Search

A citricultura brasileira lidera o mercado de exportação mundial. A tristeza dos citros é uma doença endêmica causada pelo Citrus tristeza virus (CTV), que é transmitido pelo pulgão preto dos citros, Toxoptera citricida (Kirkaldy). O controle da tristeza é feito, principalmente, pela utilização de porta-enxertos tolerantes ao CTV. Este trabalho teve como objetivo avaliar o comportamento de 50 híbridos de porta-enxerto de citros, gerados pelo Programa de Melhoramento Genético de Citros da Embrapa Mandioca e Fruticultura, quanto à infecção natural pelo CTV. Amostras de cada híbrido foram coletadas no campo experimental e casas teladas da Embrapa em Cruz das Almas. A mostra estava composta por 10 ramos novos, coletados em diferentes quadrantes da planta, que foram avaliados quanto à presença de caneluras por escala de notas: 1. Ausência de caneluras; 2. Presença de caneluras esparsas; 3. Número intermediário de caneluras; 4. Várias caneluras superficiais ou poucas caneluras profundas; 5. Toda a superfície do ramo coberta por caneluras superficiais ou profundas. A avaliação da infecção pelo CTV foi realizada no Laboratório de Biologia Molecular do Campo Avançado da Embrapa no CETAB/Seagri-BA. As amostras inicialmente foram avaliadas por sorologia, utilizando a técnica de ELISA indireto, com antissoro policlonal contra o CTV. Entretanto, as amostras que apresentaram resultados negativos no teste sorológico, foram também avaliadas por RT-PCR. Para tanto, foi realizada a extração de dsRNA a partir da casca de ramos de cada amostra. A extração de dsRNA foi feita com nitrogênio líquido e o precipitado final foi ressuspendindo em 50ul de água livre de RNAse, tratados com DNAse (Promega®). Na reação de transcrição reversa (RT) foi utilizada a enzima M-MLV (Promega®), de acordo com as recomendações do fabricante. Utilizou-se nessa etapa 5ul do dsRNA obtido, primer randômico (250ng/ul), dNTP (10mM), tampão M-MLV, RNase out e M- MLV, totalizando um volume de 25ul. Para PCR, utilizou-se 3ul do DNA obtido na RT, dNTP (2,5mM), tampão Tris/KCl (10x), MgCl2 (50mM), Taq polimerase (5U/ul) e os primers específicos para o CTV F- CN119 (5’ AGATCTACCATGGACGACGAAACAAAG3’) e R-CN120 (5’ GAATTCGCGGCCGCTCAACGTGTGTTAAATTTCC 3’), para um volume final de 25ul. O ciclo de reação adotado foi de 94°C/2min, 55°C/30seg e 72°C/1min, respectivamente. A maioria dos híbridos avaliados foi suscetível ao CTV, mas não desenvolveram os sintomas de canelura, sendo considerados tolerantes ao patógeno. Significado e impacto do trabalho: Apesar de atualmente controlada, a tristeza dos citros constitui ainda uma ameaça aos produtores de citros, já que é endêmica no Brasil. Diante desse fato, a avaliação do comportamento de híbridos gerados pelo Programa de Melhoramento Genético de Citros da Embrapa em relação ao CTV, é uma etapa determinante na seleção de novas variedades.

RESUMO A meleira do mamoeiro é considerada um dos maiores problemas fitossanitários da cultura do mamoeiro, mas diversos aspectos da sua epidemiologia ainda são desconhecidos. O objetivo deste trabalho foi determinar o risco e o padrão espaço-temporal da meleira nas condições de cultivo da região extremo sul do estado da Bahia. Foi utilizada a regressão logística para identificar os fatores de riscos associados à ocorrência da meleira na região do extremo sul da Bahia. Para o estudo da distribuição espacial, foram aplicadas as seguintes análises: sequências ordinárias; teste t (student) e áreas isópatas. Os resultados da regressão logística mostraram que o risco de um pomar apresentar meleira sendo consorciado ou consorciado com a cultura do café é maior do que quando estes fatores estão ausentes. Em geral, a meleira evoluiu lentamente do primeiro até o sexto mês de avaliação, com média de até 17,2% de plantas infectadas no sexto mês e chegando até 88% das plantas infectadas em campo ao final da epidemia. Agregação de plantas doentes foi observada em menos da metade das áreas avaliadas. A análise de áreas isópatas indicou uma tendência para início das epidemias a partir das bordas dos pomares e a presença de focos secundários e isolados da doença. ABSTRACT Papaya meleira is considered one of the major phytosanitary problems affecting papaya culture, but several aspects of its epidemiology are still unknown. The objective of this study was to determine the risk and the spatiotemporal pattern of meleira under the cultivation conditions in the far south region of Bahia State, Brazil. Logistic regression was used to identify the risk factors associated with the occurrence of meleira in the far south region of Bahia. For the spatial distribution study, the following analyses were applied: ordinary sequences; t-test (student’s) and isopath areas. The logistic regression results evidenced that the risk that an intercropped orchard, or intercropped with the coffee crop, can show meleira is greater than that in the absence of these factors. In general, meleira evolved slowly from the first to the sixth month of evaluation, showing an average of up to 17.2% infected plants in the sixth month and reaching up to 88% infected plants in the field at the end of the epidemic. Aggregation of diseased plants was observed in less than half of the evaluated areas. Analysis of isopath areas indicated a tendency for the epidemics to start from the edges of orchards and the presence of secondary and isolated foci of the disease.

Caiman latirostris has a large geographic distribution, that includes Argentina, Bolivia, Brazil, Paraguay, and Uruguay. In Brazil illegal hunting and land use change have caused population decline, relatively well documented in the last three decades. Due to such circumstances, the estimate of species effective population size might help analyze its viability. Single-sample estimator was used to estimate current effective population size (Ne) of broad-snouted caiman populations in representative areas of the species range in Brazil. For the analyzes, genotypes previously obtained were used for subpopulations of the captive colony of the University of Sao Paulo (USP) and for wild subpopulations. The microsatellites used were Amiμ8, Amiμ11, Amiμ13, Amiμ20, Claμ2, Claμ5, Claμ6, Claμ7, Claμ8, Claμ9 and Claμ10. The 11 loci analyzed produced 18.27 alleles on average. Wild populations showed significant genic and genotypic differentiation among them (p

Hypnea is a monophyletic genus with a complex nomenclatural and taxonomic history, and is an important commercial source of carrageenan. Phylogenies of this genus have been accessed based primarily on Asian species; however, recent studies performed in South America revealed a great diversity of species, for which phylogenetic relationships need to be evaluated. Three infrageneric sections are recognized in the genus: Pulvinatae, Spinuligerae, and Virgatae; however, morphological and molecular circumscriptions within each section lack clarity. In this study, we analyzed three distinct markers to establish phylogenetic relationships among Hypnea species. To assign each species to the correct section, morphological data were obtained from original descriptions, reference literature, and comparisons with type/topotype and herbaria specimens. Our analyses recovered robust phylogenies for the genus and provided new insights on the taxonomic status and relationships among and within Hypnea species. The combination of three genetic markers increased the resolution and support, resulting in the largest and best-resolved phylogeny of the genus to date. Single and combined analyses revealed that the three sections of the genus Hypnea are taxonomically irrelevant, as currently recognized. Morphological differences are not associated with monophyletic groups and similarities among clades could be better explained by convergent evolution in thallus habit.

The red algal genus Hypnea has a wide geographical distribution along the coast of Brazil, where it has economic and ecological importance. The relatively simple and plastic morphology, often influenced by the conditions of its habitat, complicates the identification of Hypnea species. In the past years, several studies dealing with the taxonomy of Hypnea on the coast of Brazil have changed considerably the known diversity of species in the region. Studies using molecular markers led to the description of new species, while other names were placed in synonymy. In this review, revaluation of the morphology and the addition of new sequences for COI-5P, UPA and rbcL-3P markers were used in order to better understand the diversity of Hypnea species and their range of distribution. An identification key is presented for eleven species of the genus Hypnea occurring on the coast of Brazil: H. brasiliensis P.B. Jesus, Nauer & J.M.C. Nunes, H. cervicornis J. Agardh, H. cornuta (Kutzing) J. Agardh, H. cryptica P.B. Jesus & J.M.C. Nunes, H. edeniana Nauer, Cassano & M.C. Oliveira, H. flava Nauer, Cassano & M.C. Oliveira, H. pseudomusciformis Nauer, Cassano & M.C. Oliveira, H. platyclada P.B. Jesus & J.M.C. Nunes, H. spinella (C. Agardh) Kutzing, H. yokoyana Nauer, Cassano & M.C. Oliveira and H. wynnei Nauer, Cassano & M.C. Oliveira. Of all taxonomic characteristics proposed by earlier studies, the only ones that have taxonomic value considering the species analyzed in this work were: (1) habit of the thallus, (2) main axis, (3) apex shape, (4) form of the branchlets and (5) tetrasporangial sori position in the branches. However, the identification of the species based only on morphological characteristics should be made with caution, once phenotypic plasticity and convergent morphologies are present in the group. The DNA barcode technique, especially the COI-5P marker, proved to be very effective in the identification and delimitation of the species, revealing scenarios that would go unnoticed by morphology alone.

The high endemism, the natural habitat degradation, and the over-collection for ornamental purposes have led some species such as Melocactus paucispinus and M. glaucescens to be threatened with extinction. The use of in vitro conservation techniques, such as slow growth storage, promotes the preservation of genetic diversity with integrity. The goal of this study was to establish a strategy for in vitro conservation of apical segments of the cladode of M. paucispinus and M. glaucescens and evaluate the genetic diversity of individuals from in vitro germinated plants. For such purpose, different concentrations of the plant regulator ancymidol and the osmotic agent sucrose on the inhibition of the in vitro growth were tested, and the genetic diversity of M. paucispinus and M. glaucescens individuals stored in vitro was evaluated. Sucrose showed higher efficiency in the reduction of growth than ancymidol for both species. However, due to the reduction in survival percentage, the use of sucrose over 75 g L− 1 in the in vitro conservation of both species for 360 days is not recommended. In the genetic diversity analysis, 76.92% of polymorphic loci (P), expected heterozygosity (He) = 0.276 and Shannon index (S) = 0.414 were observed for M. paucispinus. For M. glaucescens, the observed values were P = 95.38%, He = 0.228 and S = 0.369. These values observed here were higher than those previously found for the natural populations of these species, which demonstrated that this in vitro collection showed genetic diversity and can be used in management and reintroduction programs of these species.

Piresia, a small genus of herbaceous bamboos, has a geographical disjunction between the Caribbean and northern/western South America and the north-eastern Atlantic Forest in Brazil. Piresia leptophylla is reported from western Amazonia (WA) and the north-eastern Atlantic Forest (NAF), but its occurrence in western Amazonia is questionable. Using an integrative approach, we combined traditional morphological analysis, anatomy and niche modelling. The results revealed few macromorphological differences between WA and NAF specimens (only plant height, leaf length, lodicule dimensions, shape and position), contrasting with consistent differences in leaf anatomy (macrohairs and cruciform silica bodies in the costal zone of the adaxial/abaxial leaf surfaces, crenate silica bodies on the abaxial leaf surface, lack of panicoid hairs on the abaxial leaf surface, bicellular microhairs and lobed papillae over the abaxial leaf surface, and sparse but elongated fusoid cells in the mesophyll of WA specimens) and in niche patterns. The anatomical/micromorphological characters suggest environmental adaptations to the Amazonian and ‘restinga’ forests, respectively. We therefore propose the segregation of the WA populations into a new species, Piresia tenella sp. nov. We provide a formal description, photographs, a line illustration, a distribution map and discussion of the conservation status for the new species.

Anomochlooideae (Poaceae) represent the earliest-diverging extant lineage of grasses. One of the two genera is the monotypic Anomochloa, which is extremely rare and restricted to the Atlantic Forest of southern Bahia state in Brazil, where only two natural populations have been recorded to date. Knowledge of A. marantoidea is considered crucial to understanding evolutionary and diversification patterns in Poaceae. Despite this, knowledge of the biology and distribution of A. marantoidea remain incomplete, and thus the conservation of this poorly known species is problematic. We used niche modelling to estimate its current distribution and assess potential ranges in situ to explore new occurrences. In addition, genetic diversity and the factors that disrupt gene flow between populations of this species were estimated using molecular markers. Two new populations were documented; the modelled ecological niche indicates high climatic restriction, but also revealed suitable sites for the establishment of new populations. Genetic diversity is correlated to population size, and genetic structure analysis suggests recent fragmentation and low gene flow among the remaining populations, which exhibit high levels of inbreeding. These levels also indicate the capacity of A. marantoidea to respond favourably to selection and, thus, that a conservation plan could be designed to maintain the current genetic diversity.

Discocactus zehntneri subsp. petr-halfari, an endangered taxon, is represented by a single population in an anthropized area of Bahia, Brazil, where it is suffering due to extreme extractivism. Thus, information about this cactus, such as its reproductive patterns, is urgently needed to support conservation strategies. A population genetics approach was used to determine if this subspecies has a preferential pattern of reproduction. We sampled 18 individuals, both with and without connection to parental plants, from five clumps and assessed their diversity and genetic structure using five ISSR markers. The results revealed two clumps that are genetically supported by the presence of genetically equal individuals. The other three groups presented individuals that are genetically different and similar to individuals in other clumps. These findings suggest that this subspecies has sexual and clonal reproduction and that its environmental distribution might be shaped by events of dispersion. In addition, a possible hybrid origin may explain its rates of genetic diversity. Despite all these factors, this taxon is in danger and so the development of conservation strategies to preserve its population are urgently needed, including in situ and ex situ actions such as the micropropagation in vitro, living collections and cryopreservation.

The simple and convergent morphologies of many red algae make these species difficult to identify using traditional morphological characters. Many cryptic species have been described in recent year...

Hypnea pseudomusciformis was recently described from South America, and has three morphological variants: “musciformis”, “nigrescens”, and “valentiae”. Information on the biology of these variants may help to explain this species’ wide morphological variation despite the absence of genetic divergence among variants. More morphological and ecological data has accumulated on the “musciformis” variant occurring on the Brazilian coast than for the others. In this study, we described the reproductive morphology of a tropical “nigrescens” population and investigated its phenology to provide crucial biological information about this taxon, and perhaps also assist in answering questions about the systematics of H. pseudomusciformis variants. The population analyzed showed no significant fluctuations in its total biomass throughout the year. All reproductive stages were frequently recorded during this study, which contributes greatly to our knowledge of the reproductive morphology of the “nigrescens” variant. Phenological variations were correlated with environment variables, such as air and sea-surface temperatures, insolation, precipitation, and humidity. Male gametophytes were frequently present, which has never been reported for the “musciformis” variant. We showed that, despite being members of the same genetic species, the “nigrescens” and “musciformis” morphological variants exhibit remarkable differences in their ecology and biology.

Echinolaena and Ichnanthus are two tropical grass genera distributed mostly in the Americas, characterized by the presence of rachilla appendages in the shape of convex swellings, scars or wings at the base of the upper anthecium. However, recent studies have shown that rachilla appendages arose several times independently in several groups within Paniceae and Paspaleae (Panicoideae). Thus, this study aimed to assess the monophyly of Echinolaena and Ichnanthus and their relationship to other genera of Paniceae and Paspaleae, especially those including species with rachilla appendages. Parsimony and Bayesian analyses of the cpDNA regions ndhF, rpl16, trnH-(rps19)-psbA, trnL-trnF, trnS-(psbZ)-trnG, and the rDNA ITS region included 29 of the 39 known species of Echinolaena and Ichnanthus, 23 of which were sampled for the first time. The multiple loci analyses indicated that Echinolaena and Ichnanthus are polyphyletic in their current circumscriptions, with species in four distinct lineages within subtribe Paspalinae, each one characterized by a single type of rachilla appendage. Thus, Echinolaena and Ichnanthus are each circumscribed in a narrow sense, and the other two lineages excluded from them are proposed as the new genera Hildaea and Oedochloa, resulting in 15 new combinations and the restablishment of I. oplismenoides Munro ex Döll.

Hypnea stellulifera was, until now, considered endemic to tropical Asia. Here, we report for the first time the expansion of its distribution to the Atlantic Ocean on the basis of collections from the northeast of Brazil. Comparison of morphological features of our specimens with Asian specimens of H. stellulifera and molecular data analysis allow us to confirm its identification. Samples analyzed in this study represent the first assessment of Hypnea sequences collected in a tropical area from South America. Among the three genes analyzed (the mitochondrial cox1 and the plastidial UPA and rbcL), UPA was the most conserved, and the cox1 was the most variable marker. Despite this, all three markers were efficient as DNA barcoding markers for Hypnea. In our phylogenetic analysis, H. stellulifera had a sister relationship with the clade that includes H. cornuta, H. musciformis, H. flagelliformis, and H. chordacea. Our results demonstrate that the analysis of Hypnea species collected at large geographic distances and/or in different tropical areas reveals a higher degree of intraspecific variation as well as decreased interspecific divergence among distinct species from closer areas. These findings corroborate the necessity of a combined analysis of morphology and different genetic markers for a better understanding of taxonomy and phylogeny of the genus Hypnea.

The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.

We reconstructed phylogenetic relationships in Leguminosae subfam. Mimosoideae tribe Ingeae using 135 sequences from the nuclear (ITS) and 119 from the plastid (trnL-F) genome, representing 23 of the 36 currently recognized genera in the tribe with newly generated sequences of Blanchetiodendron, Guinetia, Macrosamanea, Thailentadopsis and Viguieranthus and an extensive sampling of Calliandra. Only two of the five Neotropical generic alliances of Barneby & Grimes (1996) were supported as monophyletic. Calliandra is resolved as monophyletic with the inclusion of Guinetia. The five previously proposed sections within Calliandra were not supported by our study. Nevertheless, based on these results, a new infrageneric classifica- tion is proposed for Calliandra, and the African species of the genus are assigned to a new genus, Afrocalliandra. Three new sections are proposed for Calliandra: (1) sect. Tsugoideae based on C. ser. Tsugoideae, with four species from northwestern South America; (2) sect. Septentrionales, with six species distributed in dry areas from the United States to Mexico and (3) sect. Monticola, which consists of species restricted to the Espinhaco range of Brazil; these latter species form a clade with low levels of sequence variation, a potential indicator of the recent diversification of this group.

The effectiveness of different presowing treatments for removing hardseededness in Adenocarpus desertorum, Astragalus gines-lopezii and Hippocrepis grossi, three endemic and threatened perennial leguminous species of Spain, was evaluated. Untreated seeds of all three species were germinated over a range of constant (15, 20 and 25°C) and alternating temperatures (15/25 and 20/30°C) under a 16-hour light photoperiod. A considerable fraction of these seeds had physical dormancy caused by a water-impermeable seed coat. Germination was studied for seeds subjected to different presowing treatments: dry heat, hot water, ultra-low freezing, liquid nitrogen, freeze-thaw and mechanical scarification. The most effective method for promoting germination of Adenocarpus desertorum (two populations) and Astragalus gines-lopezii (two populations) was mechanical scarification with pliers. The highest germination percentages of H. grosii were reached by seeds mechanically scarified and also by seeds stored in an ultra-low freezer for 24 hours. Our data provided useful information in germination protocols for ex situ propagation of these three endemic and threatened species, being the first report on seed germination behaviour of Adenocarpus desertorum and Hippocrepis grosii.

Hypnea has an intricate nomenclatural history due to a wide pantropical distribution and considerable morphological variation. Recent molecular studies have provided further clarification on the systematics of the genus; however, species of uncertain affinities remain due to flawed taxonomic identification. Detailed analyses coupled with literature review indicated a strong relationship among H. aspera, H. cervicornis, H. flexicaulis, and H. tenuis, suggesting a need for further taxonomic studies. Here, we analyzed sequences from two molecular markers (COI-5P and rbcL) and performed several DNA-based delimitation methods (mBGD, ABGD, SPN, PTP and GMYC). These molecular approaches were contrasted with morphological and phylogenetic evidence from type specimens and/or topotype collections of related species under a conservative approach. Our results demonstrate that H. aspera and H. flexicaulis represent heterotypic synonyms of H. cervicornis and indicate the existence of a misidentified Hypnea species, widely distributed on the Brazilian coast, described here as a new species: H. brasiliensis. Finally, inconsistencies observed among our results based on six different species delimitation methods evidence the need for adequate sampling and marker choice for different methods.

Cattleya elongata is a rupicolous orchid species spread throughout and endemic to outcrop islands in campo rupestre vegetation of the Chapada Diamantina, northeastern Brazil. We scored nine natural populations of C. elongata for morphological and genetic variability, covering the whole distribution area of the species, using allozymes and ISSR markers and morphometric multivariate analyses. Genetic variability in allozimes was relatively high (H e = 0.12–0.25), and unexpectedly higher than the values based on ISSR (H e = 0.16–0.19). The populations present moderate structuring (allozymes, ΦPT = 0.14; ISSR, ΦPT = 0.18) and low inbreeding (allozymes, F IS = 0.06). Genetic similarity among the populations was high in both markers, in spite of the discontinuity of the outcrops of the Chapada Diamantina. We found no particular biogeographical pattern to the distribution of the genetic and morphologic similarity among the populations of C. elongata. We found high morphological variability with moderate differentiation among the populations. We did not find any correlation among genetic, morphological, and geographical distances, and among the variability found in the morphological and genetic markers. The differences observed between the two genetic markers and the various morphological markers examined here indicated that the isolated use of any single parameter of these different populations for conservation planning or management would not consider all of the variability to be found in the species, as found in other Brazilian campos rupestres plants.

This study aimed at selecting determinant morphoagronomic descriptors to characterize and evaluate Physalis angulata L. germplasm. Twelve quantitative and twenty-two qualitative descriptors were analyzed in six accessions of P. angulata coming from the physalis germplasm collection belonging to the State University of Feira de Santana-BA. The selection and discharge of quantitative descriptors was based on the direct selection and on the Singh method, while qualitative descriptors were analyzed through entropy. The statistic analyses were carried out using the GENES and R programs. Ten quantitative descriptors were excluded through direct selection and five through the Singh method. However, only four descriptors were considered redundant by both methods: east-west fruit, weight of five ripe fruits, width of leaf blade and total soluble solids. Although the total soluble solids descriptor was appointed for discharge, it was included in the group of descriptors selected due to its importance in the characterization of physalis fruit. The list of minimum descriptors to describe physalis accessions comprised 15 descriptors: plant height, stem diameter, north-south fruits, number of fruits per plant, leaf blade length, internode length, fruit longitudinal length, fruit transversal length, total soluble solids, growth habit, stem color, leaf margin shape, unripe calyx color, unripe fruit shape and color. These were nine quantitive and six qualitative descriptors, respectively. The discharge of 55.88% of the descriptors did not cause significant loss of information and might allow the reduction of time and resources spent to characterize and evaluate physalis germplasm.

Galeandra is a neotropical genus with its center of diversity in the Amazon region. It comprises approximately 18 species of epiphytic and terrestrial herbs that are easily recognizable by their funnel-shaped labellum. We examined the phylogenetic relationships among species of Galeandra inferred from nucleotide sequences from three plastid (psbA-trnH, rpoB-trnC, and trnS-trnG) and two nuclear (ITS and ETS) DNA regions. The five data matrices were analyzed individually and in combined analyses using parsimony and maximum likelihood. We found that the epiphytic species G. devoniana is sister to the remainder of the genus, and that the other species form two groups, one consisting of epiphytic species and the other composed of terrestrial species. Adaptation to the terrestrial environment from a probable epiphytic ancestor was of great importance in the evolution of Galeandra. The relationships found in this study do not support previous infrageneric classifications.

Chamaecrista Moench is a genus of caesalpinioid legumes with about 330 species mostly from the New World. The phylogeny of the genus was studied using sequence data from nuclear ITS and plastid trnL-F DNA spacers, representing all six sections of Chamaecrista. Separate and combined analyses recovered the same major clades with high bootstrap and posterior probabilities support, except for the subclades of representatives of sections Caliciopsis, Chamaecrista, and Xerocalyx. The monophyly of Chamaecrista was highly supported in all analyses. Sections Apoucouita and Xerocalyx were supported as monophyletic, sect. Absus was paraphyletic and subsect. Baseophyllum was resolved more closely related to species of sections Chamaecrista, Caliciopsis, and Xerocalyx than to subsect. Absus. The monotypic section Grimaldia was embedded within subsect. Absus. Section Chamaecrista was paraphyletic with respect to sections Caliciopsis and Xerocalyx. Our analyses suggest that the diversification patterns in Chamaecrista occurred through an initial shift from rainforest trees to a more diverse clade of savannah shrubs. Within the latter group, two main subclades were recovered: (1) a planaltine and high-mountain clade characterized by absence of extrafloral nectaries and the appearance of sticky glandular hairs; and (2) a mostly herbaceous clade with axillary fascicled inflorescences and reduced chromosome numbers. This last group is more diverse in open grassland areas and includes many colonizers of waste ground.

Chitin synthase (CHS) is a glucosyltransferase that converts UDP-N-acetylglucosamine into chitin, one of the main components of fungal cell wall. Class III chitin synthases act directly in the formation of the cell wall. They catalyze the conversion of the immediate precursor of chitin and are responsible for the majority of chitin synthesis in fungi. As such, they are highly specific molecular targets for drugs that can inhibit the growth and development of fungal pathogens. In this work, we have identified and characterized a chitin synthase gene of Moniliophthora perniciosa (Mopchs) by primer walking. The complete gene sequence is 3,443 bp, interrupted by 13 small introns, and comprises a cDNA with an ORF with 2,739 bp, whose terminal region was experimentally determined, encoding a protein with 913 aa that harbors all the motifs and domains typically found in class III chitin synthases. This is the first report on the characterization of a chitin synthase gene, its mature transcription product, and its putative protein in basidioma and secondary mycelium stages of M. perniciosa, a basidiomycotan fungus that causes witches' broom disease of cacao.

The aim of the present work was to clarify the origin and phylogenetic position of the species belonging to the genus Ilex (Aquifoliaceae), especially the South American species. Phylogenetic relationships of the genus Ilex were investigated using the plastid psbA-trnH intergenic spacer and parsimony and Bayesian analyses. The psbA-trnH intergenic spacer was shown to evolve slowly within Ilex, but a major gap present in this region was useful in the phylogenetic study of the genus. To obtain more potentially parsimonious characters, atpB-rbcL intergenic spacer data were combined with those for psbA-trnH. Many gaps present in the psbA-trnH region were useful in the phylogenetic study of the genus Ilex. The topology of the trees showed that, in general, the clades are strongly related to geographical areas, a fact especially evident in certain different Asian lineages. © 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 182–193.

Introdução: a doença de Huntington (DH) é uma enfermidade neurodegenerativa e de desenvolvimento tardio, autossômica dominante. Declínio cognitivo, coréia, disfunção motora severa e óbito no estágio final, são sintomas que caracterizam a doença. Atualmente, testes moleculares para diagnóstico pré-sintomático estão acessíveis à população em risco, porém implicações éticas permeiam esse tipo de exames. Objetivo: avaliar aspectos atuais da realização de testes genéticos para DH no Brasil por meio de estudo analítico de amostra de laboratórios. Metodologia: foram utilizados questionários semiestruturados enviados a 19 laboratórios que ofereciam testes diagnósticos e preditivos para a doença em suas paginas virtuais, por meio de correio eletrônico, a fim de obter informações sobre a metodologia empregada para os testes, infraestrutura, composição da equipe técnica, sexo dos indivíduos atendidos, percentagem de resultados positivos e cuidados oferecidos ao indivíduo/família antes e após a realização dos exames. Resultados: os laboratórios que aceitaram participar do estudo e responderam ao questionário informaram dispor de uma infraestrutura excelente, em termos de pessoal e equipamentos, atendendo aos requisitos básicos para a realização dos exames utilizando principalmente a técnica da Reação em Cadeia da Polimerase (PCR), na metodologia molecular. O percentual de resultado positivo para DH nos laboratórios pesquisados variou de 30 a 90%, sendo que este último percentual foi apresentado pelo laboratório vinculado a Instituto Público de Ensino Superior que era o único a oferecer acompanhamento psicológico e/ou psiquiátrico antes e após os exames. Conclusão: para promover a ampliação do acesso a esse tipo de teste à população acometida pela doença de Huntington, deve ser estimulada a criação de laboratórios com tecnologia de ponta e a formação de recursos humanos especializados.

A detailed morpho-anatomical study of the genus Hypnea from the state of Bahia is presented. Eight species have been recognized: H. cenomyce , H. cervicornis , H. cornuta , H. musciformis , H. nigrescens , H. platyclada , H. spinella and H. valentiae . An identification key, as well as descriptions, illustrations, comparisons with related taxa and maps of distribution in Bahia for each species, are presented.

The plastid spacer trnD-trnT and the nuclear ribosomal internal transcribed spacer (ITS) were sequenced for 37 samples of herbaceous bamboos (Poaceae: Olyreae), including all Raddia species and allied genera, as well as two members of the woody bamboos (tribes Bambuseae and Arundinarieae), in order to examine their relationships. The sequences were analyzed using maximum parsimony and Bayesian inference. Both the individual and combined analyses of ITS and trnD-trnT supported Olyreae as a monophyletic group. All species of Raddia also formed a well-supported monophyletic group, and combined datasets allowed us to outline some relationships within this group. Individual analyses indicated incongruence regarding the sister group of Raddia, with ITS data weakly indicating Raddiella malmeana whereas trnD-trnT data supported Sucrea maculata in this position. However, the combined analysis supported Sucrea as sister to Raddia, although the monophyly of Sucrea is not well supported. Parodiolyra is paraphyletic to Raddiella in all analyses; Olyra is also paraphyletic, with species of Lithachne, Arberella and Cryptochloa nested within it. Eremitis and Pariana appeared as an isolated clade within Olyreae, and the position of the New Guinean Buergersiochloa remains uncertain within this tribe.

Ichnanthus hoffmannseggii is an annual panicoid grass that occurs in sandy and open areas of Brazil and currently includes I. piresii in its synonymy. However, herbarium and field work led us to question this circumscription. In a previous phylogenetic study, a specimen with morphological affinities to I. hoffmannseggii was recovered as more related to Echinolaena oplismenoides (currently I. oplismenoides ). This study aimed to clarify the relationship between I. hoffmannseggii , I. oplismenoides , and I. piresii using molecular and macro- and micromorphological data. We recognize these three taxa as distinct species and provide characters for distinguishing them and related species, including descriptions, comments, illustrations, distribution maps, SEM images of the upper anthecium, and phylogenetic relationships.

O objetivo deste trabalho foi avaliar, por meio de marcadores SSR, a diversidade genética de Xylella fastidiosa no Estado da Bahia. Foram estudadas duas das principais regiões produtoras de citros no Estado, o Litoral Norte e o Recôncavo Sul. Para fins comparativos, utilizaram-se dez amostras provenientes do Estado de São Paulo. Foram empregados os seguintes iniciadores: ASSR20, OSSR9, OSSR17, CSSR4, CSSR12 e CSSR20, dos quais os quatro últimos permitiram identificar 22 loci polimórficos. As populações de X. fastidiosa presentes em citros no Estado da Bahia apresentam elevada diversidade genética, com base nos marcadores SSR, com pools gênicos distintos e agrupamento geográfico. No Litoral Norte, as populações do isolado apresentam maior diversidade genética do que as da região do Recôncavo Sul da Bahia.