Search

Platelet-derived growth factor (PDGF) signaling, besides other growth factor-mediated signaling pathways like vascular endothelial growth factor (VEGF) and epidermal growth factor (EGF), seems to play a crucial role in tumor development and progression. We have recently provided evidence for upregulation of PDGF expression in UICC stage I-IV primary colorectal cancer (CRC) and demonstrated PDGF-mediated induction of PI3K/Akt/mTOR signaling in CRC cell lines. The present study sought to follow up on our previous findings and explore the alternative receptor cross-binding potential of PDGF in CRC. Our analysis of primary human colon tumor samples demonstrated upregulation of the PDGFRβ, VEGFR1, and VEGFR2 genes in UICC stage I-III tumors. Immunohistological analysis revealed co-expression of PDGF and its putative cross-binding partners, VEGFR2 and EGFR. We then analyzed several CRC cell lines for PDGFRα, PDGFRβ, VEGFR1, and VEGFR2 protein expression and found these receptors to be variably expressed amongst the investigated cell lines. Interestingly, whereas Caco-2 and SW480 cells showed expression of all analyzed receptors, HT29 cells expressed only VEGFR1 and VEGFR2. However, stimulation of HT29 cells with PDGF resulted in upregulation of VEGFR1 and VEGFR2 expression despite the absence of PDGFR expression and mimicked the effect of VEGF stimulation. Moreover, PDGF recovered HT29 cell proliferation under simultaneous treatment with a VEGFR or EGFR inhibitor. Our results provide some of the first evidence for PDGF cross-signaling through alternative receptors in colorectal cancer and support anti-PDGF therapy as a combination strategy alongside VEGF and EGF targeting even in tumors lacking PDGFR expression.

Supplementary Figure 2 from Ras-induced Modulation of CXCL10 and Its Receptor Splice Variant CXCR3-B in MDA-MB-435 and MCF-7 Cells: Relevance for the Development of Human Breast Cancer

Supplementary Figure 1 from Ras-induced Modulation of CXCL10 and Its Receptor Splice Variant CXCR3-B in MDA-MB-435 and MCF-7 Cells: Relevance for the Development of Human Breast Cancer

Supplementary Figure 1 from VEGFR-1 Expressed by Malignant Melanoma-Initiating Cells Is Required for Tumor Growth

Supplementary Table 1 from VEGFR-1 Expressed by Malignant Melanoma-Initiating Cells Is Required for Tumor Growth

Interactions between chemokines and chemokine receptors have been proposed recently to be of importance in the development and progression of cancer. Human breast cancer cells express the chemokine CXCL10 (IP-10) and also its receptor CXCR3. In this study, we have investigated the role of Ras activation in the regulation of CXCL10 and its receptor splice variant CXCR3-B in two human breast cancer cell lines MDA-MB-435 and MCF-7. In cotransfection assays, using a full-length CXCL10 promoter-luciferase construct, we found that the activated form of Ras, Ha-Ras(12V), promoted CXCL10 transcriptional activation. Ras significantly increased CXCL10 mRNA and protein expression as observed by real-time PCR, fluorescence-activated cell sorting analysis, and ELISA. Selective inhibition of Ha-Ras by small interfering RNA (siRNA) decreased CXCL10 mRNA expression in a dose-dependent manner. Further, using effector domain mutants of Ras, we found that Ras-induced overexpression of CXCL10 is mediated primarily through the Raf and phosphatidylinositol 3-kinase signaling pathways. We also observed that the expression of the splice variant CXCR3-B, known to inhibit cell proliferation, was significantly down-regulated by Ras. Selective inhibition of CXCR3-B using siRNA resulted in an increase in CXCL10-mediated breast cancer cell proliferation through Gi proteins and likely involving CXCR3-A. Finally, we observed intense expression of CXCL10 and CXCR3 in association with human breast cancer in situ, indicating that these observations may be of pathophysiologic significance. Together, these results suggest that activation of Ras plays a critical role in modulating the expression of both CXCL10 and CXCR3-B, which may have important consequences in the development of breast tumors through cancer cell proliferation. (Cancer Res 2006; 66(19): 9509-18)

Supplementary Table 2 from ABCB5 Identifies a Therapy-Refractory Tumor Cell Population in Colorectal Cancer Patients

PDF file - 52K, Differentially expressed genes in ABCB5-KD melanoma cells versus controls.

Supplementary Figure Legend from VEGFR-1 Expressed by Malignant Melanoma-Initiating Cells Is Required for Tumor Growth

Introdução: O carcinoma ductal invasor corresponde ao tipo histológico mais comum da mama coexistindo com formas diferentes de evolução clínica, graduação histológica, expressão de determinados marcadores teciduais e perfis genômicos que procuram melhor entendimento da doença. Objetivos: Analisar a correlação dos marcadores β-catenina e AXL com a agressividade tumoral, tendo como referência a sobrevida global, progressão tumoral e fatores prognósticos histopatológicos. Métodos: Foi realizado estudo de 101 amostras de carcinoma mamário ductal invasor. Foram incluídas aquelas com diagnóstico do tipo ductal, submetidas inicialmente à biópsia ou tratamento cirúrgico definitivo. Incluiu-se para fins de controle 20 amostras de carcinoma intraductal, 35 de fibroadenoma mamário e 10 de tecido mamário sem qualquer alteração. Foram excluídos os submetidos à quimioterapia neoadjuvante, que não tivessem amostra tumoral prévia ao tratamento quimioterápico, que perderam o seguimento, e com dados incompletos. Resultados: Quando analisada a expressão da β-catenina, foi negativa. Quanto ao AXL foram observados diferentes graus de expressão sem significância estatística entre eles. Conclusão: Quando analisados adenocarcinoma mamário do tipo ductal invasor em TMA não houve correlação na expressão de ß-catenina e AXL quando comparados a sobrevida global, progressão tumoral e grau histológico.

Racional: O câncer colorretal apresenta alta mortalidade global e marcadores tumorais têm surgido como sinalizadores de diagnóstico, manejo e prognóstico. Novos marcadores estão sendo estudados. Objetivo: Verificar se há correlação da expressão por imunoistoquímica das proteínas ALCAM e ALDH1 em tecido com adenocarcinoma colorretal com as características epidemiológicas e clinicopatológicas, em particular o seu impacto na progressão de doença e no óbito. Método: Estudo observacional, unicêntrico, analítico, retrospectivo, através da investigação de pacientes submetidos à ressecção cirúrgica por câncer colorretal. Foram avaliados 122 pacientes. Em relação a progressão, mostrou-se que nos indivíduos com ALCAM positiva (n=40), 14/40 (35%) tiveram progressão, e para ALDH positiva (n=54), 22/54 (40,7%). Para óbito, a análise da ALCAM positiva (n=40), 24/40 (60%) morreram, e ALDH1 positivo (n=54), 33/54 (61,1%). Conclusão: A expressão imunoistoquímica dos marcadores ALCAM e ALDH1 não apresentou associação com a progressão de doença e óbito; também não foi possível observar relação de correspondência com os marcadores avaliados.

ATP-binding cassette member B5 (ABCB5) identifies cancer-initiating cells (CICs) in multiple malignancies, including malignant melanoma, colorectal cancer, glioblastoma, and hepatocellular carcinoma (HCC). In human melanoma, ABCB5-positive CIC subpopulations have been shown to preferentially express the immune checkpoint molecules PD-1 and PD-L1, and tumor-intrinsic PD-1 receptor functions have been found to promote tumor growth, even in mice lacking adaptive immunity. In HCC, where ABCB5 mediates CIC chemoresistance, PD-1 expression has also recently been identified. However, whether ABCB5 regulates tumor-intrinsic PD-1 expression in HCC or other malignancies is currently unknown. Here, we employed RNA interference in Hep G2 HCC cells with high endogenous ABCB5 expression to study the potential role of ABCB5 in regulating PD-1 expression, utilizing the ABCB5 shRNA target sequence GCTGGAAAGATAGCAACTGAA for ABCB5 knockdown (KD) as described previously. Endogenous ABCB5 levels in ABCB5-KD cells were successfully reduced by 92.8% compared to controls. Investigation of the effects of ABCB5-KD on tumor-intrinsic immune checkpoint molecule expression and on expression of the HCC-CIC marker GRN revealed that ABCB5-KD significantly reduced PD-1 expression by 98.0%, and PD-L1 expression by 62.8% compared to controls. Expression of GRN was also significantly reduced in ABCB5-KD cells by 78.8% compared to controls, suggesting ABCB5 KD-dependent loss of CIC phenotype. Injection of ABCB5-KD cells in NSG mice showed 32.3% reduction in tumor size at endpoint (6 weeks) compared to controls (728.7 ± 199.3mm3 vs 1076.0 ± 450.9 mm3, mean ± SD; p Citation Format: Chun Philip Yeung, Brian J. Wilson, Yuzuru Sasamoto, Ana Maria Waaga-Gasser, Svetlana Karpova, Qin Guo, Natasha Y. Frank, Markus H. Frank. ABCB5 knockdown suppresses tumor-intrinsic expression of immune checkpoint regulators PD-1 and PD-L1 in hepatocellular carcinoma (HCC) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5862.

Background aim Mesenchymal stromal cells (MSCs) hold promise for the treatment of tissue damage and injury. However, MSCs comprise multiple subpopulations with diverse properties, which could explain inconsistent therapeutic outcomes seen among therapeutic attempts. Recently, the adenosine triphosphate-binding cassette transporter ABCB5 has been shown to identify a novel dermal immunomodulatory MSC subpopulation. Methods The authors have established a validated Good Manufacturing Practice (GMP)-compliant expansion and manufacturing process by which ABCB5+ MSCs can be isolated from skin tissue and processed to generate a highly functional homogeneous cell population manufactured as an advanced therapy medicinal product (ATMP). This product has been approved by the German competent regulatory authority to be tested in a clinical trial to treat therapy-resistant chronic venous ulcers. Results As of now, 12 wounds in nine patients have been treated with 5 × 105 autologous ABCB5+ MSCs per cm2 wound area, eliciting a median wound size reduction of 63% (range, 32–100%) at 12 weeks and early relief of pain. Conclusions The authors describe here their GMP- and European Pharmacopoeia-compliant production and quality control process, report on a pre-clinical dose selection study and present the first in-human results. Together, these data substantiate the idea that ABCB5+ MSCs manufactured as ATMPs could deliver a clinically relevant wound closure strategy for patients with chronic therapy-resistant wounds.

Racional - Os carcinomas papilíferos são os mais prevalentes e menos agressivos de tireoide (CPT). Em alguns casos, o diagnóstico é duvidoso e o prognóstico ruim. A busca de biomarcadores teciduais que permitam assegurar tanto o diagnóstico para casos indeterminados, quanto o prognóstico, identificando os casos de maior agressividade, têm sido estudadas nas últimas décadas. Objetivo: Analisar a ciclina D1 nos CPT e nos bócios multinodulares (BMN) e verificar a correlação da marcação com as características clinicopatológicas. Métodos: Foram selecionados 118 tecidos de pacientes adultos submetidos àa tireoidectomia por CPT e 40 BMN como grupo controle. Realizou-se imunocoloração tecidual com ciclina D1 com subsequente análise imunoistoquímica em ambos grupos, avaliando-se a expressão do marcador (intensidade e distribuição). No grupo dos CPT os dados da imunocoloração foram também cruzados com os dados clinicopatológicos. Resultados: A maioria (93,3%) expressou a coloração da ciclina D1 com intensidades variadas (fraca, moderada e forte) e distribuição predominantemente difusa (71,2%). O grupo controle dos BMN, expressou coloração para ciclina D1 em 57,5%, com intensidade fraca (47,5%) e distribuição esparsa (37,5%). A diferença entre os grupos (estudo e controle) foi estatisticamente significante (p

Introduction Clinical studies have indicated a relationship between diabetic nephropathy (DN) and the incidence and prevalence of renal cell carcinoma (RCC). However, the mechanism linking diabetic nephropathy and renal cell carcinoma has not yet to be identified. Methods In this study, a total of 42 male Sprague Dawley (SD) rats were randomly assigned to a DN group (n=35) and a control group (n=7). All animals in the DN group were unilaterally nephrectomized and treated with streptozotocin with the development of blood glucose levels >16.7mmol/L and dominant proteinuria and were compared to controls without such changes. Histopathologic alterations in the kidneys were examined by HE staining and Ki-67 immunohistochemistry. Differentially expressed genes were identified and validated by RNA-seq and PCR. Results As the results, except for two rats that failed to develop the DN model and were excluded from the analysis, 33 rats in the DN group with overt signs of DN demonstrated significantly higher food and water intake, urine production, and urine protein and urinary protein/creatinine ratio than controls. Overall, 15.2% (n=5/33) of DN animals developed RCC while none tumors were observed in the control group (n=0/7). RNA-seq analysis in these animals indicated different TRPV5 gene expression and calcium pathway expression in DN animals with developing tumors, when compared with animals with no obvious tumors. In addition, DN animals diagnosed with RCC showed increased expression of GLUT2 and c-met, when compared to controls and DN animals without tumors. Discussion In conclusion, the disordered calcium metabolism, especially disturbed TRPV5 mediated Ca2+ signal, may have been related to the development of RCC in DN rats. Further studies related to the detailed mechanism are still needed.

A significant number of chronic venous ulcers (CVUs) fail to heal despite guideline-conform standards of care. Skin-derived ABCB5+ mesenchymal stem cells can dampen the sustained IL-1β‒driven inflammation present in chronic wounds. On the basis of their wound healing‒facilitating effects in a mouse CVU model and an autologous first-in-human study, ABCB5+ mesenchymal stem cells have emerged as a potential candidate for cell-based advanced therapy of nonhealing CVUs. In this interventional, multicenter, single-arm, phase I/IIa clinical trial, subjects whose CVUs had emerged as standard therapy resistant received one or two topical applications of 1 × 106 allogeneic ABCB5+ mesenchymal stem cells per cm2 wound area, in addition to standard treatment. Of 83 treatment-emergent adverse events, only three were judged related to the cell product; they were mild or moderate and recovered without sequelae. Wound size markedly decreased from baseline to week 12, resulting in a median wound size reduction of 76% (full analysis set, n = 31), 78% (per-protocol set, n = 27), and 87% (subset of responders, n = 21). In conclusion, the study treatment was well-tolerated and safe. The treatment elicited a profound wound size reduction within 12 weeks, identifying ABCB5+ mesenchymal stem cells as a potential candidate for adjunctive therapy of otherwise incurable CVUs. These results justify the conduct of a larger, randomized, controlled trial to confirm clinical efficacy.

Clear cell renal cell carcinoma (ccRCC) is the most lethal form of kidney cancer and effective treatment regimens are yet to be established. Tyrosine kinase inhibitors (TKI) have widely been used as ccRCC therapeutics, but their efficacy is limited due to accompanying resistance mechanisms. Previous studies have provided substantial evidence for crosstalk between cAMP and the MAPK/ERK signaling pathway. Low levels of intracellular cAMP have been found in several human malignancies and some data suggest that elevation of cAMP expression can be achieved by phosphodiesterase 4 (PDE4) inhibition, resulting in cell growth arrest and/or cell death. The effects of crosstalk between cAMP and the MAPK/ERK pathway on the development progression in ccRCR, however, remain to be fully understood. In this study, we sought to explore the involvement of PDE4 in ccRCC and to assess its potential as a target for therapeutic intervention. We demonstrated that PDE4D is the predominant subtype of PDE4 expressed in healthy and cancerous renal cell lines, particularly in metastatic Caki-1 cells. We generated a CRISPR/Cas9-mediated PDE4D-KO Caki-1 cell model and showed that PDE4D depletion reduced cell proliferation and recovered cAMP expression in these cells. PDE4D-KO and/or PDE4 inhibition with the FDA approved PDE4 inhibitor, roflumilast, also attenuated MAPK/ERK signaling in a CRAF-dependent manner. Most interestingly, we showed that PDE4D-KO enhanced the effectiveness of the TKI, sorafenib, to stunt cell survival. In conclusion, we provide preliminary evidence of PDE4 involvement in ccRCC and suggest a rationale for dual tyrosine kinase/PDE4D targeting in patients with CRAF-dependent MAPK activation.

A) CD133+ cytoplasmic B) AXL+ combined C) c-MYC+ nuclear, Background: CD133 and AXL have been described as cancer stem cell markers, and c-MYC as a key regulatory cellular mechanism in colorectal cancer (CRC). Aim: Evaluate the prognostic role of the biomarkers CD133, AXL and c-MYC and their association with clinicopathologic characteristics in colorectal adenocarcinomas and adenomas. Methods: A total of 156 patients with UICC stage I-IV adenocarcinomas (n=122) and adenomas (n=34) were analyzed. Tissue microarrays (TMA) from primary tumors and polyps for CD133, c-MYC and AXL expression were performed and analyzed for their significance with clinicopathologic characteristics. Results: Poorly differentiated adenocarcinomas and disease progression were independent risk factors for poor overall survival. The median overall survival time was 30 months. Positive CD133 expression (35.9% of all cases), particularly of right-sided CRCs (44.8% of the CD133+ cases), was negatively correlated with death in the univariate analysis, which did not reach significance in the multivariate analysis. c-MYC (15.4% of all cases) was predominantly expressed in advanced-stage patients with distant (non-pulmonary/non-hepatic) metastasis. AXL expression was found only occasionally, and predominantly dominated in adenomas, with less penetrance in high-grade dysplasia. Conclusions: CD133 expression was not associated with inferior overall survival in CRC. While AXL showed inconclusive results, c-MYC expression in primary CRCs was associated with distant metastasis.

SUMMARYSignal transducer and activator of transcription 3 (STAT3) is a key transcription factor implicated in the pathogenesis of kidney fibrosis. Although tubular Stat3 deletion in tubular epithelial cells is known to protect mice from kidney fibrosis, the exact function of STAT3 in stromal cells remains unknown. We utilized stromal-cell Stat3 knock-out (KO) mice, CRISPR and pharmacologic activators and inhibitors of STAT3 to investigate its function in pericyte-like cells. STAT3 is phosphorylated in tubular epithelial cells in acute kidney injury whereas its activation expanded to interstitial cells in chronic kidney disease in mice and humans. Stromal cell-specific deletion of Stat3 protects mice from folic acid- and aristolochic acid-induced kidney fibrosis. Mechanistically, STAT3 directly regulates the inflammatory pathway, differentiation of pericytes into myofibroblasts. Specifically, STAT3 activation leads to an increase in migration and profibrotic signaling in genome-edited pericyte-like cells, 10T1/2. Conversely, Stat3 KO or blocking STAT3 function inhibits detachment, spreading, migration, and profibrotic signaling. Furthermore, STAT3 binds to Collagen1a1 promoter of fibrotic mouse kidneys and in pericyte-like cells. Together, our study identifies a previously unknown function of STAT3 in stromal cells that promotes kidney fibrosis and may have therapeutic value in fibrotic kidney disease.Graphical Abstract

Background. Coronavirus disease 2019 (COVID-19) causes psychological distress and can have a negative impact on the general mental health and rehabilitation in affected patients under currently implemented isolation guidelines. Auricular point pressure (APP) as well-established technique in traditional Chinese medicine may help to relieve sleep disturbance and anxiety in COVID-19 patients. Methods. During the early phase of the epidemic/pandemic, patients were enrolled in this study (02/2020 until 03/2020 n = 84). They were strictly isolated on specific wards at the Hubei Provincial Hospital of Integrated Chinese and Western Medicine in Hubei. The retrospective cohort study design included two groups. Group A patients were treated with an auricular point pressure (APP) in addition to standard intensive care medicine while Group B participants (No-APP) received routine nursing measures alone. Treatment outcome was measured using the St. Mary’s Hospital Sleep Questionnaire (SMH) Score and the 7-Item Generalized Anxiety Disorder Scale (GAD-7). Both scores were measured in each patient at baseline and on the discharge day. Results. The SMH score and sleep status changed in APP patients at the end of the treatment period when compared with No-APP patients ( P < 0.01 ). APP-treated patients demonstrated lower GAD-7 scores than No-APP controls ( P < 0.01 ). Further, no significant differences in safety or adverse events between the APP and No-APP groups were observed. Conclusion. The results from our snapshot study during the early phase of the SARS-CoV-2 epidemic/pandemic suggest that auricular point pressure could be a simple and effective tool to relieve insomnia and situational anxiety in hospitalized patients suffering from COVID-19 and kept under disconcerting conditions of isolation.

Expression of CD133 and ABCB5 is associated with tumor aggressiveness, but evidence in papillary thyroid cancer (PTC) is lacking. We correlated CD133 and ABCB5 expression with pathological characteristics and factors of worse prognosis in PTC. Samples of 119 PTCs and 40 controls (goiters) were distributed in 8 tissue microarray blocks and evaluated with immunohistochemistry using anti-CD133 and anti-ABCB5 antibodies. The expression of each marker alone and combined was analyzed against pathological characteristics and factors of worse prognosis in PTC. Expression of CD133 alone (19 tumors, 16.0%) was more frequent in patients with versus without lymph node metastases (P=0.024). Expression of ABCB5 alone (n=95, 83.3%) was associated with larger tumor size (P=0.045). CD133-ABCB5 coexpression was not associated with pathological characteristics or factors of worse prognosis in PTC.

OPN ABCB5, Background: Studies with biomarkers in TMA (tissue microarray) have been showing important results regarding its expression in colon cancer. Aim: Correlate the expression profile of the OPN and ABCB5 biomarkers with the epidemiological and clinicopathological characteristics of the patients, the impact on the progression of the disease and the death. Method: A total of 122 CRC patients who underwent surgical resection, immunomarking and their relationship with progression and death events were evaluated. Result: The average age was 61.9 (±13.4) years. The cases were distributed in 42 (35.9%) in the ascending/transverse colon, 31 (26.5%) in the sigmoid, 27 in the rectum (23.1%), 17 (14.5%) in the descending colon. Most patients had advanced disease (stages III and IV) in 74 cases (60.9%). There was a predominance of moderately differentiated tumors in 101 samples (82.8%); despite this, the poorly differentiated subtype proved to be an independent risk factor for death in 70%. Metastasis to the liver proved to be an independent risk factor for death in 75% (18/24), as well as patients with primary rectal tumors in 81.5% (22/27). Conclusion: The immunohistochemical expression of the OPN and ABCB5 markers was not associated with epidemiological and clinicopathological characteristics. Regarding the progression of disease and death, it was not possible to observe a correspondence relationship with the evaluated markers.

ABC member B5 (ABCB5) mediates multidrug resistance (MDR) in diverse malignancies and confers clinically relevant 5-fluorouracil resistance to CD133-expressing cancer stem cells in human colorectal cancer (CRC). Because of its recently identified roles in normal stem cell maintenance, we hypothesized that ABCB5 might also serve MDR-independent functions in CRC. Here, in a prospective clinical study of 142 CRC patients, we found that ABCB5 mRNA transcripts previously reported not to be significantly expressed in healthy peripheral blood mononuclear cells are significantly enriched in patient peripheral blood specimens compared with non-CRC controls and correlate with CRC disease progression. In human-to-mouse CRC tumor xenotransplantation models that exhibited circulating tumor mRNA, we observed that cancer-specific ABCB5 knockdown significantly reduced detection of these transcripts, suggesting that the knockdown inhibited tumor invasiveness. Mechanistically, this effect was associated with inhibition of expression and downstream signaling of AXL receptor tyrosine kinase (AXL), a proinvasive molecule herein shown to be produced by ABCB5-positive CRC cells. Importantly, rescue of AXL expression in ABCB5-knockdown CRC tumor cells restored tumor-specific transcript detection in the peripheral blood of xenograft recipients, indicating that ABCB5 regulates CRC invasiveness, at least in part, by enhancing AXL signaling. Our results implicate ABCB5 as a critical determinant of CRC invasiveness and suggest that ABCB5 blockade might represent a strategy in CRC therapy, even independently of ABCB5's function as an MDR mediator.

Generally regarded as commensal bacteria, the pathogenicity of Ureaplasma has often been considered low. Controversy remains concerning the clinical relevance of Ureaplasma infection in the pathogenesis of inflammation-related morbidities. Recently, we demonstrated Ureaplasma-driven pro-inflammatory cytokine responses in human monocytes in vitro. We hypothesized that Ureaplasma may induce further inflammatory mediators. Using qRT-PCR and multi-analyte immunoassay, we assessed the expression of granulocyte-colony stimulating factor (G-CSF), vascular endothelial growth factor (VEGF), intercellular adhesion molecule 1 (ICAM-1) and vascular cell adhesion molecule 1 (VCAM-1) in term neonatal and adult monocytes exposed to Ureaplasma urealyticum serovar 8 (Uu8) and U. parvum serovar 3 (Up3). Ureaplasma significantly induced VEGF mRNA in neonatal (Up3: p 0.05, versus broth control) and adult monocytes (Uu8: p 0.05) as well as ICAM-1 mRNA in neonatal cells (p 0.05 each). As far as protein expression was concerned, Up3 stimulated VEGF release in both monocyte subsets (p 0.01) and enhanced secretion of ICAM-1 protein in neonatal monocytes (p 0.05). In adult cells, ICAM-1 protein release was increased upon exposure to both isolates (Uu8: p 0.05, Up3: p 0.01). Ureaplasma-induced responses did not significantly differ from corresponding levels mediated by E. coli lipopolysaccharide (LPS). The stimulatory effects were dose-dependent. Ureaplasma infection, on the contrary, did not affect G-CSF and VCAM-1 expression. Of note, co-infection of LPS-primed neonatal monocytes with Ureaplasma enhanced LPS-induced ICAM-1 release (Uu8: p 0.05). Our results confirm Ureaplasma-driven pro-inflammatory activation of human monocytes in vitro, demonstrating a differential modulation of growth factors and cell adhesion molecules, that might promote unbalanced monocyte responses and adverse immunomodulation.

Critical chronic ischemia in patients with underlying arterial occlusive disease requires vascular reconstructive surgery. The limited supply of suitable small-diameter autologous vascular grafts in many patients and obvious disadvantages of synthetic bypass material demand the development of clinically usable tissue-engineered blood vessel substitutes. Despite substantial progress in the field over the last two decades, their implementation into the clinical routine has been challenging. The limited replicative life span of human adult vascular cells and their slow rate of collagenous matrix production in vitro have posed important problems in the development of mechanically robust and biologically functional engineered grafts. With recent advances in stem cell research, new cell sources for vascular tissue engineering have become available. In particular, the discovery of human induced pluripotent stem (iPS) cells derived from adult differentiated cells, as well as of human multipotent adult mesenchymal stem cells without gene modification requirements and related safety concerns, may advance the development of novel autologous cell-based tissue engineering approaches. Here we discuss recent developments in the field of vascular progenitor cells and opportunities and challenges for the clinical translation of stem cell-engineered vascular tissue substitutes.

Clear cell renal cell carcinoma (ccRCC) is the most lethal form of kidney cancer. Small molecule Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitors are widely used but are not curative and various resistant mechanisms have been described. Previous studies have indicated a crosstalk between the cAMP pathway and the MAPK pathway, and the elevation of cAMP levels by Phosphodiesterase 4 (PDE4) inhibition can result in growth arrest and/or cell death. In this study we focused on the effects of PDE4 in ccRCC. We showed for the first time that PDE4D is the dominant subtype of PDE4 in kidney. PDE4D depletion in ccRCC, Caki-1 cells, using CRISPR Knock Out (KO) enhanced sensitivity of Tyrosine Kinase Inhibitor (TKI), sorafenib and increased cytotoxicity. We also showed synergistic effects of PDE4 inhibitor, roflumilast and sorafenib, in increasing cytotoxicity of ccRCC in the absence of PDE4D. Our results further demonstrated that PDE4D deficiency increased intracellular cAMP levels and resulted in downregulation of MAPK but not PI3K/AKT signaling in a CRAF dependent manners. In conclusion, we provide a preclinical rationale for dual PDE4/VEGFR inhibition in patients with ccRCC. While the MAPK signaling pathway is activated in ccRCC, dual inhibitions may improve the anti-tumor effects in patients with proven CRAF signaling activation. Citation Format: Minghua Cao, Amrandra K. Ajay, Martin Gasser, Li-LI Hsiao, Ana Maria Waaga-Gasser. Phosphodiesterase 4D depletion enhances anti-tumor effects of tyrosine kinase inhibitor in renal cell carcinoma involving CRAF-ERK pathway [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 967.

Pancreatic ductal adenocarcinoma (PDAC) is one of the deadliest types of cancer with 5-year survival rates between 5-8%. Chronic inflammation of the pancreas and pancreatitis is thought to be a risk factor in PDAC. The aim of this study was to elucidate characteristic pro-inflammatory cytokines and chemokines including IL-17 profiles in human pancreatic cancer. A total of 186 individuals with confirmed PDAC (n=116), chronic pancreatitis (n=32), and healthy volunteers (n=38) were included in the study. The histological stage of the tumor was determined according to the Union for International Cancer Control (UICC) TNM staging system. Tumors were evaluated for stage and differentiation grade. Data concerning age, gender, level of wall infiltration, lymph node metastasis, and distant metastases were collected in a database. Additional clinical characteristics necessary for statistical analysis of the data from the study population were collected from the Tumor Registry. Inflammation-related cytokines and chemokines in IL-17 pathway among the patients were analyzed from serum obtained pre-operatively and compared with healthy controls. Moreover, the KEGG PATHWAY, a collection of manually drawn pathway maps on molecular interaction, reaction and relation networks was used for IL-17 pathway analysis. Non-parametric tests and correlation tests were utilized to compare the factors among three groups for statistical analysis. Pancreatitis patients showed highest expression in inflammatory cytokines and chemokine panels while those with PDAC showed different profiles. Pro-inflammatory cytokines including IL-5, IL-6, CXCL8, CCL2, TNF-alpha, and IFN-gamma revealed higher expression in PDAC patients than healthy volunteers (P Citation Format: Yueming Luo, Martin Gasser, Amrendra Ajay, Li-LI Hsiao, Ana Maria Waaga-Gasser. Pro-inflammatory serum marker profiles that lack upregulated IL-17 are characteristic for pancreatic cancer and require for further anti-tumor immune response and strategies [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 1758.

Mucormycoses are life-threatening infections in immunocompromised patients. This study characterizes the response of human mononuclear cells to different Mucorales and Ascomycota. PBMC, monocytes, and monocyte derived dendritic cells (moDCs) from healthy donors were stimulated with resting and germinated stages of Mucorales and Ascomycota. Cytokine response and expression of activation markers were studied. Both inactivated germ tubes and resting spores of Rhizopus arrhizus and other human pathogenic Mucorales species significantly stimulated mRNA synthesis and secretion of proinflammatory cytokines. Moreover, R. arrhizus spores induced the upregulation of co-stimulatory molecules on moDCs and a specific T-helper cell response. Removal of rodlet hydrophobins by hydrofluoric acid treatment of A. fumigatus conidia resulted in enhanced immunogenicity, whereas the cytokine response of PBMCs to dormant R. arrhizus spores was not influenced by hydrofluoric acid. Scanning electron micrographs of Mucorales spores did not exhibit any morphological correlates of rodlet hydrophobins. Taken together, this study revealed striking differences in the response of human mononuclear cells to resting stages of Ascomycota and Mucorales, which may be explained by absence of an immunoprotective hydrophobin layer in Mucorales spores.

Background: Colorectal cancer (CRC) is frequently associated with dysbiosis of the gut microbiome which, together with a compromised gut barrier, can result in perioperative endotoxin leakage into the circulation. Constant local and systemic inflammatory activity is suggested to facilitate metastases formation. Previous studies have pointed to the capacity of a colostrum preparation to neutralize endotoxins within the gastrointestinal tract which could ameliorate associated inflammatory responses and tumor recurrence in affected patients. This study aimed to examine the effects of the colostrum preparation, KMP01D, on the inflammatory activity of patient-derived immune cells. Methods: The effects of KMP01D on pro-/anti-inflammatory cytokine responses and apoptosis were examined ex vivo using immune cells from CRC patients (stages I–IV, n = 48). The expression of CD14, CD68, Toll-like receptor (TLR)4, and insulin-like growth factor (IGF)-1 was also analyzed. Results: KMP01D increased interleukin (IL)-10 and IL-13 anti-inflammatory cytokine expression in patient-derived peripheral blood mononuclear cells (PBMCs). Interestingly, KMP01D also decreased the secretion of IL-1β, IL-6, interferon (IFN)-γ, tumor necrosis factor (TNF)-α, IL-12 inflammatory cytokines, and IGF-1 in these cells. Moreover, CD14 and TLR4 expression involved in endotoxin signaling was downregulated in PBMCs and tumor-derived cells. Apoptosis of immune cells and tumor-derived cells was likewise enhanced with KMP01D. Addition of vitamin D3 as a cofactor demonstrated enhanced anti-inflammatory effects. Conclusions: KMP01D demonstrated beneficial ex vivo effects on inflammatory cytokine responses in PBMCs and enhanced apoptosis of immune cells from CRC patients. In line with previous clinical trials, we present new evidence endorsing KMP01D as a treatment strategy to regulate stage-dependent local and systemic inflammation in CRC patients.

CD137-targeting immune therapy, which activates anti-tumor T effector cell responses, seems to be an attractive concept in clinical oncology. Recent evidence has demonstrated that tumor cells besides T cells and antigen-presenting cells are able to express CD137 and CD137L. Here we aimed to identify CD137/CD137L expression in established colon cancer cell lines and primary tumors (UICC stages I-IV) from patients with documented long-term follow-up. CD137/CD137L expression was highly upregulated in early to late-stage tumors while the inverse was observed in patient-derived peripheral blood mononuclear cells. High CD137L expression within primary tumors was mediated by tumor cells and significantly correlated with the occurrence of distant metastases and shortened survival in advanced stages of disease (UICC stage IV). Interestingly, induced tumor cell signaling via CD137L on its surface in vitro resulted in dual effects: (i) reduced tumor cell proliferation suggesting inhibitory signaling in all investigated cancers and (ii) increased epithelial-to-mesenchymal transition signaling events. Taken together CD137/CD137L expression was stage-dependently upregulated with shortened survival in patients with highly CD137L-expressing tumors. Our clinical and experimental data suggest that colon cancer cells predominantly express CD137L and thereby have negative impact on overall survival through a process of reverse signaling. Beside agonistic CD137 antibody therapy to foster T effector cell responses, CD137L-mediated intervention strategies may become instrumental to circumvent relapsed tumor growth through induced epithelial-to-mesenchymal transition and consecutive metastases formation.

With cellular products being on the front run there is a rising demand for non-animal-based test platforms to predict, study and treat undesired immunity. Here, we generated human organotypic skin models from human biopsies isolating and expanding keratinocytes, fibroblasts and microvascular endothelial cells finally allowing to seed these components on a collagen matrix or a biological vascularized scaffold matrix in a bioreactor. Afterwards, we were able to induce inflammation-based tissue damage by pre-stimulated mismatched allogeneic lymphocytes and/or inflammatory cytokine containing supernatants histomorphologically mimicking severe graft versus host disease (GvHD) of the skin. The effects could be prevented by the addition of immunosuppressants to the models. Consequently, these models would harbor a promising potential to serve as a test platform for the prediction, prevention and treatment of GvHD. This would also allow functional studies of immune effectors and suppressors including but not limited to allodepleted lymphocytes, gamma-delta T cells, regulatory T cells and mesenchymal stromal cells which would otherwise be limited to animal models. Thus, the current test platform developed with the limitation given that no professional APC are in place could highly reduce animal testing for investigation of novel immune therapies.

Background: Controversy remains concerning the impact of Ureaplasma on preterm neonatal morbidity.Methods: Prospective single-center study in very low birth weight infants