFN1 and TgRatnoBrFN2) and one black rat (TgRatraBrFN1). Unlike the strains from mainland Brazil, these isolates were not pathogenic to outbred mice. The genotypes of these strains were compared with strains previously isolated on the island and in mainland Brazil. The analysis based on microsatellite data showed a limited genetic diversity of T. gondii on Fernando de Noronha Island with the majority of strains clustered into the following three groups: type II, III, and Caribbean 1. Conclusions: There was little variation among strains within the same group, suggesting that the majority of strains circulating on Fernando de Noronha are derived from only a few strains that were recently introduced to the island, likely from imported cats. Except for the strain belonging to the Caribbean 1 group that originates from northeast Brazil, there was little evidence that strains from the other groups were introduced to Fernando de Noronha via mainland Brazil. [ABSTRACT FROM AUTHOR]

Here, we assessed outcome of experimental infection by Neospora caninum in goats intravenously inoculated with 106 tachyzoites of the Nc-Spain7 isolate at 40 (G1), 90 (G2) and 120 (G3) days of gestation. Infected goats had fever between 5 and 9 days post inoculation (dpi); all were seropositive at the time of abortion/birth. Foetal death occurred in G1 from 10 to 21 dpi (n = 7) and in G2 from 27 to 35 dpi (n = 4). Goats in G2 also had seropositive stillbirth (n = 1) and healthy kids (n = 2). G3 goats (n = 7) had 3 seropositive and 3 seronegative weak kids, and 2 seronegative healthy kids. Parasite DNA detection in placentomes was 100% in G2, 85.7% in G3 and in G1 was detected only in placentomes from the goats with foetal losses from 17 dpi (100%). Parasites were detected in foetal/kid brain (>85.7%) and liver (≥50%) of G2 and G3, and in G1 after 17 dpi (100%). The highest parasite loads were detected in the placentomes of G1 from 17 dpi and G2, and in foetal tissues of G1 from 17 dpi and G3. Multifocal necrotic lesions were observed in the placentas of the three groups, but they were larger and more frequent in G1 and G2. Similar lesions were observed in foetal tissues, but they were more frequent in G3. These findings suggest that, as observed in cattle and sheep, the clinical consequences of N. caninum in pregnant goats are dependent in part on the time of gestation when animals were infected. [ABSTRACT FROM AUTHOR]

The aim of the present study was to investigate the occurrence of Toxoplasma gondii among horses and its associated risk factors in Alagoas, Brazil. In total, 440 samples from 36 properties in 23 districts of the state of Alagoas were studied, covering the Leste, Agreste and Sertão mesoregions. Risk factors were evaluated through the application of an investigative questionnaire that focused on the productive, reproductive and sanitary management of herds. T. gondii infection were assayed using the immunofluorescence assay (IFA) with a cutoff point of 64; 14.4% (95% CI: 11.0%-17.8%) of--horses were seropositive. A significant association was determined between anti-T. gondii antibody presence and the consumption and storage of hay (OR = 2.08/95% CI: 1.20-3.62). This is the first report of T. gondii infection among horses in the state of Alagoas, Brazil. [ABSTRACT FROM AUTHOR]

Mastitis is the principal disease affecting dairy herds worldwide. The aim of the present study was to characterize phenotypic and genotypic features associated with resistance to antimicrobials in Staphylococcus spp. isolated from 2064 milk samples of 525 lactating cows in the Northeast of Brazil. Of the 218 isolates analyzed, 57.8 % were characterized as Staphylococcus aureus, 28 % as coagulase-positive staphylococci other than S. aureus (oCPS), and 14.2 % as coagulase-negative staphylococci (CNS). The test for susceptibility to antimicrobials showed amoxicillin (32.6 %) to be the less effective drug in vitro, and the multi-drug resistance (MDR) rate for beta-lactams varied from 0 to 0.75. The genotypic characterization showed that 93.1 % of the samples were tested positive for the blaZ gene, while none amplified mecA. The antibiotic efflux mechanism was observed in 0.9 % of isolates. The biofilm formation was found in 3.7 and 96.3 % of samples, respectively, on Congo red agar and on the microplate adhesion test, while the icaD gene was present in 92.2 % of Staphylococcus spp. The high frequency of blaZ gene observed in this study was associated with the resistance of most Staphylococcus spp. to one or more of the beta-lactams tested, which are routinely used in Brazilian herds for mastitis treatment. The biofilm formation was also detected in the isolates analyzed being an important characteristic for pathogenicity and antimicrobial resistance of bacteria. [ABSTRACT FROM AUTHOR]

Bearded Capuchin or Black-striped Capuchin monkeys (Sapajus lidibinosus) are New World robust capuchin monkeys widely used in medical research. Few data are available concerning hematological reference values for these species, with no studies available from the Northeast region in Brazil. The aim of this study was to determine the hematological reference values for healthy bearded capuchin monkeys and to analyze the influence of sex and age factors. Blood samples were collected from 50 healthy bearded capuchin monkeys housed in captivity. These were analysed for total erythrocyte, hemoglobin, leukocyte and platelet count, packed cell volume (PCV), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and mean corpuscular hemoglobin concentration (MCHC). When considering the age factor, significant differences were reported for total erythrocyte count, PCV, hemoglobin, total leucocytes, band neutrophils, eosinophils and lymphocytes (higher in juveniles). Significant sex-associated differences were noted for total erythrocyte count, PCV, hemoglobin (higher in males) and number of lymphocytes (higher in females). We have reported for the first time the hematological profile of bearded capuchin monkeys in captivity in the state of Paraíba, Brazil. These results can contribute for a better understanding of the normal physiology of capuchin monkeys, while demonstrating that factors such as sex and age influence hematological parameters should be taken into consideration in the hematological evaluation of this species. [ABSTRACT FROM AUTHOR]

Glanders is a contagious zoonotic infectious disease characterized by an acute or chronic condition that mainly affects equids and is caused by Burkholderia (B.) mallei. From January 2005 to December 2017, 697 farms with positive cases of this disease were registered in Brazil, with the Northeast region accounting for 61.4% (428/697) of the total number of cases. This study conducted an epidemiological study of B. mallei infections that occurred in farms in the states of Pernambuco, Paraíba, Ceará and Alagoas. For this purpose, investigative questionnaires were applied to six farms where there were outbreaks of glanders and 11 farms where there were no reports of glanders between 2017 and 2021, and statistical analysis of the factors associated with the occurrence of glanders in Northeastern Brazil was performed. Factors such as the purpose of rearing (P = 0.023), lack of information on disease transmission modes (P = 0.034), failure to carry out periodic tests for glanders diagnosis (P = 0,029), no request for glanders tests prior to the purchase of new animals periodic tests for glanders diagnosis (P = 0.029), not requiring a negative test for glanders in the acquisition of animals (P = 0.06), use of extensive breeding systems(P = 0.027), and poor stall hygiene were associated with disease occurrence (P = 0.001). Understanding the factors related to the occurrence of glanders in the Northeast Region of Brazil helps to establish management measures that minimize bacteria transmission, thereby reducing the number of cases in the region and economic losses associated with glanders. [ABSTRACT FROM AUTHOR]

Glanders is an infectious disease of equids caused by Burkholderia mallei, a facultative intracellular non-mobile Gram-negative bacterium that can be transmitted to other animals and humans. This study described glanders cases reported in the state of Maranhão, located within an Amazon-Cerrado transition region in northeastern Brazil, from 2007 to 2017. A database in an electronic spreadsheet (Microsoft Excel 2010) was developed containing information on the number of positive animals according to age, sex, purpose, year and month, municipality and mesoregion of origin of the animal. The descriptive analyzis was performed on data provided by the State Agency for Agricultural and Livestock Protection of the state of Maranhão (AGED), and by the official private laboratory. As the database did not have information data about negative animals, possible risk factors could not be evaluated. Among the total of 62,555 equids were evaluated by means of the complement fixation test (CFT), 59,036 were horses, 2,981 mules and 538 donkeys. Thirty-five samples (0.06%) reacted in the CFT. Five additional samples were by the western blot technique and three of them were positive. All the reactive horses (Equus caballus) were from rural areas. Results presented here indicate that glanders may be endemic in the state of Maranhão and is a public health concern. [ABSTRACT FROM AUTHOR]

This study detected the presence and distribution of mecA in Staphylococcus spp. in the dairy production environment at farm level in Brazil. We analyzed 335 samples of mastitis cow milk, 15 samples of nostrils and hand swabs from milkers, 14 teat cup swabs, and 9 milking buckets swabs. Initially, the samples were subjected to microbiological analysis to detect Staphylococcus spp. and then S. aureus and mecA positive isolates were identified by PCR. All S. aureus isolates carrying the mecA genes were subjected to DNA macro-restriction analysis by Pulsed-Field Gel Electrophoresis (PFGE). The mecA gene was detected in 6/335 (1.78%) of mastitis cow milk, 5/15 (33.3%), and 5/15 (33.3%) of nostrils and hand swab, and 4/14 (28.5%) of the teat cup isolates. MRSA genotyping was performed by PFGE, a total of seven pulsotypes were grouped in two clusters. This study identified the occurrence and spread of MRSA at dairy environment of farms, and also the existence of distinct genetic profiles between isolates. [ABSTRACT FROM AUTHOR]

This research aimed to investigate the genotypic relatedness of 18 Staphylococcus aureus strains isolated from intramammary infections in primiparous cows and extramammary sites on five dairy herds by rep-PCR using RW3A primers, and by PFGE using the endonuclease SmaI. The isolates were also evaluated in vitro for the susceptibility against beta-lactam antimicrobials drugs (penicillin and oxacillin), considering that beta-lactams are frequently used for treating staphylococcal intrammamary infections. The rep-PCR typing was highly discriminatory (D value= 0.9804) and a total of 15 patterns were detected. The PFGE method was also highly discriminatory (D value= 0.9667) and a total of 13 patterns were observed. A total of 15 out of 18 (83%) isolates were resistant to penicillin and one out of 18 (6%) to oxacillin. In conclusion, these findings confirmed the occurrence of a high genetic diversity of S. aureus strains at the herds and the presence of clonally-related strains only at the same herd, emphasizing a variety of genotypic profiles among the isolates. [ABSTRACT FROM AUTHOR]

The present study aimed to investigate contagious agalactia (CA) in flocks from Pernambuco State. The study involved 225 goats and 63 ewes; 288 milk samples and 100 vaginal swabs were collected in total. The PCR assays were carried out using specific primers to Mycoplasma agalactiae and the Mycoplasma mycoides cluster. Among the goat's milk samples,12.0% (27/225) were positive for Mycoplasma agalactiae DNA, while 5.3% (12/225) contained the Mycoplasma mycoides cluster. Of the vaginal swabs taken from goats, 15.4% (12/78) were positive for Mycoplasma agalactiae DNA and 3.8% (3/78) contained the Mycoplasma mycoides cluster. In the case of ewes, 4.3% (1/23) of the milk samples contained Mycoplasma agalactiae DNA, and 7.5% (3/40) were positive for the Mycoplasma mycoides cluster. Vaginal swabs taken from sheep´s were negative. Analysis of risk factors for mycoplasmosis, showed that goats and sheep flocks on the extensive breeding system are more likely to have mycoplasmosis than those on the intensive breeding system (odds ratio (OR) 6.2; p=0.004); meat goat and sheep flocks are more likely to have infection compared to dairy flocks (OR 4.8; p=0.011); unclean animal housing increases the chances of infection (OR 5.0; p=0.031) and not performing quarantine increases the chances of mycoplasmosis (OR 4.6; p=0.042). Based on these findings we conclude that CA syndrome in the semiarid region of Pernambuco state can be associated with Mycoplasma agalactiae and Mycoplasma mycoides cluster. [ABSTRACT FROM AUTHOR]

The importance of Clostridium perfringens and C. difficile for most wild animal species remains unclear This study aimed to isolate and genotype C. perfringens and C. difficile in stool samples from free-living and captive capuchin monkeys (Sapajus flavius and Sapajus libidinosus) in Brazil. Ten free-living S. flavius and 14 captive S. libidinosus were sampled for this study. To isolate C. difficile, stool samples were inoculated on plates containing cycloserine-cefoxitin fructose agar supplemented with horse blood and sodium taurocholate. Two different protocols for C. perfringens isolation were tested: direct plating onto selective agar and enrichment in brain heart infusion (BHI) broth followed by plating onto selective agar. C. difficile was not detected in the present study. The results were identical for both protocols tested for isolation of C. perfringens. Four samples (16.7%) were positive for C. perfringens type A, including one sample from a free-living animal (4.2%) and three from captive animals (12.5%), meaning there was no significant difference between these two groups. C. perfringens isolates were negative for all additional virulence factors evaluated, including enterotoxin encoding-gene (cpe) and beta-2 encoding-gene (cpb2). These results suggested that C. perfringens type A is found in the microbiota of capuchin monkeys, although it is less frequent than previously reported in domestic animals. [ABSTRACT FROM AUTHOR]

The aim of the present study was to assess two diagnostic techniques (California mastitis test (CMT) and the somatic cell count (SCC)) that can diagnose mastitis in dairy goats. Experimental infection was conducted using 20 mammary glands, a strain of Staphylococcus aureus, an infectious dose of 1.2x108 CFU mL-1 and a volume of 1mL per mammary gland. The CMT and the SCC were used to detect subclinical mastitis. Bacterial culture (BC) was performed immediately after milk collection and was used as the gold standard. Four experimental time points were established (0, 24, 48 and 72 hours post-inoculation). Analysis of the ROC curve confirmed that the best combination of sensitivity and specificity were obtained with a cutoff point of 405.5, 6030.0 and 729.5x10³ cells mL-1, respectively at M1, M2 and M3. Furthermore, considering the drop in sensitivity throughout the experimental time points, the use of serial bacterial cultures are recommended, particularly in herds with a high prevalence of S. aureus. [ABSTRACT FROM AUTHOR]

The aim of this study was to determine the occurrence of anti-rough Brucella and anti-smooth Brucella antibodies in dogs from the county of Natal, Rio Grande do Norte state, Brazil, as well as to identify risk factors associated with positivity and to perform molecular detection of the agent in seropositive animals. Sera from 416 dogs attended in veterinary clinics during the period from March to November 2011 were used. For the serological diagnosis of rough Brucella the agar gel immunodiffusion (AGID) test, using antigen of lipopolysaccharides and proteins from Brucella ovis, strain Reo 198, was carried, and for smooth Brucella the buffered plate agglutination test (BPAT) was used. From seropositive animals, blood samples with sodium citrate were collected for the diagnosis by polymerase chain reaction (PCR). Frequency of anti-rough Brucella antibodies was 28.9% (120/416). All animals were negative for anti-smooth Brucella antibodies. Of the 80 seropositive animals Brucella spp. DNA was amplified in three (3.8%). Risk factors associated with the seropositivity were not identified. It was concluded that rough Brucella infection is present in the county of Natal, as well as it is suggested the serological monitoring of animals attended at clinics aiming the identification of sources of infection. [ABSTRACT FROM AUTHOR]