Search

Background The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. Results The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. Conclusions The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD enzymes of the GA pathway in wheat and barley will provide the basis for a better understanding of GA-regulated development in these species. This analysis revealed the existence of a novel, endosperm-specific GA 1-oxidase in wheat and a related GA 3,18-dihydroxylase enzyme in barley that may play important roles during grain expansion and development. Electronic supplementary material The online version of this article (doi:10.1186/s12870-015-0520-7) contains supplementary material, which is available to authorized users.

The alarm pheromone for many species of aphids, which causes dispersion in response to attack by predators or parasitoids, consists of the sesquiterpene (E)-β-farnesene (Eβf). We used high levels of expression inArabidopsis thalianaplants of anEβf synthase gene cloned fromMentha×piperitato cause emission of pureEβf. These plants elicited potent effects on behavior of the aphidMyzus persicae(alarm and repellent responses) and its parasitoidDiaeretiella rapae(an arrestant response). Here, we report the transformation of a plant to produce an insect pheromone and demonstrate that the resulting emission affects behavioral responses at two trophic levels.

Functional analysis of a gibberellin-regulated wheat alpha-amylase promoter, alpha-Amy2/54, has indicated that three regions were essential for expression. By studying the ability of mutant promoters, containing a randomly inserted 22 bp excision linker, to direct expression in oat aleurone protoplasts we have refined the positions and extents of these three cis elements and also demonstrated the presence of two additional elements. By converting the linker insertions to either single base point mutations or deletions using the class IIS restriction endonuclease BsmI we have shown that nucleotides -119 and -109 within the GARE -121GTAACAGAGTCTGG-108 and nucleotide -152 within the proposed element -156GATTGACTTGACC-144 are essential for high level expression from this promoter.

Gibberellins (GAs) are involved in the control of a number of key developmental processes in plants, including endosperm mobilisation stem elongation and flowering. In many of these systems, GA modulates the transcription of specific genes. The aim of this paper is to review current progress in identifying and characterising GA-regulated genes; both the control of gene expression and the function of the gene products are discussed. The most well-characterised system in which GA is active in controlling transcription is the aleurone layer of cereal grains, where it induces the synthesis of a range of hydrolytic enzymes, including a-amylase. Analysis of the promoters of a-Amy1 and a-Amy2 genes by transient expression in aleurone cells and protoplasts together with DNase 1 footprinting and gel-retardation assays, has identified a number of cis-acting elements important for high-level, GA-regulated expression. In particular a GA-response element (GARE) including the sequence TAACRRA has been characterised. Recent reports describe cDNA clones encoding trans-acting factors that bind to elements in the a-amylase promoters. Expression of the factor capable of binding to the TAACRRA element is itself induced by GA. In elongating tissues, GA has been shown to control the expression of a number of genes, including the tonoplast intrinsic protein, a water channel which may regulate water flux into the vacuole during cell expansion. In flower development, expression of flavonoid biosynthetic genes, such as chalcone synthase in Petunia corollas, is regulated by GA at the level of transcription. Analysis of GA-response mutants led to the suggestion that one consequence of GA action is to regulate its own biosynthesis. Genes encoding GA 20-oxidase and 3β-hydroxylase have recently been shown to be down-regulated by applied GA, providing a possible mechanism for feedback regulation of the GA biosynthetic pathway. There is evidence that cells perceive GA at the cell surface, implying the existence of a signal transduction system between plasma membrane and nucleus. This signal transduction system has barely begun to be elucidated but is likely to become a major focus of gibberellin research.

cDNA fragments from ten different protein kinases expressed in Avena sativa aleurone cells were amplified from mRNA by RT-PCR with degenerate primers. These could be classified into five groups: Aspk1-3 showed homology to the Snf1-related protein kinases, Aspk4-5 to a wheat ABA up-regulated protein kinase, Aspk6-8 to the Ca-dependent, calmodulin-independent protein kinase family, Aspk9 encoded a MAP kinase and Aspk10 was closely related to a novel Arabidopsis ribosomal protein kinase. GA caused a rapid increase in transcripts hybridising to Aspk10, while inhibiting the dramatic accumulation of transcripts hybridising to Aspk9 that occurred in the absence of GA.

The effects of wheat properties on breakage during First Break roller milling, as described by the Double Normalised Kumaraswamy Breakage Function (DNKBF), were investigated. A set of 45 wheats from nine varieties representing the range of commercial varieties grown in the UK, and grown over three harvest years at several nitrogen fertiliser levels, were milled at five roll gaps under Sharp-to-Sharp and Dull-to-Dull dispositions. The resulting particle size distributions were fitted with a DNKBF in order to understand the physical significance of the DNKBF parameters and to relate them to shape and hardness. The DNKBF parameters related strongly to hardness as measured using either the Single Kernel Characterisation System or Particle Size Index, allowing the particle size distribution over the range 0–4000 μm to be predicted solely from wheat hardness. A residual analysis showed that the remaining variation was correlated with kernel mass, and that more elongated kernels break to give slightly larger particles than more spherical kernels of equivalent hardness. Two types of breakage are identified, one of which principally produces many small endosperm particles along with large bran particles, while the other tends to produce mid-sized particles. The former dominates under Dull-to-Dull milling and for soft wheats, while the latter becomes more prominent under Sharp-to-Sharp milling and for harder wheats.

The sequence and expression characteristics are described of a wilt-inducible gene in Arabidopsis thaliana. A 1494 encodes a potential thiol protease whose mRNA accumulates rapidly in shoot tissue upon the loss of turgor. A1494 mRNA levels peaked after ca. 4 h and declined thereafter. Dehydration also induced rapid biosynthesis of the phytohormone abscisic acid (ABA), which continued for at least 9 h. Exogenous ABA induced the accumulation of A1494 mRNA, with kinetics similar to those after wilting. Rehydration of wilted shoots led to a rapid decline in the content of both ABA and A1494 mRNA. Wilting and ABA independently induced A1494 expression as evidenced by the effects of ABA and wilting on the ABA-deficient aba-1 and ABA-insensitive abi-1 and abi-3 genotypes. A1494 mRNA was not detectable in aba-1 shoots but accumulated rapidly after either wilting or ABA treatment, whereas the shoot ABA content was increased only by ABA treatment. ABA had no effect on A1494 mRNA levels in the abi-1 and abi-3 mutants but wilting did result in enhanced A1494 expression. Heat shock had only a minor effect on A1494 mRNA levels, whereas exposure to low temperature resulted in substantial accumulation of A1494 mRNA in wild-type shoots. However, this latter response, unlike that to drought, was mediated exclusively via ABA synthesis as demonstrated by the lack of A1494 mRNA accumulation in cold-treated aba-1 shoots.

The Arabidopsis ga1 mutant has very low levels of endogenous, active gibberellins and thus has an extreme dwarf phenotype; application of GA3 induces stem elongation and flower development. To test the hypothesis that GA action in this system involves changes in gene expression, we have cloned mRNAs whose abundance changes following GA application. A subtraction cloning scheme for the isolation of differentially regulated cDNAs was established, involving hybridization of single-stranded cDNA to biotinylated mRNA. cDNA populations enriched up to 150-fold in GA-regulated sequences were produced and cDNA libraries generated. Screening of these libraries has isolated two clones that identify mRNAs of ca. 1100 and 750 bases whose abundance is markedly increased 24 h after GA application. One of these clones encodes the vegetative form of the Arabidopsis tonoplast intrinsic protein (gamma-TIP), a water channel protein, the expression of which has recently been shown to be correlated with regions of cell expansion. The second clone is expressed only in the inflorescence and encodes a proline- and glycine-rich protein that may be a cell wall component.

The structure and expression of the pea chloroplast atpH gene, encoding ATP synthase CF0 subunit III, have been investigated. The atpH gene is situated between the atpF and atpF genes for CF0 subunits IV and I, and encodes a hydrophobic polypeptide of 81 amino acid residues which is very similar to subunit III from other species. Analysis of transcripts from the region of chloroplast DNA encoding ATP synthase subunits IV-III-I-α shows a complex pattern of transcription, with large transcripts potentially coding for several subunits and also smaller gene-specific transcripts. Two abundant transcripts of 660 nucleotides (nt) and 980 nt specific for atpH were identified. Primer extension and S1 nuclease protection mapping suggested that the 660-nt transcripts were produced by endonucleolytic processing at the sequence, 5′-UGGAAU.

Background Hexaploid wheat is one of the most important cereal crops for human nutrition. Molecular understanding of the biology of the developing grain will assist the improvement of yield and quality traits for different environments. High quality transcriptomics is a powerful method to increase this understanding. Results The transcriptome of developing caryopses from hexaploid wheat (Triticum aestivum, cv. Hereward) was determined using Affymetrix wheat GeneChip® oligonucleotide arrays which have probes for 55,052 transcripts. Of these, 14,550 showed significant differential regulation in the period between 6 and 42 days after anthesis (daa). Large changes in transcript abundance were observed which were categorised into distinct phases of differentiation (6–10 daa), grain fill (12–21 daa) and desiccation/maturation (28–42 daa) and were associated with specific tissues and processes. A similar experiment on developing caryopses grown with dry and/or hot environmental treatments was also analysed, using the profiles established in the first experiment to show that most environmental treatment effects on transcription were due to acceleration of development, but that a few transcripts were specifically affected. Transcript abundance profiles in both experiments for nine selected known and putative wheat transcription factors were independently confirmed by real time RT-PCR. These expression profiles confirm or extend our knowledge of the roles of the known transcription factors and suggest roles for the unknown ones. Conclusion This transcriptome data will provide a valuable resource for molecular studies on wheat grain. It has been demonstrated how it can be used to distinguish general developmental shifts from specific effects of treatments on gene expression and to diagnose the probable tissue specificity and role of transcription factors.

The CLAVATA1 (CLV1) receptor kinase controls stem cell number and differentiation at the Arabidopsis shoot and flower meristems. Other components of the CLV1 signaling pathway include the secreted putative ligand CLV3 and the receptor-like protein CLV2. We report evidence indicating that all intermediate and strong clv1 alleles are dominant negative and likely interfere with the activity of unknown receptor kinase(s) that have functional overlap with CLV1. clv1 dominant-negative alleles show major differences from dominant-negative alleles characterized to date in animal receptor kinase signaling systems, including the lack of a dominant-negative effect of kinase domain truncation and the ability of missense mutations in the extracellular domain to act in a dominant-negative manner. We analyzed chimeric receptor kinases by fusing CLV1 and BRASSINOSTEROID INSENSITIVE1 (BRI1) coding sequences and expressing these in clv1 null backgrounds. Constructs containing the CLV1 extracellular domain and the BRI1 kinase domain were strongly dominant negative in the regulation of meristem development. Furthermore, we show that CLV1 expressed within the pedicel can partially replace the function of the ERECTA receptor kinase. We propose the presence of multiple receptors that regulate meristem development in a functionally related manner whose interactions are driven by the extracellular domains and whose activation requires the kinase domain.

In a screen to identify novel cellulose deficient mutants, three lines were shown to be allelic and define a novel complementation group, irregular xylem5 ( irx5 ). IRX5 was cloned and encodes a member of the CesA family of cellulose synthase catalytic subunits (AtCesA4). irx5 plants have an identical phenotype to previously described mutations in two other members of this gene family ( IRX1 and IRX3 ). IRX5, IRX3, and IRX1 are coexpressed in exactly the same cells, and all three proteins interact in detergent solubilized extracts, suggesting that three members of this gene family are required for cellulose synthesis in secondary cell walls. The association of IRX1 and IRX3 was reduced to undetectable levels in the absence of IRX5. Consequently, these data suggest that IRX5, IRX3, and IRX1 are all essential components of the cellulose synthesizing complex and the presence of all three subunits is required for the correct assembly of this complex.

Two cDNA clones (NtmybAS1 andNtmybAS2) encoding MYB-related proteins with strong sequence similarity to petunia (Petunia hybrida) PhMYB3 were isolated from a tobacco (Nicotiana tabacumcv Samsun) pollen cDNA library. Northern blot and in situ hybridization revealed that NtmybAS transcripts are specifically expressed in both sporophytic and gametophytic tissues of the anther including tapetum, stomium, vascular tissue, and developing pollen. Random binding site selection assays revealed that NtMYBAS1 bound to DNA sequences closely resembling consensus MYB binding sites MBSI and MBSIIG, with a higher affinity for MBSI. Transient expression analyses of the N-terminal MYB domain demonstrated the presence of functional nuclear localization signals, and full-length NtMYBAS1 was able to activate two different phenylalanine ammonia-lyase promoters (PALA and gPAL1) in tobacco leaf protoplasts. Similar analysis of truncated NtmybAS1cDNAs identified an essential, C-terminal trans-activation domain. Further in situ hybridization analyses demonstrated strict co-expression of NtmybAS and gPAL1 in the tapetum and stomium. Despite abundant expression ofNtmybAS transcripts in mature pollen,gPAL1 transcripts were not detectable in pollen. Our data demonstrate that NtMYBAS1 is a functional anther-specific transcription factor, which is likely to be a positive regulator ofgPAL1 expression and phenylpropanoid synthesis in sporophytic, but not in gametophytic, tissues of the anther.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid.

The aim of the present study was to provide useful background information and evidence of the functionality of the maize Activator/Dissociation (Ac/Ds) system in hexaploid wheat. Two transgenic parental wheat lines, one harbouring the immobilised Ac element (iAc) and the other the Ds element (pUbi[Ds-uidA]bar), were crossed. Transient GUS assays confirmed that the iAc transposase is active in hexaploid wheat. Selected F1 and F2 lines were analysed by PCR using primers specific to Ac, uidA and bar genes. The primer pair Ubi/bar-tag was used to detect excision of the Ds-uidA sequence, which occurred at a frequency of 39% in the F1 generation. Lines free of Ac and showing evidence of Ds excision were subject to Southern analysis, which indicated that at least one transposition event might have occurred in these lines. Although more evidence is required to unequivocally support the reintegration of the Ds element in the wheat genome, the evidence presented here nevertheless demonstrates the effectiveness and potential value of using this system to tag genes in wheat.

A genomic clone of a wheat α-amylase gene (λAmy3/33) was identified, on the basis of hybridisation properties, as different from α-Amy1 and α-Amy2 genes which had been characterised previously. The nucleotide sequence revealed that this gene has the normal sequence motifs of an active gene and an open reading frame interrupted by two introns. The protein sequence encoded by this open reading frame is recognisably similar to that of α-amylase from the α-Amy1 and α-Amy2 genes and there is high sequence homology in all three proteins at the putative active sites and Ca++ binding region. In addition, the introns are at positions equivalent to the position of introns in the α-Amy1 and α-Amy2 genes. However, the sequence was less similar to α-Amy1 and α-Amy2 than these are to each other. Southern blot analysis showed that the λAmy3/33 DNA is one of a small multigene family carried on a different chromosome (group 5) from either the α-Amy1 or α-Amy2 genes. A further difference from the α-Amy1 and α-Amy2 genes was the pattern of expression. λAmy3/33 was expressed only in immature grains and, unlike the α-Amy1 and α-Amy2 genes, not at all in germinating aleurones. These data suggested therefore that this gene represents a third type of α-amylase gene, not described before, which shares a common evolutionary ancestor with the α-Amy1 and α-Amy2 genes.

Pea chloroplast DNA and cloned restriction fragments of pea chloroplast DNA have been used as templates in a cell-free coupled transcription-translation system from E. coli and have been shown to direct the synthesis of a 39 kD polypeptide related to cytochrome f (37.3 kD). The product was shown to be similar to cytochrome f by immunoprecipitation with specific antibodies and by peptide mapping of the products of limited chymotrypsin digestion. The structural gene for this higher molecular weight form of cytochrome f has been located within a 3.3 kbp BglII fragment situated 18 kbp from the single 16S rRNA gene.

The genes for four subunits of the chloroplast ATP synthase, alpha, beta and epsilon of CF1 and subunit III of CF0, have been located in pea chloroplast DNA using hybridisation of fragments of genes for homologous wheat ATP synthase subunits and cell-free coupled transcription-translation of pea chloroplast DNA or cloned restriction fragments. The genes are arranged in two clusters, which are 50 kbp apart. The gene for the beta subunit is located close to that for the epsilon subunit and the gene for the alpha subunit is approximately 2 kbp away from that for the CF0 subunit III gene. The genes for the alpha subunit and the CF0 subunit III are transcribed in the same direction. The beta subunit gene is close to the gene for the large subunit of ribulose 1,5-bisphosphate (RuBP) carboxylase but the two genes are transcribed divergently. The arrangement of the genes in two clusters is similar to that found in other plant species, although pea chloroplast DNA has no large inverted repeat sequence and has undergone extensive rearrangements relative to chloroplast DNAs which contain the large inverted repeat sequences.

The alpha-Amy2 genes of wheat are a multigene family which is expressed in the aleurone cells of germinating grain under control of the plant hormone gibberellin. A subset of the genes are also expressed in developing grain. Comparison of five genomic clones containing alpha-Amy2 genes, using DNA sequence analysis and Southern hybridisation, showed that the extent of similarity between genes differed. Two of the most heterogeneous genes compared were located to the same group 7 chromosome while the most similar genes alpha-Amy2/54 and alpha-Amy2/8 were located to different ones; hence sequence variation could not be correlated to the ancestry of the alpha-Amy2 genes during the separate existence of the constituent genomes of hexaploid wheat. Expression of the cloned genes was measured using an S1 nuclease protection assay and this identified alpha-Amy2/54 and alpha-Amy2/8 as part of the subset of alpha-Amy2 genes expressed in both the developing grain and in aleurone cells. Comparison of the 5' upstream regions of all five genes showed high similarity, with the exception of one gene, up to -280 nucleotides from the transcriptional start, while similarity between alpha-Amy2/54 and alpha-Amy2/8 extended a further 90 bp upstream of this point. It is suggested that regulatory elements responsible for tissue specificity and gibberellin regulation may be located within these regions of similarity.

The gene for CF(0) subunit I of ATP synthase has been located in wheat chloroplast DNA, between the genes for CF(0) subunit III and alpha subunit of CF(1). Nucleotide sequencing and analysis of RNA-DNA hybrids indicated that the gene is interrupted by an 823-bp intron which has boundaries similar to those previously described for the introns in protein-coding chloroplast genes of Euglena gracilis. The deduced amino acid sequence of CF(0) subunit I indicates a polypeptide of 183 amino acid residues. However, N-terminal amino acid sequencing of the mature spinach CF(0) subunit I suggests that the protein is synthesised with a N-terminal extension of 17 amino acid residues and is processed to give a protein of mol. wt. 19 001 of 166 amino acids residues. The mature CF(0) subunit I shows similarities in primary and predicted secondary structure to F(0) subunit b of Escherichia coli ATP synthase. A major transcript of 3.3 kb containing sequences from the genes for CF(0) subunit III, subunit I and CF(1) subunit alpha has been observed by RNA-DNA hybridisation.

DNA from pea and tobacco chloroplasts hybridizes specifically with probes derived from the gene for a membrane component, the a subunit of ATP synthase of the cyanobacterium, Synechococcus 6301. DNA sequence of the hybridizing region of the pea plastid DNA has revealed that it encodes a protein of 247 amino acids related in sequence to the a subunits of ATP synthase of Escherichia coli, Synechococcus and mitochondria. This is the sixth component of chloroplast ATP synthase that is plastid coded. The gene is located upstream from the genes for three other ATP synthase subunits and a transcript of 6 kb contains coding sequences from each of these genes. Thus the subunit a gene is part of a co-transcribed cluster of four ATP synthase genes arranged in the order a:c(or III):b(or I):alpha. Two other ATP synthase genes, those for beta and epsilon subunits, are known to form a separate cluster. These gene arrangements are most closely related to those found in the cyanobacterium, Synechococcus 6301. Hence, this finding provides strong evidence for a common origin for cyanobacteria and plant chloroplasts.

Summary Free asparagine is the precursor for acrylamide, which forms during the baking, toasting and high‐temperature processing of foods made from wheat. In this study, CRISPR/Cas9 was used to knock out the asparagine synthetase gene, TaASN2, of wheat (Triticum aestivum) cv. Cadenza. A 4‐gRNA polycistronic gene was introduced into wheat embryos by particle bombardment and plants were regenerated. T1 plants derived from 11 of 14 T0 plants were shown to carry edits. Most edits were deletions (up to 173 base pairs), but there were also some single base pair insertions and substitutions. Editing continued beyond the T1 generation. Free asparagine concentrations in the grain of plants carrying edits in all six TaASN2 alleles (both alleles in each genome) were substantially reduced compared with wildtype, with one plant showing a more than 90 % reduction in the T2 seeds. A plant containing edits only in the A genome alleles showed a smaller reduction in free asparagine concentration in the grain, but the concentration was still lower than in wildtype. Free asparagine concentration in the edited plants was also reduced as a proportion of the free amino acid pool. Free asparagine concentration in the T3 seeds remained substantially lower in the edited lines than wildtype, although it was higher than in the T2 seeds, possibly due to stress. In contrast, the concentrations of free glutamine, glutamate and aspartate were all higher in the edited lines than wildtype. Low asparagine seeds showed poor germination but this could be overcome by exogenous application of asparagine.

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from Arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1–2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1–2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.