Search

Seed storage proteins are the principal source of proteins concerning human nutrition. Rice grains are one of the important sources of carbohydrates, proteins and minerals. Thus, the extraction and identification of proteins present in rice seeds are basic step towards the characterization of seed storage proteins. Three methods viz., phosphate buffer saline (PBS) method, PBS followed by acetone precipitation (PBS-acetone) method and urea-sodium dodecyl sulphate (urea SDS) buffer method were optimized in this study. Results revealed that, compared to the first and second methods, the urea-SDS method of protein extraction was found to be better in extraction of a greater number of seed storage proteins in rice through SDS-PAGE. Hence, urea-SDS method can be used for extracting seed storage proteins from rice seeds for various proteomic approaches. Furthermore, differences in protein content and protein banding patterns between rice genotypes were observed. These findings underline the importance of method optimization tailored to specific rice genotypes for maximizing protein yield and quality. Such optimization holds promise for enhancing food sustainability and nutritional value, particularly in regions reliant on rice as a staple food. [ABSTRACT FROM AUTHOR]

Chilli is an important vegetable crop used to add spiciness to food. Capsicum frutescens L. is one of the cultivated species of chilli grown wild in high rainfall regions. The experimental material consisting of thirty-three genotypes involving thirty-two bird's eye chilli germplasm lines collected from various regions of Karnataka and Kerala and one check variety were evaluated for yield and its contributing traits. The replicated experiment was conducted in open field condition during the January-June, 2023 at Department of Biotechnology, GKVK, Bengaluru. For traits including plant height, the number of secondary branches per plant and the number of days to first fruit harvest, significant treatment differences were noted. The traits viz., plant height, individual fruit dry weight and fruit yield per plant recorded high estimates of genotypic coefficient of variation (27.43, 25.49 and 27.10%, respectively), phenotypic coefficient of variation (29.92, 27.19 and 28.99%, respectively), heritability (84.00, 68.70 and 78.21%, respectively) and genetic advance over mean (51.81, 43.35 and 49.71, respectively). Promising genotypes identified for better yield were UASBCF-29, UASBCF-30, UASBCF-27, UASBCF-31 and UASBCF-9. The traits with high estimates of variance and heritability may be altered through selection. The better performing genotypes for yield can be effectively utilized in crop improvement programme. [ABSTRACT FROM AUTHOR]

The biogenic approach for the synthesis of metal nanoparticles provides an efficient eco-friendly alternative to chemical synthesis. This study presents a novel route for the biosynthesis of silver nanoparticles using aqueous sandalwood (SW) leaf extract as a source of reducing and capping agents under mild, room temperature synthesis conditions. The bioreduction of Ag+ to Ago nanoparticles (SW-AgNPs) was accompanied by the appearance of brown color, with surface plasmon resonance peak at 340-360 nm. SEM, TEM and AFM imaging confirm SW-AgNP's spherical shape with size range of 10-32 nm. DLS indicates a hydrodynamic size of 49.53 nm with predominant negative Zeta potential, which can contribute to the stability of the nanoparticles. FTIR analysis indicates involvement of sandalwood leaf derived polyphenols, proteins and lipids in the reduction and capping of SW-AgNPs. XRD determines the face-centered-cubic crystalline structure of SW-AgNPs, which is a key factor affecting biological functions of nanoparticles. This study is novel in using cell culture methodologies to evaluate effects of SW-AgNPs on proliferating cells originating from plants and human cancer. Exposure of groundnut calli cells to SW-AgNPs, resulted in enhanced proliferation leading to over 70% higher calli biomass over control, enhanced defense enzyme activities, and secretion of metabolites implicated in biotic stress resistance (Crotonyl isothiocyanate, Butyrolactone, 2-Hydroxy-gamma-butyrolactone, Maltol) and plant cell proliferation (dl-Threitol). MTT and NRU were performed to determine the cytotoxicity of nanoparticles on human cervical cancer cells. SW-AgNPs specifically inhibited cervical cell lines SiHa (IC50–2.65 ppm) and CaSki (IC50–9.49 ppm), indicating potential use in cancer treatment. The opposing effect of SW-AgNPs on cell proliferation of plant calli (enhanced cell proliferation) and human cancer cell lines (inhibition) are both beneficial and point to potential safe application of SW-AgNPs in plant cell culture, agriculture and in cancer treatment. [ABSTRACT FROM AUTHOR]

Sandalwood (Santalum album L.), a root hemiparasite, endemic to Southern India, is a tree of great commercial value globally. Considering the growing demand and the diminishing supply of sandalwood from its natural habitat, there is a great potential for cultivating sandal trees in agricultural land, home gardens and other agro forestry systems. The cultivation of sandalwood is challenging because of the poor understanding of host parasite relationship as sandalwood is a root parasite. In this context a study was carried out to understand the relationship of sandalwood with its two primary hosts, Cajanus (legume) and Alternanthera (nonlegume). The results showed that sandalwood grown with Cajanus (T3) have greater plant height (176.57 cm), stem girth (12.01 cm) chlorophyll content (3.29 mg/g FW of leaves) in contrast to sandalwood grown with Alternanthera (T2) and control (T1) without a host. The variations in activity of SOD, Peroxidase (POX) and accumulation of phenols, flavonoids, proline in sandalwood indicates differences in sandalwood response at molecular level towards the two hosts. There was a clear shift in SOD isozyme bands in sandalwood when it interacted with Cajanus as compared to Alternanthera (T2) and control (T1). The increase in peroxidases observed in T3 (11.30ƒÝg/mg protein) was significantly higher compared to the T2 and T1. The same trend was observed for the phenols, flavonoids and prolines. The greater reduction in defense response in the host plant Cajanus in comparison to Alternanthera when planted with sandalwood signifies the deliberate vulnerability of Cajanus towards sandalwood parasitism, making it a superior host. Indeed, a polybag experiment to evaluate the direction of root growth shows a clear preference of sandalwood root to Cajanus, as compared to Alternanthera. Overall from the phenotypic observations and also from the biochemical estimations, the leguminous host Cajanus was found to be a better primary host than Alternanthera in the field condition. The insights gained from the present investigation can be used for sandalwood cultivation in large scale in the natural habitat as well as in other agroforestrty region. [ABSTRACT FROM AUTHOR]

Black turmeric is widely distributed in Indian subcontinent and having high economic importance due to varied medicinal properties. Presently the species is considered as critically endangered and mainly propagated vegetatively through underground rhizomes. Urgent need is there to conserve this rare and unconventional medicinally important plant. Genetic diversity studies in C. caesia Roxb. still in primitive stage for selecting the better performing accessions. SSR finger print for 33 black turmeric accessions by using sixteen primers revealed a total of 77 scorable bands. Among which 43 were polymorphic with an average of 2.68 per primer. SSR-02 and SSR 07 primers produced highest polymorphism (100%), followed by SSR-01, SSR-03, SSR-04, SSR-05 (75.00%). Whereas, SSR 10 produced least polymorphism (37.50%) and SSR 13, SSR 23 had showed no polymorphism. Overall primers exhibited 55.84 per cent polymorphism and the PIC value ranged between 0.255 to 0.480, which is the range to predict moderate diversity among the population. All genotypes were grouped in to three genetically diverse clusters and nine subgroups. Dendrogram depicts majority of the genotypes intermingled with each other in different clusters irrespective of their geographical affiliations. Twelve sets of genotypes had showed 100 per cent genetic similarity, while fourteen sets had least (10%). The observed intraspecific variation may be associated with cultivation and targeted genotype selection of desirable characters in C. caesia as the species is economically important. These results are the first step towards a better knowledge of the germplasm available in Indian subcontinent and can help to guide conservation of the species. [ABSTRACT FROM AUTHOR]

Curcuma caesia Roxb. is widely distributed in Indian subcontinent, presently the species has been categorized as critically endangered. As a conservation strategy DNA bar-coding with ITS-2 marker (ITS2-F: ATGCGATACTTGGTGTGAAT, ITS2-R: ACGCTTCTCCAGACTACAAT) was done. The present study aims to identify species with at most precision and to avoid mismatch. All 20 samples taken for study yielded PCR product of ITS-2 gene of around 700 base pairs. The MOLE-BLAST results clearly showed that the percent identity of the all the species ranges from 79.14 to 99.9 per cent, where 75 to 98 per cent BLAST sequence identity is suggested. The percentage of individual sequence of the genotypes aligned to a sequence in gene bank is ranged from 62 to 92 per cent. Highest query coverage was observed for GKJ-5 (92 %) and GMV-6 (92 %) and least was for GNF-27 (62 %). The E value of the sequence blast ranges from 1e-83 to 9e-115, this clearly shows high quality match of the sequence with database. Genotype GKK-30 had least E value (e1-83) followed by GGR-10 (e1-100), GMF-21 (e1-114), GAP-20 (e1-130) and GMR-31 (e1-132). BG-1 and BG-2 species were identified as Kaempferia parviflora (Black ginger), The unknown species (UNK-7) was identified as Curcuma kwangsiensis with an accession number KF694813.1 in the NCBI library record. These results helped us to identify the species in precision, the mole-blast sequences of each genotype of black turmeric and other species can be used as an identity marker. [ABSTRACT FROM AUTHOR]

Rice (Oryza sativa L.), a staple food in Asia, is very sensitive to soil salinity. However, intraspecific variations exist, with the coastal cultivar Pokkali tolerating even brackish water. This study explores cellular mechanisms that contribute to salt tolerance in rice. It is widely accepted that limiting cytosolic Na+ should improve the survival of plants subjected to saline stress. However, an understanding of the mechanisms by which Na+ levels are controlled in relatively tolerant cultivars requires monitoring cytosolic Na+ non-invasively and in real time, which is technically challenging. We have used two-photon excitation for the ratiometric estimation of cytosolic Na+ in cultured cells using sodium-binding benzofuran isophthalate. Pokkali cells maintained low cytosolic Na+ (approximately 25 mM), and a viability of over 85% under high salinity , while Jaya cells were unable to maintain low cytosolic Na+ and suffered decreased viability even at moderate saline stress. Here we show that the permeability of the Pokkali plasma membrane to Na+ is significantly lower than that of Jaya, to the extent that it is comparable with permeabilities reported for halophytes. Pokkali effectively sequesters Na+ in intracellular compartments utilizing a Ca2+-regulated transport system(s). Together these cellular mechanisms allow Pokkali to maintain low cytosolic Na+ up to a stress of 250 mM NaCl. The findings demonstrate that differences in survival between these contrasting varieties of rice are mainly because of differences in membrane transport mechanisms and thus have significance in crop improvement. [ABSTRACT FROM AUTHOR]

Soil salinity is a major factor affecting crop productivity worldwide. This study explores mechanisms that contribute to salt tolerance in rice (Oryza sativa L.). Hydroponically grown, 2-week-old salt tolerant and sensitive indica rice varieties, Pokkali and Jaya, respectively, were exposed to a 48-h stress period with NaCl (0–250 mM). When exposed to 200 mM NaCl, micromolar levels of external Ca2+ elevated survival of both varieties. The Ca2+ levels required were lower for Pokkali than for Jaya, but resulted in significantly higher survival. Estimates of Na+ and K+ in root and shoot compartments were made by flame photometry, while X-ray microanalysis was used to localize Na+ in the extracellular matrix of the shoot. Transpirational bypass flow was estimated using the apoplastic tracer, 8-hydroxypyrene-1,3,6-trisulphonic acid, trisodium salt. Our data demonstrate a Ca2+-dependent reduction in Na+ transport to shoots, which correlated with a decline in bypass flow and of Na+ in the transpirational stream. In addition, the Na+ that enters the shoot is partitioned among several distinct compartments. Survival is inversely correlated with Na+ levels in the shoot apoplastic fluid, which surrounds the cell and influences cytosolic composition. Pokkali maintained lower Na+ in its apoplast compared with the salt sensitive Jaya at the same total shoot Na+. Na+ in the apoplast appears to be regulated by sequestration into intracellular compartments. This sink supplements the primary response of reducing Na+ influx into the shoot and effectively buffers the apoplastic fluid in Pokkali. All of these mechanisms are operational in Jaya as well but are deployed less effectively. [ABSTRACT FROM AUTHOR]

Calcium-dependent protein kinase (CDPK) is expressed in sandalwood (Santalum album L.) seeds under developmental regulation, and it is localized with spherical storage organelles in the endosperm [Anil et al. (2000) Plant Physiol. 122: 1035]. This study identifies these storage organelles as oil bodies. A 55 kDa protein associated with isolated oil bodies, showed Ca2+-dependent autophosphorylation and also cross-reacted with anti-soybean CDPK. The CDPK activity detected in the oil body-protein fraction was calmodulin-independent and sensitive to W7 (N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide) inhibition. Differences in Michaelis Menton kinetics, rate of histone phosphorylation and sensitivity to W7 inhibition between a soluble CDPK from embryos and the oil body-associated CDPK of endosperm suggest that these are tissue-specific isozymes. The association of CDPK with oil bodies of endosperm was found to show a temporal pattern during seed development. CDPK protein and activity, and the in vivo phosphorylation of Ser and Thr residues were detected strongly in the oil bodies of endosperm from maturing seed. Since oil body formation occurs during seed maturation, the observations indicate that CDPK and Ca2+ may have a regulatory role during oil accumulation/oil body biogenesis. The detection of CDPK-protein and activity in oil bodies of groundnut, sesame, cotton, sunflower, soybean and safflower suggests the ubiquity of the association of CDPKs with oil bodies. [ABSTRACT FROM AUTHOR]

Here, we describe a series of methods suitable for the measurement of cytosolic ion concentrations in living plant cells using ion selective dyes. We describe procedures for the use of SBFI for the measurement of Na(+) in live cells. The resulting material is suitable for most standard cell biology procedures.