Search

Background Time spent in daily activities (sleep, sedentary behaviour and physical activity) has important consequences for health and wellbeing. The amount of time spent varies from day to day, yet little is known about the temporal nature of daily activity patterns in adults. The aim of this review is to identify the annual rhythms of daily activity behaviours in healthy adults and explore what temporal factors appear to influence these rhythms. Methods Six online databases were searched for cohort studies exploring within-year temporal patterns (e.g. season effects, vacation, cultural festivals) in sleep, sedentary behaviour or physical activity in healthy 18 to 65-year-old adults. Screening, data extraction, and risk of bias scoring were performed in duplicate. Extracted data was presented as mean daily minutes of each activity type, with transformations performed as needed. Where possible, meta-analyses were performed using random effect models to calculate standardised mean differences (SMD). Results Of the 7009 articles identified, 17 studies were included. Studies were published between 2003 and 2019, representing 14 countries and 1951 participants, addressing variation in daily activities across season (n = 11), Ramadan (n = 4), vacation (n = 1) and daylight savings time transitions (n = 1). Meta-analyses suggested evidence of seasonal variation in activity patterns, with sleep highest in autumn (+ 12 min); sedentary behaviour highest in winter (+ 19 min); light physical activity highest in summer (+ 19 min); and moderate-to-vigorous physical activity highest in summer (+ 2 min) when compared to the yearly mean. These trends were significant for light physical activity in winter (SMD = − 0.03, 95% CI − 0.58 to − 0.01, P = 0.04). Sleep appeared 64 min less during, compared to outside Ramadan (non-significant). Narrative analyses for the impact of vacation and daylight savings suggested that light physical activity is higher during vacation and that sleep increases after the spring daylight savings transition, and decreases after the autumn transition. Conclusions Research into temporal patterns in activity behaviours is scarce. Existing evidence suggests that seasonal changes and periodic changes to usual routine, such as observing religious events, may influence activity behaviours across the year. Further research measuring 24-h time use and exploring a wider variety of temporal factors is needed.

[Image: see text] A combination of focused library and virtual screening, hit expansion, and rational design has resulted in the development of a series of inhibitors of RET(V804M) kinase, the anticipated drug-resistant mutant of RET kinase. These agents do not inhibit the wild type (wt) isoforms of RET or KDR and therefore offer a potential adjunct to RET inhibitors currently undergoing clinical evaluation.

Background: Few studies have investigated associations between academic achievement and meeting recommendations from the 24-h movement guidelines. The specific guidelines associated with the most benefit academic achievement are unknown. Utilizing both self-report and objective movement data, this study examined associations between academic achievement and meeting individual recommendations and combinations of recommendations from the 24-h movement guidelines (sleep, physical activity, and screen time).Methods: Data from CheckPoint, a cross-sectional study nested between Waves 6 and 7 of the Longitudinal Study of Australian Children, were used. Movement behaviors were measured using 24-h wrist-worn accelerometry (GENEActiv (Activinsights, Kimbolton, UK)) and were self-reported by children using the Multimedia Activity Recall for Children and Adolescents. Academic achievement was measured using a nationally administered standardized test in literacy and numeracy. Analysis of covariance, with t tests with sequential Bonferroni adjustments, was used to compare academic achievement with all possible combinations of meeting recommendations, adjusting for demographic confounders. Two models were considered: guideline compliance assessed by self-report (n = 1270, mean age = 11.99 years, 52% male) and by accelerometry (for moderate-to vigorous-intensity physical activity (MVPA) and sleep)) and self-report (screen time) in combination (n = 927, mean age = 11.97 years, 52% male).Results: Literacy (F (7, 1258) = 3.08, p = 0.003) and numeracy achievement (F (7, 1258) = 2.92, p = 0.005) significantly differed based on guideline compliance (self-report only). When assessed by self-report, children who met all guidelines (t (334) = -4.05, p = 0.0001) or met the screen time and sleep guidelines in combination (t (125) = -5.02, p < 0.001) had superior literacy achievement. Meeting the MVPA guideline in any combination was associated with higher numeracy scores (p < 0.05). No differences in academic achievement were observed when guideline compliance was assessed by accelerometry.Conclusion: The findings suggest that limiting recreational screen time is important for literacy achievement and that encouraging compliance with the MVPA guideline is important for numeracy achievement. Refereed/Peer-reviewed

Objectives To assess the feasibility and efficacy of a 6-week pilot active break program (ACTI-BREAK) on academic achievement, classroom behaviour and physical activity. Design Pilot cluster randomised controlled trial. Methods 374 children in Year 3 and 4 (74% response) were recruited from six schools across Melbourne, Australia. Schools were randomised to the ACTI-BREAK intervention or usual teaching practice. The intervention involved teachers incorporating 3 × 5 min active breaks into their classroom routine daily. Academic achievement was assessed using 1-min tests in reading and mathematics; classroom behaviour at the individual and whole class level was observed by teachers; and physical activity levels were assessed using accelerometers. Multilevel mixed effects linear regression models were conducted using intention to treat (ITT) and per protocol (PP) analyses. Results Significant intervention effects were found for classroom behaviour at the individual level (ITT B = 16.17; 95% CI: 6.58, 25.76); effects were stronger for boys (B = 21.42; 95% CI: 10.34, 32.49) than girls (B = 12.23; 95% CI: 1.52, 22.92). No effect was found for classroom behaviour at the whole class level, reading, math or physical activity. PP findings were similar. Conclusions Implementing active breaks during class time may improve classroom behaviour, particularly for boys. There was no evidence to suggest that implementing active breaks had any adverse effect on academic achievement or classroom behaviour, which may encourage classroom teachers to incorporate active breaks into their routine.

Background Previous research has examined associations between individual activity behaviors and academic achievement. Yet activity behaviors should be analyzed together because they are codependent parts of the 24-hour day. Aims This study aims to explore the associations between all daily activity behaviors (sleep, sedentary time, light physical activity [LPA], and moderate-to-vigorous physical activity [MVPA]) and academic achievement using compositional data analysis. Method Participants for this study were drawn from two cohorts: the Australian arm of the cross-sectional International Study of Childhood Obesity, Lifestyle and the Environment ( n = 452; mean age 10.7 years ( SD = 0.4); 54% female) and CheckPoint ( n = 1278; mean age 12 years [ SD = 0.4]; 50% female), a cross-sectional study nested between Waves 6 and 7 of the Longitudinal Study of Australian Children. Objective daily activity behavior data (sleep, sedentary time, LPA, and MVPA) were collected using 8-day, 24-hour accelerometry. Academic achievement was assessed using a nationally administered standardized test in literacy (spelling, grammar and punctuation, writing and reading) and numeracy. Compositional models (adjusted for age, sex, socioeconomic position, and pubertal development) regressed academic scores against isometric log ratios of activity behaviors. We used the models to estimate academic achievement for observed daily activity mixes. Estimated outcomes were plotted against time spent in each individual activity domain, and loess curves were fitted. Discussion and conclusion In two different cohorts using two different accelerometers, lower LPA was related to better numeracy and literacy and higher sedentary time to better literacy (relative to time spent in other domains). Discussion and conclusion. LPA likely “drains time” from other movement behaviors, which are beneficial for academic achievement.

Background Emerging evidence suggests that children become fatter and less fit over the summer holidays but get leaner and fitter during the in-school period. This could be due to differences in diet and time use between these distinct periods. Few studies have tracked diet and time use across the summer holidays. This study will measure rates of change in fatness and fitness of children, initially in Grade 4 (age 9 years) across three successive years and relate these changes to changes in diet and time use between in-school and summer holiday periods. Methods Grade 4 Children attending Australian Government, Catholic and Independent schools in the Adelaide metropolitan area will be invited to participate, with the aim of recruiting 300 students in total. Diet will be reported by parents using the Automated Self-Administered 24-h Dietary Assessment Tool. Time use will be measured using 24-h wrist-worn accelerometry (GENEActiv) and self-reported by children using the Multimedia Activity Recall for Children and Adults (e.g. chores, reading, sport). Measurement of diet and time use will occur at the beginning (Term 1) and end (Term 4) of each school year and during the summer holiday period. Fitness (20-m shuttle run and standing broad jump) and fatness (body mass index z-score, waist circumference, %body fat) will be measured at the beginning and end of each school year. Differences in rates of change in fitness and fatness during in-school and summer holiday periods will be calculated using model parameter estimate contrasts from linear mixed effects model. Model parameter estimate contrasts will be used to calculate differences in rates of change in outcomes by socioeconomic position (SEP), sex and weight status. Differences in rates of change of outcomes will be regressed against differences between in-school and summer holiday period diet and time use, using compositional data analysis. Analyses will adjust for age, sex, SEP, parenting style, weight status, and pubertal status, where appropriate. Discussion Findings from this project may inform new, potent avenues for intervention efforts aimed at addressing childhood fitness and fatness. Interventions focused on the home environment, or alternatively extension of the school environment may be warranted. Trial registration Australia New Zealand Clinical Trials Registry, identifier ACTRN12618002008202. Retrospectively registered on 14 December 2018.

Background Active breaks in the classroom have been shown to be effective for increasing children’s physical activity, while simultaneously improving classroom behaviour outcomes. However, there is limited evidence on the feasibility and fidelity of these programs outside of the research context. The purpose of this study was to conduct a process evaluation to explore factors associated with feasibility and fidelity of a classroom active break (ACTI-BREAK) program designed to improve classroom behaviour and physical activity outcomes for children in primary (elementary) school Years 3 and 4. Methods Six schools (3 intervention; 3 control) and 374 children (74% response) were included in the ACTI-BREAK pilot cluster randomised controlled trial. The intervention involved teachers implementing 3 × 5-minute moderate-intensity ACTI-BREAKS into their classroom routines, daily. This study focuses on the responses of students (n = 138) and their teachers (n = 7) who participated in the ACTI-BREAK intervention group. Intervention fidelity was assessed by number of ACTI-BREAKS completed per class per day; minutes spent in moderate-intensity physical activity (accelerometry) per ACTI-BREAK; change in physical activity from baseline to mid- and end- intervention. Intervention feasibility was explored through telephone interviews (teachers), questionnaires and focus groups (students), and teacher observations of acute effects on classroom behaviour. Qualitative data were analysed using thematic analyses; acute effects on classroom behaviour and change in physical activity were explored using paired t-tests; questionnaire data were described as frequencies. Results Teachers implemented two ACTI-BREAKS/day on average, mostly of light-intensity physical activity. Physical activity increased from baseline to mid-, but not baseline to end-intervention; classroom behaviour improved immediately following ACTI-BREAKS. Barriers to implementation included ability for students to return to task and scheduling. Facilitators included ease of implementation, flexible delivery options and student enjoyment. Students were largely satisfied with the program and enjoyed ACTI-BREAKS that incorporated choice, imagination and challenge but did not enjoy ACTI-BREAKS that evoked silliness or were perceived as too difficult and some did not like doing ACTI-BREAKS in the confined space of their classroom. Conclusions Results indicated the ACTI-BREAK program was acceptable for students and feasible for teachers, however, some minor modifications in terms of required frequency and intensity could improve fidelity. Trial registration Australia New Zealand Clinical Trials Registry (ACTRN12617000602325). Retrospectively registered on 27 April 2017.

Given the short- and long-term health implications associated with overweight and obesity plus the likelihood of overweight or obesity to continue into adulthood, addressing the causes of overweight and obesity in childhood is a significant public health concern. One underlying cause of overweight and obesity is insufficient physical activity. The Department of Health and Aging recommends children engage in at least 60 minutes of moderate to vigorous physical activity (MVPA) per day; however, these recommendations are met less frequently with increasing age, and girls less often meet these recommendations than boys. School lunch times have been identified as an ideal time for maximizing children’s physical activity (PA), but studies have shown variable levels of PA among children during this time and research indicates that during school lunch times, girls are consistently less active than boys. Understanding influences on girls’ participation in PA during this time may help to increase levels of PA for this demographic. Two South Australian schools, one government and one independent, were included in the sample. Four focus groups (three or four participants per group: total 13 participants) focusing on girls’ perceptions of PA during the lunch break were conducted. Transcripts and field notes were analyzed using a social constructionist framework and thematic content analysis. The expectation to participate in activities considered “gender appropriate”, maturation, and bullying/teasing were identified as explicit barriers to participation in lunch time play. Other important barriers included a “girls’” school uniform and feelings of inadequate competency. The ability to renegotiate gender stereotypes, a unisex school uniform, and perceived high competency were important facilitators of lunch time PA. Low levels of lunch time PA evident in many young adolescent girls may be due to many complex social factors. Therefore, these barriers may need to be addressed before any environmental interventions are likely to be effective. Refereed/Peer-reviewed

Background: Physical activity is associated with many physical and mental health benefits, however many children do not meet the national physical activity guidelines. While schools provide an ideal setting to promote children's physical activity, adding physical activity to the school day can be difficult given time constraints often imposed by competing key learning areas. Classroom-based physical activity may provide an opportunity to increase school-based physical activity while concurrently improving academic-related outcomes. The primary aim of this systematic review and meta-analysis was to evaluate the impact of classroom-based physical activity interventions on academic-related outcomes. A secondary aim was to evaluate the impact of these lessons on physical activity levels over the study duration. Methods: A systematic search of electronic databases (PubMed, ERIC, SPORTDiscus, PsycINFO) was performed in January 2016and updated in January 2017. Studies that investigated the association between classroom-based physical activity interventions and academic-related outcomes in primary (elementary) school-aged children were included. Meta-analyses were conducted in Review Manager, with effect sizes calculated separately for each outcome assessed. Results: Thirty-nine articles met the inclusion criteria for the review, and 16 provided sufficient data and appropriate design for inclusion in the meta-analyses. Studies investigated a range of academic-related outcomes including classroom behaviour (e.g. on-task behaviour), cognitive functions (e.g. executive function), and academic achievement (e.g. standardised test scores). Results of the meta-analyses showed classroom-based physical activity had a positive effect on improving on-task and reducing off-task classroom behaviour (standardised mean difference=0.60 (95% CI: 0.20,1.00)), and led to improvements in academic achievement when a progress monitoring tool was used (standardised mean difference=1.03 (95% CI: 0.22,1.84)). However, no effect was found for cognitive functions (standardised mean difference=0.33 (95% CI: -0.11,0.77)) or physical activity (standardised mean difference=0.40 (95% CI: -1.15,0.95)). Conclusions: Results suggest classroom-based physical activity may have a positive impact on academic-related outcomes. However, it is not possible to draw definitive conclusions due to the level of heterogeneity in intervention components and academic-related outcomes assessed. Future studies should consider the intervention period when selecting academic-related outcome measures, and use an objective measure of physical activity to determine intervention fidelity and effects on overall physical activity levels. Refereed/Peer-reviewed

Background Levels of overall physical activity have been shown to decline across childhood. Schools are considered ideal settings to promote physical activity as children spend a large amount of their waking hours at school. Time-efficient physical activity strategies that demonstrate a positive impact on academic-related outcomes are needed to enable physical activity to be prioritised in the school day. The ACTI-BREAK programme requires classroom teachers to integrate active breaks; 5-min bursts of moderate-intensity physical activity into their classroom routine. Active breaks have been shown to be effective in improving academic-related outcomes, a potentially appealing aspect for teachers and schools. The primary aim of this study is to assess the feasibility and potential efficacy of the ACTI-BREAK programme on children’s academic achievement. Secondary aims are to explore the impact of ACTI-BREAK on children’s on-task behaviour and objectively measured physical activity levels. Methods ACTI-BREAK is a 6-week, classroom-based, physical activity intervention. This pilot trial of the programme will be evaluated using a cluster randomised controlled design. Government primary schools in metropolitan Melbourne, Australia will be invited to participate in the programme in 2017. Randomisation will occur at the school level, with the aim to recruit six schools (three intervention and three control). The ACTI-BREAK programme is theoretically grounded, and was developed with input and guidance from current primary school teachers. Teachers from the intervention schools will receive a 45-min training session and be asked to incorporate ACTI-BREAKS into their classroom routine three times per day for 6 weeks. Intervention support will be provided via assisted delivery. The primary outcomes will be children’s academic achievement in mathematics and reading. Children’s on-task behaviour and school-day physical activity will be assessed as secondary outcomes. Process evaluation will also be carried out. Discussion The ACTI-BREAK programme has been designed to be a time-efficient, feasible and appealing approach to physical activity promotion for schools. This study will assess required teacher time commitment and the potential for the ACTI-BREAK programme to improve academic-related outcomes and school-day physical activity levels with the potential for a full-scale trial in the future. Trial registration Australia New Zealand Clinical Trials Registry, identifier ACTRN12617000602325. Retrospectively registered on 27 April 2017. Electronic supplementary material The online version of this article (doi:10.1186/s13063-017-2163-5) contains supplementary material, which is available to authorized users.

Executive functions (EFs; e.g. working memory, inhibitory control) are mediated by the prefrontal cortex and associated with optimal cognitive and socio-emotional development. This study provides the first concurrent analysis of the relative contributions of maternal EF and caregiving to child EF. A group of children and their mothers (n = 62) completed age-appropriate interaction (10, 24, 36 months) and EF tasks (child: 24, 36, and 48 months). Regression analyses revealed that by 36 months of age, maternal EF and negative caregiving behaviors accounted for unique variance in child EF, above and beyond maternal education and child verbal ability. These findings were confirmed when using an early child EF composite-our most reliable measure of EF - and a similar pattern was found when controlling for stability in child EF. Furthermore, there was evidence that maternal EF had significant indirect effects on changes in child EF through maternal caregiving. At 24 months, EF was associated with maternal EF, but not negative caregiving behaviors. Taken together, these findings suggest that links between negative caregiving and child EF are increasingly manifested during early childhood. Although maternal EF and negative caregiving are related, they provide unique information about the development of child EF. A video abstract of this article can be viewed at http://www.youtube.com/watch?v=NPKXFbbrkps.

IntroductionPhysical activity is positively associated with children's classroom behaviour. However, less is known about how different types of physical activity contribute to these outcomes. This study examines associations between sport participation and classroom behaviour among primary school-aged children.MethodsParents of 568 children aged 9-11 years reported child sport participation and classroom behaviour outcomes (school functioning, inattention, classroom behaviour (fidgetiness), acting without thinking and poor concentration). Sport participation included: duration (hours/week) and type (individual; team; team and individual). Regression analyses assessed associations between sport participation and classroom behaviour outcomes. Analyses adjusted for maternal education, and objectively-measured overall physical activity, and accounted for clustering by recruitment centre. Sex differences in associations were explored as a secondary aim.ResultsIn comparison to children who did not participate in sport, children who participated in sport displayed less inattention/hyperactivity (individual sport: B = -1.00;95%CI:-1.90, -0.00; team sport:-0.88;95%CI:-1.73, -0.03) and less acting without thinking (individual sport: OR = 0.35;95%CI:0.13,0.98), after adjusting for overall physical activity. There were no sex differences in associations.ConclusionsFindings indicated sport participation, one form of physical activity, was associated with less inattention/hyperactivity and acting without thinking, over and above the influence of overall physical activity levels. Parents may consider sport as one way to contribute to their child's overall physical activity levels, although the impact of organised sport on classroom behaviour is modest at best.

The recently discovered enzyme tyrosyl-DNA phosphodiesterase 2 (TDP2) has been implicated in the topoisomerase-mediated repair of DNA damage. In the clinical setting, it has been hypothesized that TDP2 may mediate drug resistance to topoisomerase II (topo II) inhibition by etoposide. Therefore, selective pharmacological inhibition of TDP2 is proposed as a novel approach to overcome intrinsic or acquired resistance to topo II-targeted drug therapy. Following a high-throughput screening (HTS) campaign, toxoflavins and deazaflavins were identified as the first reported sub-micromolar and selective inhibitors of this enzyme. Toxoflavin derivatives appeared to exhibit a clear structure-activity relationship (SAR) for TDP2 enzymatic inhibition. However, we observed a key redox liability of this series, and this, alongside early in vitro drug metabolism and pharmacokinetics (DMPK) issues, precluded further exploration. The deazaflavins were developed from a singleton HTS hit. This series showed distinct SAR and did not display redox activity; however low cell permeability proved to be a challenge.

Topoisomerases regulate DNA topology by the transient cleavage and religation of DNA during transcription and replication. Topoisomerase II (Topo II) poisons such as etoposide can induce abortive DNA strand breaks in which Topo II remains covalently bound to a 5′ DNA strand terminus via a phosphotyrosyl linker. Tyrosyl DNA phosphodiesterase 2 (Tdp2) is a recently discovered human 5′-tyrosyl DNA phosphodiesterase that repairs this topoisomerase-mediated DNA damage, thereby playing a central role in maintaining normal DNA topology in cells. Cellular depletion of Tdp2 has been shown to result in increased susceptibility and sensitivity to Topo II-induced DNA double-strand breaks, thereby revealing Tdp2 as a potentially attractive anticancer target. No drug-like inhibitors of Tdp2 have been identified to date, and assays suitable for high-throughput screening (HTS) have not been widely reported. Here we have identified a new and effective chromogenic substrate for Tdp2 and developed a homogeneous and robust HTS assay. A second novel Tdp2 assay was also developed to cross-validate hit matter identified from an HTS. In addition, a new and specific Tdp2 antibody is described. Together, these new tools will aid in the identification of novel Tdp2 inhibitors and the investigation of the role of Tdp2 in cancer.

Sixty-eight 3-year-old children participated in an investigation of inhibitory control (IC). Child IC was measured using various tasks in order to determine the impact on child performance of manipulating task demands. Performance on a nonverbal IC task, but not performance on more difficult motivational or traditional IC tasks, was explained by medial frontal electroencephalographic activity and by language abilities. Because of the unique relations of nonverbal IC with concurrent developmental measures, and because of its potential to predict later social problems, we conclude that it is important to include nonverbal IC measures in investigative IC batteries in early childhood.

2535 Background: The DNA repair protein O6-methylguanine DNA methyltransferase (MGMT) contributes to cellular resistance to irinotecan (IR) and its metabolite SN-38. In human cancer cell lines MGMT expression correlates with SN-38 sensitivity, inactivation of MGMT enhances cell killing and increasing MGMT expression by transfection increases resistance to IR. This study evaluated the safety, tolerability and pharmacokinetics (PK) and pharmacodynamic (PD) effects of lomeguatrib (LM), an MGMT inactivator, in combination with IR. Methods: Patients with stage 4 colorectal cancer, performance status 0–2 and adequate bone marrow and biochemical function took part in the trial, which followed a standard 3 patient cohort dose escalation design. LM was given daily PO for 5 days, with IR by IVI on day 4 of each 21 day cycle. Starting doses were 10 mg/day LM and 350 mg/m2 IR. Tumor response to treatment was measured by RECIST criteria. Blood was taken for PK & PD measurements in cycle 1. Results: 24 patients (14M/10F; median age 62) were enrolled. The first dose level was not tolerated, with 2 of 3 patients experiencing dose limiting haematological toxicity. The IR dose was decreased to 250 mg/m2 for subsequent cohorts, and the LM dose escalated from 10 to 80 mg/day. With LM 80 mg/day a final 6 patient cohort received 300 mg/m2 IR, establishing this as the maximum tolerated dose. Non-hematological toxicity matched that of single agent IR. No partial responses have been seen amongst 22 evaluable patients. 10 patients had prolonged disease stabilisation, completing all 6 treatment cycles, with another 3 patients still on treatment. There was no PK interaction between the drugs. Conclusion: LM and IR is well tolerated, requiring a modest reduction in the single agent dose of IR. Clinical activity, in this pre-treated population, is modest. PD data on MGMT levels and DNA-topoisomerase 1 complex formation in peripheral blood mononuclear cells, measured by bioassay and RIA respectively, will be presented. No significant financial relationships to disclose.

Prior studies implicate type 1 IGF receptor (IGF-1R) in mediating chemo-resistance. Here, we investigated whether IGF-1R influences response to temozolomide (TMZ), which generates DNA adducts that are removed by O6-methylguanine-DNA methyltransferase (MGMT), or persist causing replication-associated double-strand breaks (DSBs). Initial assessment in 10 melanoma cell lines revealed that TMZ resistance correlated with MGMT expression (r = 0.79, p = 0.009), and in MGMT-proficient cell lines, with phospho-IGF-1R (r = 0.81, p = 0.038), suggesting that TMZ resistance associates with IGF-1R activation. Next, effects of IGF-1R inhibitors (IGF-1Ri) AZ3801 and linsitinib (OSI-906) were tested on TMZ-sensitivity, cell cycle progression and DSB induction. IGF-1Ri sensitized BRAF wild-type and mutant melanoma cells to TMZ in vitro, an effect that was independent of MGMT. Cells harboring wild-type p53 were more sensitive to IGF-1Ri, and showed schedule-dependent chemo-sensitization that was most effective when IGF-1Ri followed TMZ. This sequence sensitized to clinically-achievable TMZ concentrations and enhanced TMZ-induced apoptosis. Simultaneous or prior IGF-1Ri caused less effective chemo-sensitization, associated with increased G1 population and reduced accumulation of TMZ-induced DSBs. Clinically relevant sequential (TMZ → IGF-1Ri) treatment was tested in mice bearing A375M (V600E BRAF, wild-type p53) melanoma xenografts, achieving peak plasma/tumor IGF-1Ri levels comparable to clinical Cmax, and inducing extensive intratumoral apoptosis. TMZ or IGF-1Ri caused minor inhibition of tumor growth (gradient reduction 13%, 25% respectively), while combination treatment caused supra-additive growth delay (72%) that was significantly different from control (p < 0.01), TMZ (p < 0.01) and IGF-1Ri (p < 0.05) groups. These data highlight the importance of scheduling when combining IGF-1Ri and other targeted agents with drugs that induce replication-associated DNA damage.

We present IncucyteDRC, an R package for the analysis of data from live cell imaging cell proliferation experiments carried out on the Essen Biosciences IncuCyte ZOOM instrument. The package provides a simple workflow for summarising data into a form that can be used to calculate dose response curves and EC50 values for small molecule inhibitors. Data from different cell lines, or cell lines grown under different conditions, can be normalised as to their doubling time. A simple graphical web interface, implemented using shiny, is provided for the benefit of non-R users. The software is potentially useful to any research group studying the impact of small molecule inhibitors on cell proliferation using the IncuCyte ZOOM.

Alkyltransferase-like (ATL) proteins in Schizosaccharomyces pombe (Atl1) and Thermus thermophilus (TTHA1564) protect against the adverse effects of DNA alkylation damage by flagging O 6 -alkylguanine lesions for nucleotide excision repair (NER). We show that both ATL proteins bind with high affinity to oligodeoxyribonucleotides containing O 6 -alkylguanines differing in size, polarity, and charge of the alkyl group. However, Atl1 shows a greater ability than TTHA1564 to distinguish between O 6 -alkylguanine and guanine and in an unprecedented mechanism uses Arg69 to probe the electrostatic potential surface of O 6 -alkylguanine, as determined using molecular mechanics calculations. An unexpected consequence of this feature is the recognition of 2,6-diaminopurine and 2-aminopurine, as confirmed in crystal structures of respective Atl1-DNA complexes. O 6 -Alkylguanine and guanine discrimination is diminished for Atl1 R69A and R69F mutants, and S. pombe R69A and R69F mutants are more sensitive toward alkylating agent toxicity, revealing the key role of Arg69 in identifying O 6 -alkylguanines critical for NER recognition.

Nucleotide excision repair (NER) has long been known to remove DNA lesions induced by chemical carcinogens, and the molecular mechanism has been partially elucidated. Here we demonstrate that in Schizosaccharomyces pombe a DNA recognition protein, alkyltransferase-like 1 (Atl1), can play a pivotal role in selecting a specific NER pathway, depending on the nature of the DNA modification. The relative ease of dissociation of Atl1 from DNA containing small O(6)-alkylguanines allows accurate completion of global genome repair (GGR), whereas strong Atl1 binding to bulky O(6)-alkylguanines blocks GGR, stalls the transcription machinery, and diverts the damage to transcription-coupled repair. Our findings redraw the initial stages of the NER process in those organisms that express an alkyltransferase-like gene and raise the question of whether or not O(6)-alkylguanine lesions that are poor substrates for the alkyltransferase proteins in higher eukaryotes might, by analogy, signal such lesions for repair by NER.

Alkyltransferase-like proteins (ATLs) share functional motifs with the cancer chemotherapy target O6-alkylguanine-DNA alkyltransferase (AGT) and paradoxically protect cells from the biological effects of DNA alkylation damage, despite lacking the reactive cysteine and alkyltransferase activity of AGT. Here we determine Schizosaccharomyces pombe ATL structures without and with damaged DNA containing the endogenous lesion O6-methylguanine or cigarette-smoke-derived O6-4-(3-pyridyl)-4-oxobutylguanine. These results reveal non-enzymatic DNA nucleotide flipping plus increased DNA distortion and binding pocket size compared to AGT. Our analysis of lesion-binding site conservation identifies new ATLs in sea anemone and ancestral archaea, indicating that ATL interactions are ancestral to present-day repair pathways in all domains of life. Genetic connections to mammalian XPG (also known as ERCC5) and ERCC1 in S. pombe homologues Rad13 and Swi10 and biochemical interactions with Escherichia coli UvrA and UvrC combined with structural results reveal that ATLs sculpt alkylated DNA to create a genetic and structural intersection of base damage processing with nucleotide excision repair. Alkylated DNA is directly repaired by enzymes known as alkyltransferases (AGTs). A related class of enzymes, the alkyltransferase-like proteins (ATLs), can also protect against alkylation damage, but lack alkyltransferase activity. To gain insight into how this occurs, Tubbs et al. have solved the structure of a yeast ATL in the presence and absence of damaged DNA. Like AGTs, the ATL flips the alkylated base out of the DNA helix, but in this case the lesion is then acted upon by proteins of the nucleotide excision repair pathway. This analysis of lesion-binding site conservation identifies new ATLs in sea anemone and ancestral archaea, indicating that ATL interactions are ancestral to present-day repair pathways in all domains of life. A class of enzymes known as alkyltransferase-like proteins (ATLs) can protect against alkylation damage to DNA. To gain insight into how this occurs, the structure of a yeast ATL has been solved in the presence and absence of damaged DNA, revealing that ATL flips the alkylated base out of the DNA helix, leaving the lesion to be acted on by proteins of the nucleotide excision repair pathway.

Recent in silico analysis has revealed the presence of a group of proteins in pro and lower eukaryotes, but not in Man, that show extensive amino acid sequence similarity to known O6-alkylguanine-DNA alkyltransferases, but where the cysteine at the putative active site is replaced by another residue, usually tryptophan. Here we review recent work on these proteins, which we designate as alkyltransferase-like (ATL) proteins, and consider their mechanism of action and role in protecting the host organisms against the biological effects of O6-alkylating agents, and their evolution. ATL proteins from Escherichia coli (eAtl, transcribed from the ybaz open reading frame) and Schizosaccharomyces pombe (Atl1) are able to bind to a range of O6-alkylguanine residues in DNA and to reversibly inhibit the action of the human alkyltransferase (MGMT) upon these substrates. Isolated proteins were not able to remove the methyl group in O6-methylguanine-containing DNA or oligonucleotides, neither did they display glycosylase or endonuclease activity. S. pombe does not contain a functional alkyltransferase and atl1 inactivation sensitises this organism to a variety of alkylating agents, suggesting that Atl1 acts by binding to O6-alkylguanine lesions and signalling them for processing by other DNA repair pathways. Currently we cannot exclude the possibility that ATL proteins arose through independent mutation of the alkyltransferase gene in different organisms. However, analyses of the proteins from E. coli and S. pombe, are consistent with a common function.

Purpose To evaluate tumor response, pharmacodynamic effects, and safety of a combination of lomeguatrib (LM), an O6-methylguanine DNA-methyltransferase (MGMT) inactivator, and temozolomide (TMZ), TMZ alone, and LM/TMZ after disease progression on TMZ alone in patients with advanced melanoma. Patients and Methods Patients with unresectable stage III or IV cutaneous melanoma who had no prior systemic chemotherapy were randomly assigned to receive either 40 to 80 mg LM and 125 mg/m2 TMZ or 200 mg/m2 TMZ on days 1 through 5 of each 28-day treatment cycle. Drugs were administered orally for up to six cycles of treatment. Patients on TMZ alone were offered LM/TMZ at progression, if fit enough to receive treatment. Results One hundred four patients were enrolled, with 52 in each trial arm. Twenty-seven TMZ-treated patients received LM/TMZ after progression on TMZ. Unexpectedly, analysis of tumor biopsies showed rapid recovery of MGMT after LM/TMZ with 40 mg/d LM. Therefore, doses of LM were escalated to 60 then 80 mg/d. Tumor response rates were 13.5% with LM/TMZ and 17.3% with TMZ alone. No patient responded to LM/TMZ having progressed through TMZ. Median time to disease progression was 65.5 days for LM/TMZ and 68 days for TMZ. All treatments were well tolerated, although hematologic and gastrointestinal adverse events were common. A higher incidence of hematological adverse events was observed in the LM/TMZ combination arm. Conclusion The efficacy of LM and TMZ in the current dosing schedule is similar to that of TMZ alone. To maintain MGMT depletion in tumor dosing of LM needs to be continued beyond that of TMZ.

Aim This study aimed to investigate fatigue, and its correlates, in children and adolescents with physical disabilities. Method Sixty-five young people aged 8 to 17 years (35 males, 30 females; mean age 13y 2mo, SD 2y 8mo) with mild to moderate physical disabilities (Gillette Functional Assessment Questionnaire levels 7–10) were recruited. Self-reported fatigue was measured using the PedsQL Multidimensional Fatigue Scale. Physical activity was measured using 7-day hip-worn accelerometer. Associations between fatigue, physical activity, and socio-demographic characteristics were examined using analysis of covariance, with significance (α) set at 0.05. Results were compared with normative data from other paediatric populations. Results Among children with physical disabilities, fatigue was associated with being physically inactive (F-statistic=4.42, p=0.040), female (F=4.37, p=0.042), and of low socio-economic status (F=3.94, p=0.050). Fatigue was not associated with age, weight status, or functional impairment. Young people with physical disabilities experienced high levels of fatigue compared with other paediatric health populations, and comparable to the paediatric cancer population. Interpretation Fatigue is an important issue for young people with physical disabilities. Clinicians and researchers working with this group should be mindful that fatigue is likely to impact on an individual's ability to undertake new treatment regimens or interventions. Interventions aimed at reducing fatigue are warranted. Increasing physical activity might play a role in reducing fatigue.

Tumour resistance to chemotherapy involving methylating agents such as DTIC (dacarbazine) and temozolomide is linked to expression of the DNA repair protein O(6)-alkylguanine-DNA alkyltransferase (MGMT). There is considerable interest in improving the efficacy of such O(6)-alkylating chemotherapy by the prior inactivation of MGMT. We have examined the effect of the modified guanine base, O(6)-(4-bromothenyl)guanine (PaTrin-2, Patrin, Lomeguatrib) on MGMT activity and cell or xenograft tumour growth inhibition by temozolomide in the human breast carcinosarcoma cell line, MCF-7. PaTrin-2 effectively inactivated MGMT in MCF-7 cells (IC(50) approximately 6 nM) and in xenografts there was complete inactivation of MGMT within 2 h of dosing (20 mg kg(-1) i.p.) and only slight recovery by 24 h. MGMT inactivation in a range of murine host tissues varied between complete and approximately 60%, with extensive recovery by 24 h. PaTrin-2 (10 microM) substantially increased the growth inhibitory effects of temozolomide in MCF-7 cells (D(60)=10 microM with PaTrin-2 vs 400 microM without). In MCF-7 xenografts, neither temozolomide (100 mg kg(-1) day(-1) for 5 days) nor PaTrin-2 (20 mg kg(-1) day(-1) for 5 days) had any significant effect on tumour growth. In contrast, the PaTrin-2-temozolomide combination produced a substantial tumour growth delay: median tumour quintupling time was increase by 22 days (P

Cisplatin may have additive activity with temozolomide due to ablation of the DNA repair protein O6-alkylguanine-DNA alkyltransferase (MGMT). This phase I/II study determined recommended combination doses using the Continual Reassessment Method, toxicities and antitumour activity in paediatric patients, and evaluated MGMT in peripheral blood mononuclear cells (PBMCs) in order to correlate with haematological toxicity. In total, 39 patients with refractory or recurrent solid tumours (median age approximately 13 years; 14 pretreated with high-dose chemotherapy, craniospinal irradiation, or having bone marrow involvement) were treated with cisplatin, followed the next day by oral temozolomide for 5 days every 4 weeks at dose levels 80 mg m(-2)/150 mg m(-2) day(-1), 80/200, and 100/200, respectively. A total of 38 patients receiving 113 cycles (median 2, range 1-7) were evaluable for toxicity. Dose-limiting toxicity was haematological in all but one case. Treatment-related toxicities were thrombocytopenia, neutropenia, nausea-vomiting, asthenia. Hearing loss was experienced in five patients with prior irradiation to the brain stem or posterior fossa. Partial responses were observed in two malignant glioma, one brain stem glioma, and two neuroblastoma. Median MGMT activity in PBMCs decreased after 5 days of temozolomide treatment: low MGMT activity correlated with increased severity of thrombocytopenia. Cisplatin-temozolomide combinations are well tolerated without additional toxicity to single-agent treatments; the recommended phase II dosage is 80 mg m(-2) cisplatin and 150 mg m(-2) x 5 temozolomide in heavily treated, and 200 mg m(-2) x 5 temozolomide in less-heavily pretreated children.

The ability to detect flow is the most crucial aspect of an ultrasound (US) system because, if flow cannot be detected, no other aspect of performance matters. The objectives of this study were to validate a Doppler "sensitivity performance index," a figure of merit, and to determine if it could be used to differentiate colour Doppler sensitivity performance in scanners of varying complexity. The sensitivity performance index was developed to give a combined measure of related aspects of sensitivity, such as the lowest detectable velocity, the vessel size and the penetration depth. The colour Doppler sensitivity was evaluated objectively as the lowest detectable velocity signal from the deepest achievable point within the Doppler sensitivity phantom free from extraneous noise in a small diameter vessel (3.2 mm inner diameter). The effect of vessel size and mean velocity on the sensitivity performance index were investigated and it was found that the index was not proportional to vessel size, but this may be accounted for by considering the effect of the acoustic properties of the vessel material, the clutter filter and beam shape. The results obtained using flow phantoms with vessel sizes different from those used in this study are, therefore, not directly comparable to the results found in this study; however, a similar trend should be found in the results for the effect of control settings and a similar range of US scanners. It was found that the Doppler sensitivity performance index was a robust challenging test because none of the US scanners evaluated was capable of achieving the highest sensitivity performance index score, which would be limited by the lowest pump velocity and the deepest point of the vessel within the flow phantom. Therefore, this suggests that this method of determining Doppler sensitivity performance is valuable in the absence of other suitable methods, despite the fact that the relationship between the sensitivity performance index and vessel size is not proportional. Furthermore, use of the Doppler sensitivity performance index for the evaluation of a range of scanners demonstrated that curvilinear transducers have higher sensitivity performance indices than higher-frequency linear transducers, due to the higher achievable penetration depth. The effect of instrument settings was assessed for two transducers, the 4C3 curvilinear general-purpose transducer (Aspen) and the PVM375AT curvilinear general-purpose transducer (Nemio). The colour Doppler sensitivity performance was found to be significantly dependent on the clutter filter setting and the output power setting for both transducers tested. Users need to be aware of the effect of these settings on the colour Doppler sensitivity performance of their US scanner when interpreting the clinical significance of the colour Doppler information.

Humor at work could provide many potential benefits, but the empirical literature does not support many clear conclusions about its role. Two issues have limited the clarity of the findings. First, many studies do not consider the potential negative, as well as positive, associations with humor. Second, no available measure allows researchers to quantify the broad presence of humor in the workplace. The current research describes the development and initial validation of a brief measure, the Humor Climate Questionnaire (HCQ), which assesses positive and negative styles of humor in the workplace climate. The HCQ has a clear four factor structure, good internal reliability for each dimension, and it explains variance in multiple indicators of job satisfaction and commitment beyond that explained by individual differences in humor uses. The HCQ provides a research tool that could be used to assess a variety of predictions about the roles that humor could play in the workplace.

Objective. Busulfan (BU) is often used in conditioning regimens prior to bone marrow transplantation, but its mechanism of action remains to be resolved. We have examined the possibility that BU may exert part of its toxic effects via DNA alkylation at the Oh position of guanine as this might provide an approach to improving the conditioning regimen. Methods. Survival of LAMA-84 and RJKO cells was assessed by colony-forming assay and cell counting, respectively. O-6-alkylguanine-DNA alkyltransferase (ATase) activity was assayed by transfer of radioactivity from [H-3]-methylated DNA, Colony-forming potential of normal human bone marrow cells (BMC) was measured in the presence of appropriate growth factors as the formation of both granulocyte-macrophage colony-forming units (CFU-GM) or burst-forming unit erythroids (BFU-E) within the same assay. Murine hematopoietic precursors were grown under a bone marrow stromal cell line to allow measurement of the frequency of cobblestone area-forming cells (CAFC) that correspond to CFU-GM, spleen colony-forming units (CFU-S), and the primitive stem cells with long-term repopulating ability. Results. Inactivation of ATase by O-6-benzylguanine (O-6-BeG) sensitized a human erythromegakaryocytic cell line (LAMA-84) and normal human bone marrow progenitors to 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) but not to BU toxicity, BCNU, but not BU, inactivated ATase in LAMA-84 cells. Overexpression of human ATase in cDNA transfected Chinese hamster cells attenuated the toxicity of BCNU but not BU, Finally, the in vivo treatment of mire showed that the depletion of primitive stem cells by BU as measured in the CAFC assay was not affected by addition of O-6-BeG. O-6-BeG did, however, dramatically potentiate BCNU toxicity in all CAFC subsets, leading to depletion of more than 99% stem cells, Conclusion. These data suggest that BU does not elicit toxicity via alkylation at the O-6 position of guanine in DNA in a way that can be influenced by ATase modulation, (C) 2001 International Society for Experimental Hematology. Published by Elsevier Science Inc.

The aims of this phase I study in patients with recurrent malignant gliomas were to determine the maximum tolerated dose (MTD) and toxicity profile of fotemustine when combined with a fixed dose of procarbazine (PCZ), and to evaluate the extent of O6-alkylguanine-DNA alkyltransferase (ATase) depletion in circulating lymphocytes during treatment. Sixteen patients received an induction cycle consisting of 100 mg/day oral PCZ for 12 consecutive days and a 1-h intravenous infusion of fotemustine given 4 h after PCZ on days 5 and 12 at escalated doses (50, 75, 100 and 125 mg/m2/day). After a 6-week rest period, a maximum of 4 maintenance cycles (PCZ 300 mg/day, 4 days; fotemustine, day 4) was given every 4 weeks. ATase activity was measured on days 1, 5 and 12 over 4 h after PCZ intake. Fifteen patients had previously received at least one nitrosourea-based chemotherapy, associated with PCZ in 12 cases. The MTD of fotemustine was 125 mg/m2 (days 5 and 12) with myelosuppression as the dose limiting toxicity (DLT). At this dose level, half of patients experienced grade 3 anemia, neutropenia or thrombopenia. No extra-hematological DLT was observed. No significant depletion of ATase activity by PCZ was evidenced. One partial response and 7 stable diseases were obtained leading to a disease control rate of 50%. The median times to progression and survival were 2.6 and 9.7 months, respectively. This combined regimen of PCZ and fotemustine was well tolerated with a good disease control rate in heavily pretreated glioma patients and merits further investigation in phase II studies.

This article appeared in a journal published by Elsevier. Under Elsevier's copyright, mandated authors are not permitted to make work available in an institutional repository., Azoxymethane (AOM) is an alkylating agent that generates mutagenic and carcinogenic O6-methylguanine (O6meG) adducts in DNA. O6meG has been detected in human colonic DNA; hence, understanding the innate cellular events occurring in response to the formation of O6meG is important in developing preventive strategies for colorectal cancer. We explored the time-course, dose–response, and kinetics of O6meG formation and its removal by the DNA repair protein, O6-methylguanine DNA methyltransferase (MGMT), and apoptosis. In rats given AOM (10 mg/kg), the formation of O6meG occurs within 2 h of exposure, accompanied by rapid depletion of MGMT activity and followed by the induction of an acute apoptotic response that peaks at 6–8 h. MGMT repair and apoptosis are dependent on AOM dose and O6meG load. Apoptosis is initiated only when a high O6meG load is present and MGMT activity is fully depleted. AOM, 10 mg/kg, overwhelms MGMT repair for about 96 h and renewed MGMT activity is only observed once O6meG is no longer detectable. A threshold for apoptosis is observed at 6 h after 6 mg/kg AOM, when a high O6meG persists and MGMT activity is very low. These data suggest that apoptosis is probably triggered by O6meG, but only once the capacity of MGMT to repair O6meG is exhausted. In the colonic epithelium, apoptosis may be complementary to MGMT, in terms of minimising potentially mutagenic events and maintaining a healthy genome., This study was supported in part by the CSIRO Preventative Health National Flagship Program, the Cancer Council of South Australia (CCSA 525925), the National Health and Medical Research Council (NHMRC 1007501), and Cancer Research UK.

The title compound, [PtCl2(C14H16)], contains a square-planar d8 platinum(II) center which is coordinated by two Cl atoms and the double bonds of a rigid polycyclic ligand containing a 1,4-cyclo­octa­diene subunit. This compound is an inter­esting substrate for additional mechanistic studies of catalytically active metal complexes.

Tyrosyl-DNA phosphodiesterase 1 (Tdp1) catalyzes the hydrolysis of phosphodiester bonds between the DNA 3′-phosphate and tyrosine residues and plays a major role in the repair of stalled topoisomerase I-DNA covalent complexes. Given this role, Tdp1 is of interest as a potential target for anticancer therapy. Inhibiting Tdp1 in combination with clinically used Top1 inhibitors may potentiate the effects of the latter and help to overcome some of the chemoresistance issues currently observed. In addition, Tdp1 can function during DNA repair to remove a variety of other 3′ adducts from DNA such as phosphoglycolates and abasic or apurinic/apyrimidinic (AP) sites. Here we describe a new mix-and-read homogeneous fluorogenic assay for the measurement of the AP-site cleavage activity of Tdp1 that is compatible with high-throughput screening. The application of such an assay will open up further avenues for the discovery of novel Tdp1 inhibitors.

Background Tobacco specific nitrosamines such as 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) are genotoxic alkylating agents found within cigarette smoke that induce lung adenocarcinomas in animal models. In humans, adenocarcinomas originate most frequently in the lung periphery. The aim of this study was to determine whether peripheral lung has increased susceptibility to the genotoxic effects of alkylating agents by comparing DNA alkylation damage (N7-methylguanine: N7-meG) and repair (O6-alkylguanine DNA alkyltransferase: MGMT) in peripheral relative to central lung tissue. Methods Macroscopically normal lung tissue, resected from patients undergoing surgery for lung cancer, was sampled at equidistant points from central to peripheral lung along a bronchus. N7-meG levels were determined using an immunoslotblot technique and MGMT activity with a [32P]-labelled oligodeoxynucleotide cleavage assay. Results A total of 20 subjects were recruited, 12 males and 8 females with a mean age of 68.7 ± 5.8 years. There were 14 former and 6 current smokers with a mean smoking exposure of 34.0 ± 18.3 packyears. N7-meG (mean 0.75 ± 0.57/106 dG, n = 65 samples from 14 patients) and MGMT repair (geometric mean 9.57 ± 1.62 fmol/μg DNA, n = 79 samples from 16 patients) were detected in all samples assayed. MGMT activity increased towards the lung periphery (r = 0.28, p = 0.023; n = 16) with a highly significant association in current (r = 0.53, p = 0.008; n = 6) but not former smokers (r = 0.13; p = 0.41; n = 10). No correlation was seen with N7-meG levels and lung position (r = −0.18; p = 0.21; n = 14). N7-meG levels were higher in current compared to former smokers reaching significance in two lung positions including peripheral lung (p = 0.047). Conclusions The findings in this study do not support the hypothesis that peripheral tissue is more susceptible to the genotoxic effects of alkylating agents than central lung tissue. In addition exposure to cigarette smoke reduced the level of MGMT in central bronchial tissue possibly through increased alkylating agent exposure.

Two resistant K562 sublines have been developed by treatment with AZQ (2,5-bis(carboethoxyamino)-3,6-diaziridinyl-1,4-benzoquinone) and BZQ (2,5-bis(2-hydroxyethylamino)-3,6-diaziridinyl-1,4-benzoquinone). The id 50 values for AZQ on K562, the AZQ-resistant sublines (AZQR) and the BZQ-resistant sublines (BZQR) were 0.063, 1.47 and 0.244 μM, respectively. The relative id 50 values for BZQ on the same cell lines were 0.2, 0.67 and 0.83 μM, respectively. Although it is generally believed that these two quinones function by different mechanisms, the two sublines have similar decreased levels of cytochrome P-450 reductase and DT-diaphorase and increased levels of glutathione and superoxide dismutase, compared to the parent cell line. The sublines are also cross-resistant to adriamycin, mitozolamide, N -methyl- N ′-nitro- N -nitrosoguanidine (MNNG) and mitomycin C. This work indicates the potential multifactorial mechanisms by which drug resistance can be induced in cell lines in the absence of conventional ‘P’-glycoprotein multidrug resistance.

RET (REarranged during Transfection) is a receptor tyrosine kinase, which plays pivotal roles in regulating cell survival, differentiation, proliferation, migration and chemotaxis. Activation of RET is a mechanism of oncogenesis in medullary thyroid carcinomas where both germline and sporadic activating somatic mutations are prevalent. At present, there are no known specific RET inhibitors in clinical development, although many potent inhibitors of RET have been opportunistically identified through selectivity profiling of compounds initially designed to target other tyrosine kinases. Vandetanib and cabozantinib, both multi-kinase inhibitors with RET activity, are approved for use in medullary thyroid carcinoma, but additional pharmacological activities, most notably inhibition of vascular endothelial growth factor - VEGFR2 (KDR), lead to dose-limiting toxicity. The recent identification of RET fusions present in ~1% of lung adenocarcinoma patients has renewed interest in the identification and development of more selective RET inhibitors lacking the toxicities associated with the current treatments. In an earlier publication [Newton et al, 2016; 1] we reported the discovery of a series of 2-substituted phenol quinazolines as potent and selective RET kinase inhibitors. Here we describe the development of the robust screening cascade which allowed the identification and advancement of this chemical series. Furthermore we have profiled a panel of RET-active clinical compounds both to validate the cascade and to confirm that none display a RET-selective target profile.

O 6-(carboxymethyl)guanine (O 6-CMG) and O 6-(4-oxo-4-(3-pyridyl)butyl)guanine (O 6-pobG) are toxic lesions formed in DNA following exposure to alkylating agents. O 6-CMG results from exposure to nitrosated glycine or nitrosated bile acid conjugates and may be associated with diets rich in red meat. O 6-pobG lesions are derived from alkylating agents found in tobacco smoke. Efficient syntheses of oligodeoxyribonucleotides (ODNs) containing O 6-CMG and O 6-pobG are described that involve nucleophilic displacement by the appropriate alcohol on a common synthetic ODN containing the reactive base 2-amino-6-methylsulfonylpurine. ODNs containing O 6-pobG and O 6-CMG were found to be good substrates for the S. pombe alkyltransferase-like protein Atl1. [Supplemental materials are available for this article. Go to the publisher's online edition of Nucleosides, Nucleotides & Nucleic Acids to view the free supplemental file.]

Myxoid Liposarcomas (MLS), characterized by the expression of FUS-CHOP fusion gene are clinically very sensitive to the DNA binding antitumor agent, trabectedin. However, resistance eventually occurs, preventing disease eradication. To investigate the mechanisms of resistance, a trabectedin resistant cell line, 402-91/ET, was developed. The resistance to trabectedin was not related to the expression of MDR related proteins, uptake/efflux of trabectedin or GSH levels that were similar in parental and resistant cells. The 402-91/ET cells were hypersensitive to UV light because of a nucleotide excision repair defect: XPG complementation decreased sensitivity to UV rays, but only partially to trabectedin. 402-91/ET cells showed collateral sensitivity to temozolomide due to the lack of O(6) -methylguanine-DNA-methyltransferase (MGMT) activity, related to the hypermethylation of MGMT promoter. In 402-91 cells chromatin immunoprecipitation (ChIP) assays showed that FUS-CHOP was bound to the PTX3 and FN1 gene promoters, as previously described, and trabectedin caused FUS-CHOP detachment from DNA. Here we report that, in contrast, in 402-91/ET cells, FUS-CHOP was not bound to these promoters. Differences in the modulation of transcription of genes involved in different pathways including signal transduction, apoptosis and stress response between the two cell lines were found. Trabectedin activates the transcription of genes involved in the adipogenic-program such as c/EBPα and β, in 402-91 but not in 402-91/ET cell lines. The collateral sensitivity of 402-91/ET to temozolomide provides the rationale to investigate the potential use of methylating agents in MLS patients resistant to trabectedin.

Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCTɛAGCGGGTACCGAGCTCGAAT; ɛA=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67 fmol/μg DNA/h vs 3.47±1.35 fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

BACKGROUND: Poly adenosine diphosphate (ADP)-ribose polymerase (PARP) is essential in cellular processing of DNA damage via the base excision repair pathway (BER). The PARP inhibition can be directly cytotoxic to tumour cells and augments the anti-tumour effects of DNA-damaging agents. This study evaluated the optimally tolerated dose of olaparib (4-(3--4-fluorophenyl) methyl-1(2H)-one; AZD2281, KU0059436), a potent PARP inhibitor, with dacarbazine and assessed safety, toxicity, clinical pharmacokinetics and efficacy of combination treatment. PATIENTS AND METHODS: Patients with advanced cancer received olaparib (20-200 mg PO) on days 1-7 with dacarbazine (600-800 mg m(-2) IV) on day 1 (cycle 2, day 2) of a 21-day cycle. An expansion cohort of chemonaive melanoma patients was treated at an optimally tolerated dose. The BER enzyme, methylpurine-DNA glycosylase and its substrate 7-methylguanine were quantified in peripheral blood mononuclear cells. RESULTS: The optimal combination to proceed to phase II was defined as 100 mg bd olaparib with 600 mg m(-2) dacarbazine. Dose-limiting toxicities were neutropaenia and thrombocytopaenia. There were two partial responses, both in patients with melanoma. CONCLUSION: This study defined a tolerable dose of olaparib in combination with dacarbazine, but there were no responses in chemonaive melanoma patients, demonstrating no clinical advantage over single-agent dacarbazine at these doses.

Mitochondria play critical roles in oxidative phosphorylation and energy metabolism. Increasing evidence supports that mitochondrial DNA (mtDNA) damage and dysfunction play vital roles in the development of many mitochondria-related diseases, such as obesity, diabetes mellitus, infertility, neurodegenerative disorders, and malignant tumors in humans. Human 8-oxoguanine-DNA glycosylase 1 (hOGG1) transgenic (TG) mice were produced by nuclear microinjection. Transgene integration was analyzed by PCR. Transgene expression was measured by RT-PCR and Western blot analysis. Mitochondrial DNA damage was analyzed by mutational analyses and measurement of mtDNA copy number. Total fat content was measured by a whole-body scan using dual-energy X-ray absorptiometry. The hOGG1 overexpression in mitochondria increased the abundance of intracellular free radicals and major deletions in mtDNA. Obesity in hOGG1 TG mice resulted from increased fat content in tissues, produced by hyperphagia. The molecular mechanisms of obesity involved overexpression of genes in the central orexigenic (appetite-stimulating) pathway, peripheral lipogenesis, down-regulation of genes in the central anorexigenic (appetite-suppressing) pathway, peripheral adaptive thermogenesis, and fatty acid oxidation. Diffuse hepatosteatosis, female infertility, and increased frequency of malignant lymphoma were also seen in these hOGG1 TG mice. High levels of hOGG1 expression in mitochondria, resulting in enhanced oxidative DNA damage processing, may be an important factor in human metabolic syndrome, infertility, and malignancy.

Folate deficiency is implicated in human colon cancer. The effects of feeding rats a folate-deficient diet for 24 weeks on DNA damage (8-oxo-7,8-dihydroguanine), DNA repair [O6-methylguanine-DNA methyltransferase (MGMT) and 8-oxoguanine-DNA glycosylase (OGG-1) activity], and epigenetic parameters (genome-wide cytosine methylation and indices of cellular methylation status) were investigated. Relative to control diet, the folate-deficient diet resulted in significantly reduced levels of serum (∼80%; P < 0.0001), whole blood (∼40%; P < 0.0001), and tissue folate (between 25% and 60% depending on the tissue sampled; P < 0.05); increased plasma total homocysteine (∼35%; P < 0.05); and decreased S-adenosylmethionine to S-adenosylhomocysteine concentrations (∼11%; P < 0.05). There was no significant change in the levels of 5-methyldeoxycytidine in liver or colon DNA, nor in the activity of liver DNA cytosine methyltransferase. However, there were significant increases in 8-oxo-7,8-dihydroguanine (P < 0.001) in lymphocyte DNA and in levels of the DNA repair proteins OGG-1 (∼27%; P < 0.03) and MGMT (∼25%; P < 0.003) in the liver, but not in the colon. This may reflect the ability of the liver, but not the colon, to upregulate DNA repair enzymes in response to either elevated DNA damage or an imbalance in the nucleotide precursor pool. These results show that folate deficiency can significantly modulate DNA damage and DNA repair, providing mechanisms by which it plays a role in the etiology of human cancer. We speculate that the inability of colon tissue to respond to folate deficiency occurs in humans and may increase the potential for malignant transformation. Cancer Prev Res; 3(1); 92–100

Chinese hamster V79 lung fibroblasts are sensitive to the toxic effects of chloroethylating agents such as mitozolomide (Mz) and express very low levels (less than 2 fmol/mg) of the DNA repair enzyme O6-alkylguanine-DNA-alkyltransferase (ATase). These cells were subjected to selection by treatment with serially increasing doses of Mz. After each dose, the surviving population was expanded and ATase activity was determined in cell extracts. ATase specific activity increased stepwise and in cells surviving selection at 120 micrograms/ml Mz had reached 430 fmol/mg protein: polyacrylamide gel electrophoresis and fluorography showed the size of the ATase as 25 kDa. Cytological examination of these cells showed the presence of double minute (DM) chromosomes (mean approximately 3/cell) but no obvious homogeneously staining regions. In cells grown in continuous culture without further selection no marked decrease in ATase activity or DM frequency was observed. Karyotype analysis and DNA profiling confirmed that the parent and selected cells were of the same origin with, in the latter case, the probable loss or gain of a single restriction endonuclease site. No major differences were seen in the intensity of hybridization signals following Southern analyses of DNA from control and Mz selected cells using the human ATase cDNA as a probe. These results indicate that the ATase gene is not amplified in the Mz selected cells and suggest that increased ATase activity is a consequence only of increased transcription or translation of the ATase gene.

We evaluated the pharmacodynamic effects of the O(6)-methylguanine-DNA methyltransferase (MGMT) inactivator lomeguatrib (LM) on patients with melanoma in two clinical trials. Patients received temozolomide (TMZ) for 5 days either alone or with LM for 5, 10 or 14 days. Peripheral blood mononuclear cells (PBMCs) were isolated before treatment and during cycle 1. Where available, tumour biopsies were obtained after the last drug dose in cycle 1. Samples were assayed for MGMT activity, total MGMT protein, and O(6)-methylguanine (O(6)-meG) and N7-methylguanine levels in DNA. MGMT was completely inactivated in PBMC from patients receiving LM, but detectable in those on TMZ alone. Tumours biopsied on the last day of treatment showed complete inactivation of MGMT but there was recovery of activity in tumours sampled later. Significantly more O(6)-meG was present in the PBMC DNA of LM/TMZ patients than those on TMZ alone. LM/TMZ leads to greater MGMT inactivation, and higher levels of O(6)-meG than TMZ alone. Early recovery of MGMT activity in tumours suggested that more protracted dosing with LM is required. Extended dosing of LM completely inactivated PBMC MGMT, and resulted in persistent levels of O(6)-meG in PBMC DNA during treatment.