Search

Our knowledge of complex pathological mechanisms underlying organ fibrosis is predominantly derived from animal studies. However, relevance of animal models for human disease is limited; therefore, an ex vivo model of human precision-cut tissue slices (PCTS) might become an indispensable tool in fibrosis research and drug development by bridging the animal–human translational gap. This study, presented as two parts, provides comprehensive characterization of the dynamic transcriptional changes in PCTS during culture by RNA sequencing. Part I investigates the differences in culture-induced responses in murine and human PCTS derived from healthy liver, kidney and gut. Part II delineates the molecular processes in cultured human PCTS generated from diseased liver, kidney and ileum. We demonstrated that culture was associated with extensive transcriptional changes and impacted PCTS in a universal way across the organs and two species by triggering an inflammatory response and fibrosis-related extracellular matrix (ECM) remodelling. All PCTS shared mRNA upregulation of IL-11 and ECM-degrading enzymes MMP3 and MMP10. Slice preparation and culturing activated numerous pathways across all PCTS, especially those involved in inflammation (IL-6, IL-8 and HMGB1 signalling) and tissue remodelling (osteoarthritis pathway and integrin signalling). Despite the converging effects of culture, PCTS display species-, organ- and pathology-specific differences in the regulation of genes and canonical pathways. The underlying pathology in human diseased PCTS endures and influences biological processes like cytokine release. Our study reinforces the use of PCTS as an ex vivo fibrosis model and supports future studies towards its validation as a preclinical tool for drug development.

Fibrotic processes in the liver of non‐alcoholic steatohepatitis (NASH) patients cause microcirculatory dysfunction in the organ which increases blood vessel resistance and causes portal hypertension. Assessing blood vessel function in the liver is challenging, necessitating the development of novel methods in normal and fibrotic tissue that allow for drug screening and translation toward pre‐clinical settings. Cultures of precision cut liver slices (PCLS) from normal and fibrotic rat livers were used for blood vessel function analysis. Live recording of vessel diameter was used to assess the response to endothelin‐1, serotonin and soluble guanylate cyclase (sGC) activation. A cascade of contraction and relaxation events in response to serotonin, endothelin‐1, Ketanserin and sGC activity could be established using vessel diameter analysis of rat PCLS. Both the sGC activator BI 703704 and the sGC stimulator Riociguat prevented serotonin‐induced contraction in PCLS from naive rats. By contrast, PCLS cultures from the rat CCl4 NASH model were only responsive to the sGC activator, thus establishing that the sGC enzyme is rendered non‐responsive to nitric oxide under oxidative stress found in fibrotic livers. The role of the sGC pathway for vessel relaxation of fibrotic liver tissue was identified in our model. The obtained data shows that the inhibitory capacities on vessel contraction of sGC compounds can be translated to published preclinical data. Altogether, this novel ex vivo PCLS method allows for the differentiation of drug candidates and the translation of therapeutic approaches towards the clinical use., Cultures of rat precision cut liver slices (PCLS) were used for ex vivo blood vessel function analysis via live recording. The sGC activator BI703704 differentiates from the sGC stimulator Riociguat in the prevention of serotonin induced blood vessel contraction of normal and fibrotic rat liver slices. ​

Expression of bronchodilatory β2-adrenoceptors and bronchoconstrictive muscarinic M3-receptors alter with airway size. In COPD, (a combination of) β2-agonists and muscarinic M3-antagonists (anticholinergics) are used as bronchodilators. We studied whether differential receptor expression in large and small airways affects the response to β2-agonists and anticholinergics in COPD. Bronchoprotection by indacaterol (β2-agonist) and glycopyrrolate (anticholinergic) against methacholine- and EFS-induced constrictions of large and small airways was measured in guinea pig and human lung slices using video-assisted microscopy. In guinea pig lung slices, glycopyrrolate (1, 3 and 10 nM) concentration-dependently protected against methacholine- and EFS-induced constrictions, with no differences between large and small intrapulmonary airways. Indacaterol (0.01, 0.1, 1 and 10 μM) also provided concentration-dependent protection, which was greater in large airways against methacholine and in small airways against EFS. Indacaterol (10 μM) and glycopyrrolate (10 nM) normalized small airway hyperresponsiveness in COPD lung slices. Synergy of low indacaterol (10 nM) and glycopyrrolate (1 nM) concentrations was greater in LPS-challenged guinea pigs (COPD model) compared to saline-challenged controls. In conclusion, glycopyrrolate similarly protects large and small airways, whereas the protective effect of indacaterol in the small, but not the large, airways depends on the contractile stimulus used. Moreover, findings in a guinea pig model indicate that the synergistic bronchoprotective effect of indacaterol and glycopyrrolate is enhanced in COPD.

Nonalcoholic fatty liver disease (NAFLD) is the most common liver disease, characterized by excess fat accumulation (steatosis). Nonalcoholic steatohepatitis (NASH) develops in 15–20% of NAFLD patients and frequently progresses to liver fibrosis and cirrhosis. We aimed to develop an ex vivo model of inflammation and fibrosis in steatotic murine precision-cut liver slices (PCLS). NASH was induced in C57Bl/6 mice on an amylin and choline-deficient l-amino acid-defined (CDAA) diet. PCLS were prepared from steatohepatitic (sPCLS) and control (cPCLS) livers and cultured for 48 h with LPS, TGFβ1, or elafibranor. Additionally, C57Bl/6 mice were placed on CDAA diet for 12 wk to receive elafibranor or vehicle from weeks 7 to 12. Effects were assessed by transcriptome analysis and procollagen Iα1 protein production. The diets induced features of human NASH. Upon culture, all PCLS showed an increased gene expression of fibrosis- and inflammation-related markers but decreased lipid metabolism markers. LPS and TGFβ1 affected sPCLS more pronouncedly than cPCLS. TGFβ1 increased procollagen Iα1 solely in cPCLS. Elafibranor ameliorated fibrosis and inflammation in vivo but not ex vivo, where it only increased the expression of genes modulated by PPARα. sPCLS culture induced inflammation-, fibrosis-, and lipid metabolism-related transcripts, explained by spontaneous activation. sPCLS remained responsive to proinflammatory and profibrotic stimuli on gene expression. We consider that PCLS represent a useful tool to reproducibly study NASH progression. sPCLS can be used to evaluate potential treatments for NASH, as demonstrated in our elafibranor study, and serves as a model to bridge results from rodent studies to the human system. NEW & NOTEWORTHY This study showed that nonalcoholic steatohepatitis can be studied ex vivo in precision-cut liver slices obtained from murine diet-induced fatty livers. Liver slices develop a spontaneous inflammatory and fibrogenic response during culture that can be augmented with specific modulators. Additionally, the model can be used to test the efficacy of pharmaceutical compounds (as shown in this investigation with elafibranor) and could be a tool for preclinical assessment of potential therapies.

Background: Liver fibrosis results from continuous inflammation and injury. Despite its high prevalence worldwide, no approved antifibrotic therapies exist. Omipalisib is a selective inhibitor of the PI3K/mTOR pathway that controls nutrient metabolism, growth and proliferation. It has shown antifibrotic properties in vitro. While clinical trials for idiopathic pulmonary fibrosis have been initiated, an in-depth preclinical evaluation is lacking. We evaluated omipalisib's effects on fibrogenesis using the ex vivo model of murine and human precision-cut tissue slices (PCTS).Methods: Murine and human liver and jejunum PCTS were incubated with omipalisib up to 10 mu M for 48 h. PI3K pathway activation was assessed through protein kinase B (Akt) phosphorylation and antifibrotic efficacy was determined via a spectrum of fibrosis markers at the transcriptional and translational level.Results: During incubation of PCTS the PI3K pathway was activated and incubation with omipalisib prevented Akt phosphorylation (IC50 = 20 and 1.5 nM for mouse and human, respectively). Viability of mouse and human liver PCTS was compromised only at the high concentration of 10 and 1-5 mu M, respectively. However, viability of jejunum PCTS decreased with 0.1 (mouse) and 0.01 mu M (human). Spontaneously increased fibrosis related genes and proteins were significantly and similarly suppressed in mouse and in human liver PCTS.Conclusions: Omipalisib has antifibrotic properties in ex vivo mouse and human liver PCTS, but higher concentrations showed toxicity in jejunum PCTS. While the PI3K/mTOR pathway appears to be a promising target for the treatment of liver fibrosis, PCTS revealed likely side effects in the intestine at higher doses.

The direct relationship between pulmonary structural changes and airway hyperresponsiveness (AHR) in chronic obstructive pulmonary disease (COPD) is unclear. We investigated AHR in relation to airway and parenchymal structural changes in a guinea pig model of COPD and in COPD patients. Precision-cut lung slices (PCLS) were prepared from guinea pigs challenged with lipopolysaccharide or saline two times weekly for 12 wk. Peripheral PCLS were obtained from patients with mild to moderate COPD and non-COPD controls. AHR to methacholine was measured in large and small airways using video-assisted microscopy. Airway smooth muscle mass and alveolar airspace size were determined in the same slices. A mathematical model was used to identify potential changes in biomechanical properties underlying AHR. In guinea pigs, lipopolysaccharide increased the sensitivity of large (>150 μm) airways toward methacholine by 4.4-fold and the maximal constriction of small airways (

Airway epithelium, which forms the first barrier towards environmental insults, is disturbed by cigarette smoking, a major risk factor for developing chronic obstructive pulmonary disease (COPD). A-kinase anchoring proteins (AKAP) maintain endothelial barrier function and coordinate subcellular localization of protein kinase A (PKA). However, the role of AKAPs in epithelial barrier function is unknown. We studied the role of AKAPs in regulating human bronchial epithelial (Hogg JC, Timens W. Annu Rev Pathol 4: 435–459, 2009; HBE) barrier. Cigarette smoke extract (CSE) reduced barrier function in 16HBE cells and the expression of the adhesion molecule E-cadherin specifically at the cell membrane. In addition, CSE reduced the protein expression of the AKAP family member AKAP9 at the cell membrane. The expression of AKAP5 and AKAP12 was unaffected by CSE. AKAP9 interacted and colocalized with E-cadherin at the cell membrane, suggesting that the reduction of both proteins may be related. Interestingly, disruption of AKAP-PKA interactions by st-Ht31 prevented the CSE-induced reduction of E-cadherin and AKAP9 protein expression and subsequent loss of barrier function. Silencing of AKAP9 reduced the functional epithelial barrier and prevented the ability of st-Ht31 to restore membrane localization of E-cadherin. Our data suggest the possibility of a specific role for AKAP9 in the maintenance of the epithelial barrier. E-cadherin, but not AKAP9, protein expression was reduced in lung tissue from COPD patients compared with controls. However, AKAP9 mRNA expression was decreased in primary bronchial epithelial cells from current smokers compared with non/ex-smokers. In conclusion, our results indicate that AKAP proteins, most likely AKAP9, maintain the bronchial epithelial barrier by regulating the E-cadherin expression at the cell membrane.

Dysfunctional regulation of airway smooth muscle (ASM) tone is a feature of obstructive airway diseases. cAMP-elevating agents, such as β 2 -adrenoceptor agonists, are potent inhibitors of bronchial constriction. Although used clinically for many years, their precise mechanism of action is still under debate. Activation of protein kinase A (PKA) by β 2 -agonists induces ASM relaxation. Next to PKA, activation of the exchange protein directly activated by cAMP (Epac) induces ASM relaxation. We have recently shown that Epac1 and Epac2 are differentially involved in inflammatory and remodeling processes in vivo. Here, we studied the roles of Epac1 and Epac2 in regulating ASM tone. In precontracted rings, isoprenaline dose-dependently reduced methacholine-induced ASM tone by approximately 80 % (pD2-value 7.58±0.22), both effects were reduced but not diminished by the PKA inhibitor Rp, pointing to PKA-independent mechanisms (Emax 63.4±3.5; pD2-value 7.34±0.13). Epac activators dose-dependently reduced methacholine-induced ASM tone (pEC50=4.22±0.12 and 4.30±0.10, respectively). The reduction was 25.2±3.0% and 46.0±1.8% for the highest dose used (300 μM). The effects of the Epac activator9s were unaffected by Rp. Isoprenaline-induced relaxation was not altered in Epac1-/- or Epac2-/- mice. The effects of 8-pCPT were reduced in Epac deficient mice, although to a smaller extent in Epac1-/-. Pharmacological inhibition of Epac1 - to a lesser extent of Epac2 – dose-dependently increased isoprenaline-induced relaxation, effects blunted in Epac deficient mice, confirming the specificity of the Epac inhibitors. Collectively, these data show that Epac1 and Epac2 regulate airway smooth muscle tone in mice by currently unknown mechanisms.

Cigarette smoke (CS) induces inflammatory responses characterized by increase of immune cells and cytokine release. Remodeling processes, such as mucus hypersecretion and extracellular matrix protein production, are also directly or indirectly induced by CS. Recently, we showed that activation of the exchange protein directly activated by cAMP (Epac) attenuates CS extract-induced interleukin (IL)-8 release from cultured airway smooth muscle cells. Using an acute, short-term model of CS exposure, we now studied the role of Epac1, Epac2, and the Epac effector phospholipase-Cε (PLCε) in airway inflammation and remodeling in vivo. Compared to wild-type mice exposed to CS, the number of total inflammatory cells, macrophages, and neutrophils and total IL-6 release was lower in Epac2(-/-) mice, which was also the case for neutrophils and IL-6 in PLCε(-/-) mice. Taken together, Epac2, acting partly via PLCε, but not Epac1, enhances CS-induced airway inflammation in vivo. In total lung homogenates of Epac1(-/-) mice, MUC5AC and matrix remodeling parameters (transforming growth factor-β1, collagen I, and fibronectin) were increased at baseline. Our findings suggest that Epac1 primarily is capable of inhibiting remodeling processes, whereas Epac2 primarily increases inflammatory processes in vivo.-Oldenburger, A., Timens, W., Bos, S., Smit, M., Smrcka, A. V., Laurent, A.-C., Cao, J., Hylkema, M., Meurs, H., Maarsingh, H., Lezoualc'h, F., and Schmidt, M. Epac1 and Epac2 are differentially involved in inflammatory and remodeling processes induced by cigarette smoke.

Chronic obstructive pulmonary disease (COPD) is an inflammatory disorder of structural airway cells with cigarette smoke as the main etiologic factor. COPD patients are treated with agonists of the β2-adrenoceptor, which induce their biological effects by elevating cyclic AMP and subsequently activate protein kinase A (PKA) and the “exchange proteins directly activated by cAMP”, Epac1 and Epac2. PKA and Epac are involved in key processes that contribute to the pathogenesis of COPD, including inflammation (Schmidt et al. 2013). The expression of specifically Epac1 protein is reduced in cultured human airway smooth muscle (HASM) cells, immortalized by stable ectopic expression of human telomerase reverse transcriptase enzyme, after exposure to cigarette smoke extract (CSE) and in lung tissue from COPD patients (Oldenburger et al. 2012). Since specific activation of Epac reduces CSEinduced cytokine release (Oldenburger et al. 2012), loss of Epac1 may contribute to the inflammatory process in COPD. MicroRNAs (miRNAs) are epigenetic regulators involved in fine-tuning of cellular activities by posttranscriptional repression of mRNA. In COPD, miRNAs have been implicated in the regulation of inflammatory processes (Oglesby et al. 2010), and miRNA-7 is increased in serum of COPD patients (Akbas et al. 2013). In silico analysis indicates that Epac1 is a putative target of miRNA-7 (targetscan.org). Therefore, we hypothesized that increased miRNA-7 levels are involved in the attenuation of Epac1 expression in COPD patients. We investigated the expression of Epac and miRNA-7 in lung tissue of control and COPD patients as well as in CSEexposed structural airway cells. HASM cells, MRC-5 fibroblasts, and human bronchial epithelial (16HBE14o-) cells were exposed to CSE as described previously (Oldenburger et al. 2012). RT-PCR for miRNA-7 was performed by using stemloop primers (Stemloop: GTCGTATCCAGTGCAGGGTCCGAGGTAT TGCGCACTGGATACGACACAACAAA; Forward: GCGGTTGGAAGACTAGTGAT; Reverse: CCAGTGCA GGGTCCGAGGTCCG) and quantified results were normalized to RNU6B (Stemloop: GTCGTATCCAGTGCAGGGTC CGAGGTATTCGCACTGGATACGACAAAAATATGG; Forward: TGCGGCTGCGCAAGGATGA; Reverse: CCAG TGCAGGGTCCGAGGTCCG). CSE increased miRNA-7 expression specifically in HASM cells, leaving miRNA-7 in 16HBE14oand MRC-5 cells unaffected (Fig. 1a). To correlate the expression of miRNA7 and Epac1, HASM cells were lentivirally transformed to overexpress miRNA-7. Although Epac2 protein (Fig. 1c) was not altered, ectopic overexpression of miRNA7 significantly decrease Epac1 protein (Fig. 1b; p=0.03). These data suggest that Epac1 is targeted by miRNA-7 and that increased miRNA-7 expression is related to CSE-induced downregulation of Epac1 in HASM. Wim Timens and Martina Schmidt shared senior authorship. A. Oldenburger : B. van Basten :H. Meurs :M. Schmidt Department of Molecular Pharmacology, University of Groningen, Groningen, The Netherlands

Therapies involving elevation of the endogenous suppressor cyclic AMP (cAMP) are currently used in the treatment of several chronic inflammatory disorders, including chronic obstructive pulmonary disease (COPD). Characteristics of COPD are airway obstruction, airway inflammation and airway remodelling, processes encompassed by increased airway smooth muscle mass, epithelial changes, goblet cell and submucosal gland hyperplasia. In addition to inflammatory cells, airway smooth muscle cells and (myo)fibroblasts, epithelial cells underpin a variety of key responses in the airways such as inflammatory cytokine release, airway remodelling, mucus hypersecretion and airway barrier function. Cigarette smoke, being next to environmental pollution the main cause of COPD, is believed to cause epithelial hyperpermeability by disrupting the barrier function. Here we will focus on the most recent progress on compartmentalized signalling by cAMP. In addition to G protein-coupled receptors, adenylyl cyclases, cAMP-specific phospho-diesterases (PDEs) maintain compartmentalized cAMP signalling. Intriguingly, spatially discrete cAMP-sensing signalling complexes seem also to involve distinct members of the A-kinase anchoring (AKAP) superfamily and IQ motif containing GTPase activating protein (IQGAPs). In this review, we will highlight the interaction between cAMP and the epithelial barrier to retain proper lung function and to alleviate COPD symptoms and focus on the possible molecular mechanisms involved in this process. Future studies should include the development of cAMP-sensing multiprotein complex specific disruptors and/or stabilizers to orchestrate cellular functions. Compartmentalized cAMP signalling regulates important cellular processes in the lung and may serve as a therapeutic target.