Search

Lily (Lilium asiatica) is an important plant grown for its range of flower colors and heavy scent. In March 2024, potyvirus-like symptoms consisting of light-yellow mottling and mosaic were noticed on 12/20 lily plants in a private property in Weslaco, Hidalgo County, Texas. Two symptomatic plants (WTX1 and WTX2) were sampled randomly for virus diagnosis. The leaf extracts of both samples were negative for the potyvirus group using Agdia's Poty ImmunoStrip® (Agdia, Inc., Elkhart, IN, USA). However, rub-inoculation of the extracts onto healthy Nicotiana benthamiana and Vigna unguiculata plants (n=4, each) induced mild mottle symptoms on the systemic leaves of both herbaceous test plants 20 to 28 days post inoculation, indicating the presence of a mechanically transmissible agent in the samples. No virus-like symptoms were observed on the mock-inoculated plants (n=1, each) of both species. To test for suspected potyvirus infection, 2-µg of total nucleic acid extracts (Dellaporta et al. 1983) from WTX1 and WTX2 were used for complimentary DNA (cDNA) synthesis with Oligo(dT) primer and the PrimeScript 1st strand cDNA synthesis kit (Takara Bio, USA). One microliter aliquot of each cDNA served as template in 12.5-µl conventional PCR reaction volumes with 5 U Taq polymerase (Roche Diagnostics, Indianapolis, IN), and two pairs of degenerate primers targeting the partial cylindrical inclusion (CI) gene and the helper component protease (HC-Pro) of potyviruses (Ha et al. 2008). The expected ~700-bp DNA product of each gene target was amplified from both samples. The amplicons were excised, gel eluted (Zymoclean™ Gel DNA Recovery kit) and cloned individually into the pJET1.2/Blunt vector (Life Technologies). Recombinant plasmids from two transformed Escherichia coli cells per cloned DNA insert were Sanger sequenced. BLASTn analysis of each gene-specific nucleotide (nt) sequence fragment revealed their identities (83 to 92 % nt) as lily mottle virus (LMoV; genus Potyvirus) at 93 to 98% query coverage. In pairwise comparison, the obtained sequences of LMoV isolates from TX specific to the CI (GenBank accession nos. PQ037260-61) and the HC-Pro (PQ037262-63) shared ~99% nt and 100% amino acid (aa) identities with each other and ~91-92% nt and 98-100% aa identities with the closest isolate, Bate5 (JN127341) from Australia. Based on these results, a pair of LMoV-specific primers (LM_v109-F: 5'-GGCCAGTAATGTGCACAAGC-3' and LM_c527-R: 5'-TCGCTGTAGCTAGCGACGTAC-3') was newly designed to target the partial CI gene, internal to the 700-bp fragment obtained above with the generic primers. The primer pair was used to screen each of the mechanically inoculated test plants by RT-PCR as previously described above. The expected 438-bp fragment of the LMoV CI gene was amplified from all the inoculated plants of both N. benthamiana and V. unguiculata; the results were confirmed by Sanger sequencing as described above. The mock-inoculated plant of each experimental host plant tested negative for LMoV. LMoV is a quarantine pest and was previously reported in the U.S. (Brierley and Smith, 1944) and other lily-producing parts of the world, such as the Netherlands, China, Korea, and Brazil. To our knowledge, this is the first confirmed report of the virus in Texas, thus expanding its geographical range. Testing of lily foundation stocks before propagation is essential to prevent further spread of LMoV via planting material.

During the summer of 2022, a cluster of Madagascar periwinkle plants with white and mauve flowers were observed with foliar mild yellow mosaic symptoms on a private property in Harlingen, Cameron County, Texas. The symptoms were reproduced on mechanically inoculated periwinkle and Nicotiana benthamiana plants. Virions of 776 to 849 nm in length and 11.7 to 14.8 nm in width were observed in transmission electron microscopy of leaf dip preparations made from symptomatic periwinkle leaves. High-throughput sequencing (HTS) analysis of total RNA extracts from symptomatic leaves revealed the occurrence of two highly divergent variants of a novel Potyvirus species as the only virus-like sequences present in the sample. The complete genomes of both variants were independently amplified via reverse transcriptase PCR, cloned, and Sanger sequenced. The 5' and 3' of the genomes were acquired using random amplification of cDNA ends methodology. The assembled virus genomes were 9,936 and 9,944 nucleotides (nt) long, and they shared 99.9 to 100% identities with the respective HTS-derived genomes. Each genome encoded hypothetical polyprotein of 3,171 amino acids (aa) (362.6 kilodaltons [kDa]) and 3,173 aa (362.7 kDa), respectively, and they shared 77.3/84.4% nt/aa polyprotein identities, indicating that they represent highly divergent variants of the same Potyvirus species. Both genomes also shared below-species-threshold polyprotein identity levels with the most closely phylogenetically related known potyviruses, thus indicating that they belong to a novel species. The name periwinkle mild yellow mosaic virus (PwMYMV) is given to the potyvirus with complete genomes of 9,936 nt for variant 1 (PwMYMV-1) and 9,944 nt for variant 2 (PwMYMV-2). We propose that PwMYMV be assigned into the genus Potyvirus (family Potyviridae )., Competing Interests: The author(s) declare no conflict of interest.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

Huanglongbing (HLB, citrus greening disease), the most destructive disease affecting citrus production, is primarily linked to the gram-negative, insect-vectored, phloem-inhabiting α-proteobacterium ' Candidatus Liberibacter asiaticus' (CLas). With no effective treatment available, management strategies have largely focused on the use of insecticides in addition to the destruction of infected trees, which are environmentally hazardous and cost-prohibitive for growers, respectively. A major limitation to combating HLB is the inability to isolate CLas in axenic culture, which hinders in vitro studies and creates a need for robust in situ CLas detection and visualization methods. The aim of this study was to investigate the efficacy of a nutritional program-based approach for HLB treatment, and to explore the effectiveness of an enhanced immunodetection method to detect CLas-infected tissues. To achieve this, four different biologically enhanced nutritional programs (bENPs; P1, P2, P3, and P4) were tested on CLas-infected citrus trees. Structured illumination microscopy preceded by a modified immunolabeling process and transmission electron microscopy were used to show treatment-dependent reduction of CLas cells in phloem tissues. No sieve pore plugging was seen in the leaves of P2 trees. This was accompanied by an 80% annual increase in fruit number per tree and 1,503 (611 upregulated and 892 downregulated) differentially expressed genes. These included an MLRQ subunit gene, UDP-glucose transferase, and genes associated with the alpha-amino linolenic acid metabolism pathway in P2 trees. Taken together, the results highlight a major role for bENPs as a viable, sustainable, and cost effective option for HLB management., Competing Interests: S. N. Makam and C. Nwugo (consultant) were employed by ILSRC, a BioFlora research division, while all other co-authors were independent university collaborators who helped to evaluate bENP products from Bioflora. No consultancy terms or employment agreement exists that will affect the paper contents or views.

Investigations conducted during the spring 2020 season to diagnose the associated viral agent of a severe mosaic disease of wheat in a Texas Panhandle field revealed the presence of wheat Eqlid mosaic virus (WEqMV; genus Tritimovirus, family Potyviridae) in the analyzed samples. The complete genome sequences of two WEqMV isolates were determined, and each was found to be 9,634 nucleotides (nt) in length (excluding the polyA tail) and to contain 5' and 3' untranslated regions of 135 nt and 169 nt, respectively, based on rapid amplification of cDNA ends (RACE) assays. Both sequences contained an open reading frame (ORF) of 9,330 nt encoding a polyprotein of 3,109 amino acids (aa). The ORF sequences of the two isolates were 100% identical to each other, but only 74.7% identical to that of the exemplar WEqMV-Iran isolate, with 85.7% aa sequence identity in the encoded polyprotein. The Texas WEqMV isolates also diverged significantly from WEqMV-Iran in the individual proteins at the nt and aa levels. This is the first report of WEqMV in the United States and the first report of this virus outside of Iran, indicating an expansion of its geographical range., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Crinum sp. (family Amaryllidaceae ) is an ornamental flower bulb that is commonly called crinum lily, cape lily, cemetery plant, spider lily, and swamp lily. In April 2023, two plants of Crinum sp. var. Maiden's Blush with yellow stripe symptoms (Fig. S1) were submitted to the Texas Plant Virus Diagnostic Laboratory, Weslaco, TX for virus diagnosis. Due to the resemblance of the observed symptoms to those described for potyviruses infecting ornamental flower bulbs (Pearson et al. 2009), total RNA extracts were made from each sample using the SpectrumTM Plant Total RNA Kit (Sigma-Aldrich, USA), according to the manufacturer's protocol. Complementary DNA (cDNA) was synthesized from 2 µg total RNA per sample with Oligo(dT) primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio, USA) as recommended by the manufacturer. A 2µL aliquot of each cDNA template was initially subjected to PCR using the generic primer pair CIFor/CIRev (Ha et al., 2008) that targets a fragment of the cylindrical inclusion (CI) body of potyviruses. The expected ~700 bp DNA band was amplified from both samples using the Taq DNA polymerase, dNTPack kit (Sigma-Aldrich). The amplicons were cloned and sequenced (three recombinant clones per sample) as described by Hernandez et al. (2021) and the BLASTX analyses of the consensus sequence (GenBank acc. no. OR137018) returned significant hits only to nerine yellow stripe virus (NeYSV; Potyvirus , Potyviridae ) at 100% query coverage. To further confirm the results, another pair of universal primers (Jordan et al. 2011) was used to amplify the expected ∼1,600 bp product specific to the partial nuclear inclusion body (NIb), coat protein (CP) cistron, and 3' untranslated region of potyviruses from the same samples. The amplicons were similarly cloned, and a consensus sequence obtained (OR137019). In pairwise comparisons, the partial CI sequence of NeYSV from Texas (NeYSV-TX; OR137018) shared 83% nucleotide (nt)/93% amino acids (aa) identities with the corresponding sequences of NeYSV isolate 63 (MT396083) from the United Kingdom. The partial (649 nt) NIb sequences of NeYSV-TX (OR137019) and the complete CP (OR137019) of NeYSV-TX shared 77-94%/88-94% and 83-99%/89-98% nt/aa identities with the corresponding sequences of global NeYSV isolates that were retrieved from GenBank. Phylogenetic analysis revealed a closer relationship between NeYSV-TX and the isolates Stenomesson (EU042758) and DC (MG012805) from the Netherlands and USA, respectively based on the partial NIb and CP cistrons (Fig. S2), suggesting that NeYSV-TX may have been introduced from foreign and/or domestic sources. NeYSV has been documented previously from the United Kingdom, the Netherlands, Australia, New Zealand, and India; its first report from the United States was a decade ago from Amaryllis belladonna in California (Guaragna et al. 2013). To the best of our knowledge, this is the first report of NeYSV in Texas, thus expanding the geographical range of the virus in the USA. Anecdotal information from the sample submitter implicated infected crinum lily bulbs as the likely source of NeYSV introduction into the property, with subsequent vegetative propagation of plants resulting in 100% incidence of symptomatic lilies (n>100) over time. Thus, the results underscore the importance of ensuring that only virus-free vegetative plant materials are distributed and propagated by florists to curtail virus spread.

As significant threats to global citrus production, Diaphorina citri (Kuwayama; Hemiptera: Psyllidae) and Trioza erytreae (Del Guercio; Hemiptera: Triozidae) have caused considerable losses to citrus trees globally. Diaphorina citri vectors "Candidatus Liberibacter asiaticus" and "Ca. L. americanus", whereas T. erytreae transmits "Ca. L. africanus" and "Ca. L. asiaticus", the pathogens responsible for citrus greening disease or Huanglongbing (HLB). Though HLB is a destructive disease of citrus wherever it occurs, information on the occurrence and geographical distribution of its vectors in Africa is limited. In recent surveys to determine if HLB vectors are present in Ghana, we observed eggs, nymphs, and adults of insects suspected to be D. citri and T. erytreae. Using morphological traits and DNA analyses, the identity of the suspected insects was confirmed to be D. citri and T. erytreae. Individuals of D. citri and T. erytreae were examined using qPCR for CLaf, CLam, and CLas, but none of them tested positive for any of the Liberibacter species. Herein we report, for the first time, the presence of D. citri and T. erytreae in Ghana (West Africa). We discuss the implications of this new threat to the citrus industry to formulate appropriate management strategies., (© 2023. The Author(s).)

The Asian citrus psyllid (ACP), Diaphorina citri, was detected for the first time in the Republic of Benin, West Africa. The ACP is a known vector of Candidatus Liberibacter asiaticus (CLas), the putative causal agent of the devastating Huanglongbing (HLB; citrus greening disease). During visual surveys, ACP was only observed on residential citrus trees in southern Benin, but not in residential areas or commercial groves in the central and northern parts of the country. Its identity was confirmed morphologically and molecularly via DNA barcoding with published primers. Analysis of the obtained sequences showed that the ACP recorded in Benin clustered with the ones previously reported from Nigeria, suggesting a common origin of both populations. The ACP samples from Benin also carried Ca. Carsonella ruddii and Ca. Profftella armatura, two commonly found ACP endosymbionts. However, all the sampled ACP individuals tested negative for Ca. Liberibacter africanus, Ca. Liberibacter americanus, and CLas by quantitative polymerase chain reaction. This is the second report of the ACP in West Africa after Nigeria, the eastern bordering country of the Republic of Benin. Benin has an expanding commercial citrus industry, especially in the southern part of the country. Although the ACP samples tested negative for the HLB associated bacteria, the detection of ACP in the country requires swift actions including area-wide surveys to determine the extent of spread of this pest and the implementation of eradication or control efforts to prevent its establishment and spread of HLB in the country., (© 2023. The Author(s).)

The production of common bean ( Phaseolus vulgaris L.) is adversely affected by virus-like diseases globally, but little is known about the occurrence, distribution, and diversity of common bean-infecting viruses in Zambia. Consequently, field surveys were conducted during the 2018 season in 128 fields across six provinces of Zambia and 640 common bean leaf tissue samples were collected with ( n = 585) or without ( n = 55) symptoms. The prevalence of symptomatic fields was 100%, but incidence of symptomatic plants ranged from 32 to 67.5%. Metagenomic analyses of nine composite samples and a single plant sample of interest revealed the occurrence of isolates of Bean common mosaic necrosis virus , Bean common mosaic virus , Cowpea aphid - borne mosaic virus , Peanut mottle virus , Southern bean mosaic virus (SBMV), Cucumber mosaic virus , Phaseolus vulgaris alphaendornavirus 1 (PvEV-1), PvEV-2, Ethiopian tobacco bushy top virus (ETBTV), and a novel strain of Cowpea polerovirus 1 (CPPV1-Pv) of 5,902 nt in length. While CPPV1-Pv was consistently detected in mixed infection with ETBTV and its satellite RNA molecule, based on results of mechanical transmission assays it does not appear to be involved in disease etiology, suggesting that its role may be limited to being a helper virus for the umbravirus. Screening of the survey samples by real-time PCR for the viruses detected by high-throughput sequencing revealed the prevalence of single (65.2% or 417/640) over mixed (1.9% or 12/640) infections in the samples. SBMV was the most frequently detected virus, occurring in ∼29.4% (188/640) of the samples and at a prevalence rate of 58.6% (75/128) across fields. The results showed that diverse virus species are present in Zambian common bean fields and the information will be useful for the management of common bean viral diseases.

Sickle cell disease (SCD), also known as sickle cell anemia (SCA) is one of the structural hemoglobinopathies that occurs due to a single nucleotide mutation from GAG to GTG, which changes the amino acid of a β-globin chain of hemoglobin (Hb) from glutamate to valine. This singular mutation results to disorderliness in red blood cells (RBCs) with advent of changes in RBC morphology and other pathological conditions. In the 1980s, intermittent red blood cell transfusions, opioids, and penicillin prophylaxis were the only available therapy for SCA and were commonly reserved for acute, life threatening complications. So far, the US Food and Drug Administration (FDA) has granted a total of four drugs approval for the prophylaxis and treatment of the clinical complications of SCD. Due to limitations (adherence, safety, adverse effects) of existing therapies in the prophylaxis and treatment of SCD complications in Nigerian children and their inaccessibility to approved drugs, the present study discusses the therapeutic effects of readily available functional food as one of the therapies or an adjunct therapy to tackle the sickle cell crisis in Nigerian Children., Competing Interests: The authors declare no conflict of interest., (© 2022 The Author(s).)

' Candidatus Liberibacter asiaticus' (Las) is the prominent species of Liberibacter associated with huanglongbing, a devastating disease of citrus worldwide. In this study, we report the identification of an ∼8.3-kb DNA region of the Las genome containing eight putative open reading frames flanked by two inverted repeats, which was not present in the Las str. psy62 genome. Comparisons with other genome sequences established this region as a unique genetic element associated with genome plasticity/instability. Primers specific for both the presence (Las wild type) and absence (Las mutant) of this region were designed to study the population dynamics and host adaptation of the two strains. Las populations with and/or without the wild-type strain were detected and differentiated in >2,300 samples that included psyllids, periwinkle, and several species of citrus. In psyllids, although a mixed population of the wild type and mutant was observed in most samples (88%), the wild-type Las was detected alone at a rate of 11%. In contrast, none of the infected citrus plants were positive for the wild type alone, which harbored either the mutant strain alone (8%) or a mixed population of the mutant and wild type (92%). Furthermore, the dynamics of these two major Las populations varied with different citrus hosts, whereas an in-depth study on grapefruit that did not rapidly succumb to disease revealed that the population of mutant alone increased with time, indicating that the absence of this genetic element is associated with the fitness of Las in planta under the selection pressure of its host.

Olea europaea geminivirus (OEGV) from olive accessions in Italy was characterized recently. OEGV was also detected during routine high-throughput sequencing screening of olive (cv. Leccino) material, and its complete bipartite genome segments were sequenced and shown to be 100% identical to those of the isolate from Italy. Using two pairs of newly designed primers targeting the AV1 and BV1 genes, OEGV was detected in randomly sampled olive trees from the U.S. Department of Agriculture National Clonal Germplasm Repository (USDA-NCGR) (21.4% or 6/28), commercial and residential settings in California (47.6% or 10/21), and an orchard in Texas (60% or 30/50). The cuttings for the USDA-NCGR-positive trees originated from the former Serbia and Montenegro, Spain, Italy, and Greece. Comparative analysis of the directly sequenced gene fragments from randomly selected samples showed that OEGV isolates from the different sources were 100% identical to each other. The results indicate that OEGV spread was likely facilitated by inadvertent movement of contaminated olive germplasm., (© 2021. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Cotton leafroll dwarf virus (CLRDV) was first reported in the United States (US) in 2017 from cotton plants in Alabama (AL) and has become widespread in cotton-growing states of the southern US. To investigate the genomic variability among CLRDV isolates in the US, complete genomes of the virus were obtained from infected cotton plants displaying mild to severe symptoms from AL, Florida, and Texas. Eight CLRDV genomes were determined, ranging in size from 5865 to 5867 bp, and shared highest nucleotide identity with other CLRDV isolates in the US, at 95.9-98.7%. Open reading frame (ORF) 0, encoding the P0 silencing suppressor, was the most variable gene, sharing 88.5-99.6% and 81.2-89.3% amino acid similarity with CLRDV isolates reported in cotton growing states in the US and in Argentina and Brazil in South America, respectively. Based on Bayesian analysis, the complete CLRDV genomes from cotton in the US formed a monophyletic group comprising three relatively divergent sister clades, whereas CLRDV genotypes from South America clustered as closely related sister-groups, separate from US isolates, patterns reminiscent of phylogeographical structuring. The CLRDV isolates exhibited a complex pattern of recombination, with most breakpoints evident in ORFs 2 and 3, and ORF5. Despite extensive nucleotide diversity among all available CLRDV genomes, purifying selection ( dN/dS < 1) was implicated as the primary selective force acting on viral protein evolution.

In 2012, dormant canes of a proprietary wine grape ( Vitis vinifera L.) accession were included in the collection of the University of California-Davis Foundation Plant Services. No virus-like symptoms were elicited when bud chips from propagated own-rooted canes of the accession were graft-inoculated onto a panel of biological indicators. However, chlorotic ringspot symptoms were observed on sap-inoculated Chenopodium amaranticolor Coste & A. Rein and C. quinoa Willd. plants, indicating the presence of a mechanically transmissible virus. Transmission electron microscopy of virus preparations from symptomatic C. quinoa revealed spherical, nonenveloped virions about 27 nm in diameter. Nepovirus-like haplotypes of sequence contigs were detected in both the source grape accession and symptomatic C. quinoa plants via high-throughput sequencing. A novel bipartite nepovirus-like genome was assembled from these contigs, and the termini of each RNA segment were verified by rapid amplification of complementary DNA ends assays. The RNA1 (7,186-nt) of the virus encodes a large polyprotein 1 of 231.1 kDa, and the RNA2 (4,460-nt) encodes a large polyprotein 2 of 148.9 kDa. Each of the polyadenylated RNA segments is flanked by 5'- (RNA1 = 156-nt; RNA2 = 170-nt) and 3'- (RNA1 = 834-nt; RNA2 = 261-nt) untranslated region sequences with >90% identities. Maximum likelihood phylogenetic analyses of the conserved Pro-Pol amino acid sequences revealed the clustering of the new virus within the genus Nepovirus of the family Secoviridae. Considering its biological and molecular characteristics, and based on current taxonomic criteria, we propose that the novel virus, named grapevine nepovirus A, be assigned to the genus Nepovirus .

Virus diseases are major constraints to the production of cucurbits in the Texas Lower Rio Grande Valley. In September 2020, a ~8.1 ha butternut squash ( Cucurbita moschata ) field in Hidalgo County, Texas, was observed with virus-like symptoms of vein yellowing, leaf curl, mosaic, and foliar chlorosis. The proportion of plants with virus-like symptoms in this field was estimated at 30% and seven samples (symptomatic = 5; non-symptomatic = 2) were collected randomly for virus diagnosis. Initially, equimolar mixtures of total nucleic acid extracts (Dellaporta et. al. 1983) from two symptomatic samples from this field and extracts from 12 additional symptomatic samples from six other fields across south and central Texas was used to generate one composite sample for diagnosis by high throughput sequencing (HTS). The TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina) was used to construct cDNA library from the composite sample, which was then sequenced on the Illumina NextSeq 500 platform. More than 26 million single-end HTS reads (75 nt each) were obtained and their bioinformatic analyses (Al Rwahnih et al. 2018) revealed several virus-like contigs belonging to different species (data not shown). Among them, 6 contigs that ranged in length from 429 to 3,834 nt shared 96 to 100% identities with isolates of squash vein yellowing virus (SqVYV), genus Ipomovirus , family Potyviridae . To confirm the HTS results, total nucleic acid extracts from the cucurbit samples from all seven fields (n = 46) were used for cDNA synthesis with random hexamers and the PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio). A 1-μL aliquot of cDNA was used in 12.5-μL PCR reaction volumes with PrimeSTAR GXL DNA Polymerase (Takara Bio) and two pairs of SqVYV-specific primers designed based on the HTS derived contigs. The primer pairs SqYVV-v4762: 5'-CTGGATTCTGCTGGAAGATCA & SqYVV-c5512: 5'-CCACCATTAAGGCCATCAAAC and SqYVV-v8478: 5'-TTTCTGGGCAAACAAACATGG & SqYVV-c9715: 5'-TTCAGCGACGTCAAGTGAG targeted ~0.75 kb and ~1.2 kb fragments of the cylindrical inclusion (CI) and the complete coat protein (CP) gene sequences of SqVYV, respectively. The expected DNA band sizes were obtained only from the five symptomatic butternut squash samples from the Hidalgo Co. field. Two amplicons per primer pair from two samples were cloned into pJET1.2/Blunt vector (Life Technologies) and bidirectionally Sanger sequenced, generating 753 nt partial CI specific sequences (MW584341-342) and 1,238 nt that encompassed the complete CP (MW584343-344) of SqVYV. In pairwise comparisons, the partial CI sequences shared 100% nt/aa identity with each other and 98-99% nt/aa identity with corresponding sequences of SqVYV isolate IL (KT721735). The CP cistron of TX isolates shared 100% nt/aa identity with each other and 90-98% nt (97-100% aa) identities with corresponding sequences of several SqVYV isolates in GenBank, with isolates IL (KT721735) and Florida (EU259611) being at the high and low spectrum of nt/aa identity values, respectively. This is the first report of SqVYV in Texas, naturally occurring in butternut squash. SqVYV was first discovered in Florida (Adkins et al. 2007) and subsequently reported from few other states in the U.S. (Adkins et al. 2013; Egel and Adkins 2007; Batuman et al. 2015), Puerto Rico (Acevedo et al. 2013), and locations around the world. The finding shows an expansion of the geographical range of SqVYV and adds to the repertoire of cucurbit-infecting viruses in Texas. Further studies are needed to determine the prevalence of SqVYV in Texas cucurbit fields and an assessment of their genetic diversity.

Texas is a major producer of cucurbits such as cantaloupe ( Cucumis melo L.), but outbreaks of virus-like diseases often adversely affect yields. Little is known about the identity of the causal or associated viruses. During studies conducted in fall 2020 to explore the virome of cucurbit fields in Texas, a commercial cantaloupe field (~4.1 ha) in Cameron County was observed with virus-like symptoms of interveinal chlorotic mottle and foliar chlorosis and disease incidence was estimated at 100%. Virus-like symptoms including mosaic and leaf curl were also observed in six additional fields across five south and central Texas counties of Atascosa, Hidalgo, Fort Bend, Frio, and Wharton. Forty-six plants, which included 32 symptomatic and 14 non-symptomatic, were sampled from these fields for virus diagnosis and each sample was subjected to total nucleic acid extraction according to Dellaporta et. al. (1983). Initially, equal amounts of nucleic acids from 14 symptomatic plants (two/field) were pooled into one composite sample for preliminary diagnosis by high throughput sequencing (HTS). The cDNA library obtained from the composite sample with a TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina) was sequenced on the Illumina NextSeq 500 platform, generating ~26.3 M single-end HTS reads (75 nucleotides [nt] each). Analyses of the reads according to Al Rwahnih et al. (2018) revealed several virus-like contigs; among them 23 contigs (206 to 741 nt) shared 98 to 100% nt identities to isolates of cucurbit chlorotic yellows virus (CCYV), genus Crinivirus , family Closteroviridae . Three pairs of CCYV-specific primers were designed from the HTS contigs with primers CCYV-v1330: 5'-AGTCCCTTACCCTGAGATGAA/CCYV-c2369: 5'-CGGAGCATTCGACAACTGAATA targeting ~1 kb fragment of the ORF1a (RNA1), primers CCYV-v4881: 5'-ATAAGGCGGCGACCTAATC/CCYV-c5736: 5'-GATCACTTGACCATCTCCTTCT targeting a ~0.9 kb fragment encompassing the coat protein (CP) cistron of CCYV (RNA2), and primers CCYV-v6362: 5'-CACCTCTTCCAGAACCAGTTAAA/CCYV-c7423: 5'-TGGGAACAACTTATTTCTCCTAGC targeting ~1 kb spanning partial minor coat protein (CPm) and p26 sequences (RNA2). Total nucleic acid extracts of each of the 46 samples from the seven fields were tested by two-step reverse transcription polymerase chain reaction using all three CCYV-specific primer pairs and they yielded amplicons of expected sizes from all five symptomatic cantaloupe samples from the Cameron County field and one additional symptomatic butternut squash sample from a field in Hidalgo County. The DNA bands from three randomly chosen cantaloupe samples were cloned and sequenced as previously described (Oke et al. 2020). In pairwise comparisons, the obtained 1,040 nt ORF1a (MW584332-334), 753 nt complete CP (MW584335-337), and 1,062 nt CPm/p26 (MW584338-340) gene specific sequences from the three samples shared 100% nt identity with each other, and 99-100% nt identities with corresponding RNA1 (AB523788) and RNA2 (AB523788) sequences of the exemplar isolate of CCYV. This is the first report of CCYV in Texas, thus expanding the current geographical range of the virus in the U.S. that includes California (Wintermantel et al. 2019) and Georgia (Kavalappara et al. 2021). The abundance of whiteflies of the Bemisia tabaci species complex in south Texas and other major U.S. cucurbit production areas presents additional challenges to virus disease management.

Watermelon ( Citrullus lanatus ) and other cucurbits are cultivated globally, and Texas ranks among its top 5 producers in the U.S. In July 2020, plants with virus-like disease symptoms consisting of mild leaf crinkling and yellow mosaic patterns were observed in a 174-ha watermelon field in Burleson Co., TX; disease incidence was visually estimated at 5%. Total nucleic acids were extracted from leaf tissues of 5 randomly sampled plants (Dellaporta 1983) and their equimolar amounts were made into a composite sample that was used for cDNA library construction with TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina). The cDNA library was sequenced on the Illumina NextSeq 500 platform, generating ~37M single-end reads (each 75 nt), which were analyzed as per Al Rwahnih et al. (2018). Of these, 58,200 and 27,500 reads mapped to the genomes of watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2 (Xin et al. 2017), respectively, along with 4 other virus-specific reads (data not shown). The near complete RNA1-RNA3 segments of WCLaV-1 (354-652X) and WCLaV-2 (144-258X) were generated from the mapped reads and they shared ≥96% nt identities with published RNA segments of both viruses. The results were verified by RT-PCR using newly designed primers WCLaV-1vRP: 5'-GGTGAGTTAGTGTGTCTGAAGG/WCLaV-1cRP: 5'-GAGGTTGCCTGAGGTGATAAG to target 881 bp of the RNA1-encoded RNA-dependent RNA polymerase (RdRP), WCLaV-1vMP: 5'-GAAGGTTTGCTCCCTTGAAATG/WCLaV-1cMP: 5'-GACTGTGGCTGAAGAGTCTATG target 538 bp of the RNA2-encoded movement protein (MP), and WCLaV-1vNP: 5'-CGAATAGACTCTGGAGGGTAGA/WCLaV-1cMP: 5'-GAAAGCAAGAAAGCTGGCTAAA target 786 bp of the RNA3-encoded nucleoprotein (NP). Similarly, the WWCLaV-2-specific primers WCLaV-2vRP: 5'-GTCTCACATTCCTGCACTAACT/WCLaV-2cRP: 5'-ATCGGTCCTGGGTTATTTGTATC target 968 bp of the RdRP, WCLaV-2vMP: 5'-GACTTCAGAACCTCAACATCCA/WCLaV-2cMP: 5'-CAAGGGAGAGTGCTGACAAA target 562 bp of the MP, and WCLaV-2vNP: 5'-ATTCCCAGTGAGAGCAACAA/WCLaV-2cMP: 5'-GAGGTGGAGGTAGGAAAGAAAG target 449 bp of the NP. Fresh cDNA synthesized from the 5 samples with PrimeScript First Strand cDNA synthesis kit (Takara Bio) were tested by PCR with all 6 primer pairs using the PrimeSTAR GXL DNA Polymerase kit (Takara Bio). Three of the 5 samples were positive for both viruses and one sample was positive for each virus. The obtained products from 4 samples were cloned individually into pJET1.2/Blunt vector (Thermo Scientific, USA), followed by bidirectional Sanger-sequencing of the plasmids with the GenElute Five-Minute Plasmid Miniprep kit (Sigma-Aldrich). In pairwise comparisons, the partial RNA1-RNA3 sequences of WCLaV-1 (GenBank accession nos. MW559074-82) shared 100% nt/aa identities with each other and with corresponding sequences of WCLaV-1 isolate KF-1 from China (KY781184-86). The partial RNA1-RNA3 sequences of WCLaV-2 (MW559083-91) shared 97-100% nt/96-100% aa identities with each other and with corresponding sequences of WCLaV-2 isolate KF-15 from China (KY781187-89). This is the first report of WCLaV-1 and WCLaV-2 in Texas and the first record of both viruses in the U.S. and elsewhere outside of China. Both negative-sense, single-stranded RNA viruses represent a novel taxon in the family Phenuiviridae (order Bunyavirales ) (Xin et al. 2017). While aspects of the biology of both viruses are yet to be elucidated, our results expand their geographical range. The detection primers developed here will be useful for screening cucurbits germplasm to avert their spread.

During surveys for common bean viruses in Central Province of Zambia in April 2018, symptoms of bushy top, deep green curled branches and patchy leaf chlorosis were observed on five plants in a 2-ha farmer's field. Total RNA was isolated from symptomatic leaf samples using the CTAB method (Chang et al. 1993). The RNA from one sample (CP414-1) was used to construct a cDNA library with the Illumina TruSeq RNA Library Prep Kit (Illumina, San Diego, CA), followed by high-throughput sequencing (HTS) on the Illumina MiSeq platform that generated ~3.1M single-end raw reads of ~300 nucleotides (nt) each. A total of 355,885 reads showed hits to Ethiopian tobacco bushy top virus (ETBTV; Umbravirus), ETBTV satellite RNA (satRNA) and peanut mottle virus (PeMoV, Potyvirus) based on BLASTn analysis. The full-length genomes of ETBTV (4239-nt; MT225089), its satRNA (521-nt; MT225092) and PeMoV (9,643-nt) were assembled from the HTS reads using Geneious R11.1.2 (Biomatters, Auckland, New Zealand). The obtained complete genome sequences of ETBTV (MT225089) and ETBTV satRNA (MT225092) shared 88% and 95% nt identities, respectively with the corresponding viral (KJ918748) and satRNA (KJ918747) sequences of isolate 18-2 (Abraham et al. 2014). The near complete PeMoV genome was 89% identical to isolate Liaoning (MH270528). The HTS results were validated by two-step RT-PCR analyses of the five field-collected samples using newly designed primer pairs (data not shown). All five samples gave the expected 988-bp ETBTV-specific and 521-bp satRNA-specific DNA bands while three samples produced the expected 2100-bp PeMoV-specific fragment. The virus specificities of the agent specific PCR fragments were ascertained by Sanger sequencing (ETBTV: MT225090-91; ETBTV satRNA: MT225093-94; PeMoV: MT900843-44) and they shared 98-100% identities with their corresponding HTS-derived sequences. To further probe for the presence of an ETBTV helper virus, the samples were screened by RT-PCR with the degenerate primer pair Lu1-mod-F/C2R3 that was modified from Robertson et al. (1991). The expected 245-bp DNA bands was obtained from all five samples, indicating the presence of a possible luteovirus or polerovirus target in these samples. The BLASTn analyses of the two Sanger sequenced gel-eluted products (MT900845-46) showed that they shared 100% identity with each other and 96% nt identity with cowpea polerovirus 1 (CPPV1, KX599163). Leaf tissue extracts from a common bean plant that was confirmed by RT-PCR to be positive for all four agents were rub-inoculated onto Nicotiana occidentalis and common bean (Sutter Pink) plants (n=5 each) at the three fully expanded leaf stage, with a buffer inoculation as control. Systemic foliar symptoms consisting of leaf deformation, stunting and leaf bushy top were observed on all ten plants, 10 days post-inoculation whereas the control plants remained symptomless. All the test plants were screened by RT-PCR as described above. The results showed that all five N. occidentalis plants were positive for ETBTV+ETBTVsatRNA, the five common bean plants tested positive for ETBTV+satRNA+PeMoV, and all 10 plants of both species were negative for CPPV1. To the best of our knowledge, this is the first report of ETBTV, ETBTV satRNA and CPPV1 infecting common bean in Zambia, and the first molecular based confirmation of PeMoV occurrence in the country. Ongoing studies are focused on determining the extent of the disease spread and assessment of its economic impact.

Phytophthora -induced foot rot, also known as gummosis, is an important disease affecting citrus production worldwide. In Texas, the third-largest citrus-producing state in the United States, limited information is available on the etiology and epidemiology of foot rot in commercial orchards. This study comprises a survey of foot rot incidence and severity in Texas and the characterization of Phytophthora isolates associated with the disease. Surveys in 2015 and 2017 of 30 orchards in the Lower Rio Grande Valley (LRGV) region where commercial citrus production is concentrated in the state revealed that foot rot occurred in 97% of the orchards assessed. Overall, foot rot symptoms were observed on 33.7% of the trees evaluated and the disease severity index in the region was rated at 14.2 and 16.5% in 2015 and 2017, respectively. Lesions were mostly present on the scion, while the rootstock (sour orange) was not affected. Phytophthora nicotianae was the only Phytophthora sp. isolated from the surveyed orchards and from five additional residential sites on the Texas Coastal Bend (TCB). Sporangia and chlamydospores from 34 representative LRGV isolates of P. nicotianae were larger than those of TCB isolates. In both LRGV and TCB, A1 and A2 mating types were present in the same location, albeit the A2 mating type was more prevalent. All isolates were sensitive to mefenoxam (50% inhibition in the presence of mefenoxam [EC 50 ] < 0.5 µg/ml), except for one TCB isolate (EC 50 = 143.6 µg/ml). Our research indicates that treatment for Phytophthora foot rot in the region is necessary and, although mefenoxam is still useful, alternating chemistries for resistance management are required.

The complete genome sequences of two grapevine virus L (GVL) isolates collected from the wine grape cultivar Blanc du Bois (Vitis spp.: 'Florida D 6-148'×'Cardinal') in Texas were determined. The two genome sequences (excluding the polyA tail) were each 7594 nucleotide long and 99.7% identical to each other, but they shared only ~74% identity with those of previously published GVL isolates. Further analysis showed that the two Texas GVL isolates also diverged significantly from previously published isolates of the virus in each of the five ORFs at both the nucleotide and amino acid level, indicating that they represent a new phylogroup of this virus.

The Asian citrus psyllid (ACP; Diaphorina citri) is the vector of Candidatus Liberibacter asiaticus (CLas) that is associated with the devastating Huanglongbing (HLB; citrus greening disease). This pest of Asian origin has spread into the Americas and more recently into a few countries in East Africa. During recent surveys, suspect ACP adults and nymphs were recorded for the first time infesting citrus trees in southwest Nigeria. Morphological identification and DNA barcoding confirmed the samples to be D. citri. Analysis of the obtained sequences revealed that the ACP recorded in Nigeria clustered with other taxa in the previously identified B1 clade that consists of populations from different continents. The presence of the endosymbionts Ca. Carsonella ruddii and Ca. Profftella armatura in ACP from Nigeria was also confirmed by PCR and Sanger sequencing. The ACP individuals were assayed for the presence of CLaf, CLam and CLas by qPCR, but none of the insects tested positive for any of the Liberibacters. The prolific nature of ACP and the tropical climate prevailing in the citrus-producing areas of Nigeria and other West African countries may favor its rapid spread and population increase, thus posing a grave threat to the sustainability of citriculture in these countries.

Huanglongbing (HLB, citrus greening disease) in the major citrus-producing states of the United States is associated with Candidatus Liberibacter asiaticus (CLas), which is vectored by the Asian citrus psyllid (ACP). Surveys were conducted in Texas from 2007 to 2017 to assess the prevalence and titer of CLas in ACPs and citrus trees. ACP and citrus leaf tissue samples were collected from suspect trees in residential areas and commercial groves (orchards) and assayed for CLas by quantitative PCR. CLas detection in ACPs (2011) preceded that of citrus trees (2012) by several months. Annual incidences of CLas-positive ACPs and leaf tissue followed an exponential growth pattern over the survey period, varying from 0.03 to 28.7% in ACPs and 0.6 to 36.5% in citrus trees. There was a significant and positive relationship between the monthly incidences of CLas-positive ACP and leaf tissue samples. The proportion of HLB detection sites also increased with time, reaching 26 and 40% of commercial groves and residential sites, respectively, by 2017. Seasonal variations were observed in the incidences of CLas-positive ACPs and citrus trees such that significantly more CLas-positive ACPs and trees were recorded during the fall and winter of a given year relative to the hot summer. A temporal analysis of the class distribution of cycle threshold values revealed a trend of increased bacterial accumulation in ACPs and trees over time, with the trend more pronounced for the former than the latter host type. These findings provide a comprehensive insight into the ongoing CLas/HLB epidemic in Texas, with potential lessons for California and other citrus-producing areas where the disease is not yet established.

A virus-like disease characterized by foliar yellow blotch symptoms and resembling those described for cilantro yellow blotch disease in California was observed in a 4.05-ha cilantro ( Coriandrum sativum ) cv. Santo field in Hidalgo County, Texas during spring 2019. Disease incidence at harvest was estimated at ∼20%, and the affected plants were rendered unmarketable. Foliar systemic chlorosis symptoms were observed on sap-inoculated Nicotiana occidentalis plants ( n = 3) using inocula from symptomatic cilantro. Total RNA aliquots from 11 randomly collected leaf tissue samples (symptomatic = 7, asymptomatic = 4) were pooled into a composite cilantro RNA sample which was analyzed by high throughput sequencing (HTS). Analyses of the obtained 15.7 million raw reads (76 nt each) yielded virus-specific contigs that mapped to the genomes of alfalfa mosaic virus (AMV), beet pseudoyellows virus (BPYV), and lettuce chlorosis virus (LCV). Virus-specific primers designed from the HTS-derived sequences were used to screen the samples in two-step RT-PCR assays, resulting in the detection of AMV+BPYV in 3 of 7 symptomatic cilantro samples, AMV+LCV in 4 of 7 symptomatic cilantro samples, and AMV alone in the 4 asymptomatic cilantro and sap-inoculated N. occidentalis samples. The results represent the first reports of the natural infection of cilantro by BPYV and LCV and implicate the mixed infection of a Crinivirus and AMV in cilantro yellow blotch disease.

Background: Up until recently, adoption is the most common alternative to recommended to couples struggling to procreate. However, with the advancement in medical technology, it is now possible to procreate through assisted reproductive technology (ART). Debates continue to ensue on the contentious issues emanating from various ART procedures, for instance regarding surrogacy there are concerns that this fragments womanhood, motherhood and parenthood, and there is a dereliction of the sacredness and cultural sanctity of the family system, most especially in an African context. However, as infertility becomes more prevalent among couples trying to have children in Nigeria, it has become important that alternate mediums of reproduction be examined within the socio-cultural milieu of the country. This study set out to examine surrogacy as a panacea to infertility in Nigeria through a qualitative lens. Methods: 15 stakeholders (traditional birth attendants, medical gynaecologists and legal professionals within the social, medico-legal framework of reproductive health) in Nigeria were engaged in an in-depth interview to unravel the challenges surrogacy might or is encountering as an ART in Nigeria. Results : There are various social, traditional, cultural and religious beliefs that police the reproductive sphere of Nigeria, which has grave implications on fertility treatment. These socio-cultural and religious factors do not provide a fertile ground for surrogacy to thrive in Nigeria. Hence, it is important that the socio-cultural framing of reproducing in Nigeria become receptive to modern medical reproductive alternatives and innovations. Conclusions: For surrogacy to permeate the reproductive terrain of the country there is a need to jettison several socio-cultural and religious sentimental beliefs policing reproduction in Nigeria., Competing Interests: No competing interests were disclosed., (Copyright: © 2020 Alabi OJ.)

Background: Surrogacy might be a reproductive process that brings joy and fulfilment to many, but it also brings with it numerous ethical and legal concerns; it raises questions about the fundamental human rights, welfare and wellbeing of women and infants, especially within a context where it is barely regulated. This article examines the perception of surrogacy within the socio-cultural context of Nigeria. It brings to the fore various socio-cultural concerns that question the influence of surrogacy as a reproductive process on womanhood, motherhood and parenthood. It discusses, by analysing the narratives of the participants, how the surrogacy process is a dereliction of the sacredness and cultural sanctity of the family system, most especially in an African context. Methods: Fifteen (15) stakeholders (traditional birth attendants, medical gynaecologists and legal professionals within the social, medico-legal framework of reproductive health) in Nigeria were engaged in in-depth interviews to unravel the challenges which surrogacy might be facing or encountering as an ART in Nigeria. Results : There are various social, traditional, cultural, and religious beliefs that police the reproductive sphere of Nigeria, which have grave implications on fertility treatment. These socio-cultural and religious factors do not provide a fertile ground for surrogacy to thrive in Nigeria. Hence, it is important that the socio-cultural framing of reproducing in Nigeria become receptive to modern medical reproductive alternatives and innovations. Conclusions: For surrogacy to permeate the reproductive terrain of the country there is a need to jettison several socio-cultural and religious sentimental beliefs policing reproduction in Nigeria., Competing Interests: No competing interests were disclosed., (Copyright: © 2020 Alabi OJ.)

Background: Surrogacy might be a reproductive process that brings joy and fulfilment to many but it also brings with it numerous ethical and legal concerns; it raises questions about the fundamental human rights, welfare and wellbeing of women and infants especially within a context where it is barely regulated. This article examines the perception of surrogacy within the Yoruba socio-cultural context in Ado-Ekiti, Nigeria. It brings to the fore various socio-cultural concerns that questions the influence of surrogacy as a reproductive process on womanhood, motherhood and parenthood. It discusses by analysing the narratives of participants how surrogacy process is a dereliction of the sacredness and cultural sanctity of the family system, most especially in an African context. Methods: 15 stakeholders (traditional birth attendants and gynaecologists) were engaged in an in-depth interview to unravel the challenges surrogacy might or is encountering within the socio-cultural context of Ado-Ekiti. Results : There are various social, cultural and religious beliefs that police the reproductive sphere of the Yoruba socio-cultural group, which has grave implications on fertility treatment. These socio-cultural and religious factors do not provide a fertile ground for surrogacy to thrive within the study location. Hence, it is important that the socio-cultural framing of reproduction within this cultural context become receptive to medical reproductive solutions and innovations if at all the processes are to thrive or at least become less stigmatised. Conclusions: The process of surrogacy is very complex and people's attitude towards the practice is greatly influenced by their culture, religion and social belief systems about what is considered appropriate for procreation. Also, it is important to have clear-cut policy regulating surrogacy and all forms of ARTs in Nigeria, as this will protect women and infants, as well as, ensure that they are not to exposed abuse, commercialization and exploitation., Competing Interests: No competing interests were disclosed., (Copyright: © 2021 Alabi OJ.)

A novel virus with a (+) single-stranded RNA genome was detected by high-throughput sequencing (HTS) in a sample of grapevine (Vitis vinifera) cv. Kizil Sapak (sample/isolate 127) that originated from Turkmenistan. The complete genome of the virus, tentatively named "grapevine Kizil Sapak virus" (GKSV), is 7,604 nucleotides in length, excluding the poly(A) tail. The genome organization of GKSV, encoded genes, and sequence domains are typical for members of the family Betaflexiviridae, specifically those belonging to the subfamily Trivirinae. Phylogenetic analysis placed GKSV within the subfamily Trivirinae, in the same clade as fig latent virus 1 (FLV-1) but distinct from the clades formed by members of other genera. A comparative analysis of GKSV-127 with the HTS-derived sequences obtained from two additional isolates showed that they are genetic variants of the same virus species. Based on current ICTV species and genus demarcation criteria, and the results of the sequence and phylogenetic analyses, we propose that GKSV and FLV-1 represent a new genus within the subfamily Trivirinae.

Maize yellow mosaic virus (MaYMV; genus Polerovirus ; family Luteoviridae ) was recently characterized from maize in China and subsequently detected in mixed infection with sugarcane mosaic virus (genus Potyvirus ; family Potyviridae ) in sugarcane and itch grass in Nigeria. This study was conducted to understand the status and genetic diversity of MaYMV in maize fields in the northern guinea savannah region of Nigeria. A survey was conducted in 2017 and maize (n = 90) and itch grass (n = 10) plants suspected of virus infection based on appearance of mosaic and/or yellowing symptoms were sampled in Kaduna (n = 65) and Katsina (n = 35) states. The samples were screened individually by reverse transcription polymerase chain reaction using the genus-specific primers targeting poleroviruses and potyviruses Pol-G-F and Pol-G-R primers encompassing the partial P1-P2 fusion protein and coat protein genes of poleroviruses and primer pair CI-For & CI-Rev encompassing the partial cylindrical inclusion proteins of most potyviruses. A subset of amplified DNA fragments was cloned, Sanger-sequenced, and the obtained sequences were bioinformatically analyzed along with corresponding sequences from GenBank. The ~ 1.1 Kb polerovirus fragment was detected in 32.2% (29/90) of the maize samples while all 10 itch grass samples tested negative. BLASTN analysis of sequences derived from six polerovirus samples confirmed the virus identity as MaYMV. In pairwise comparisons, the MaYMV sequences derived in this study shared 97-99% nucleotide identity with sequences of other MaYMV isolates available in the NCBI GenBank. Phylogenetic analysis revealed the segregation of global MaYMV sequences into three host-independent clusters with pattern of geographic structuring., (© Indian Virological Society 2019.)

Gender and educational equality have been extensively debated by scholars in South Africa, researchers have failed to capitalize on why enthusiastic postgraduate female students have a higher dropout rate than their male counterparts. This study has capitalized on this vacuity, via a phenomenological lens, to examine the challenges experienced by female postgraduate students at University of KwaZulu-Natal. This study presents the lived experiences of ten female postgraduate honours students from University of KwaZulu-Natal in 2017. The study sought to research the learner's impetus to pursue postgraduate studies and the limitations eminent during the process. The ostensive constraints acknowledged by participants have seeped in socio-cultural beliefs rooted in traditional and religious affirmations, financial impediments and balancing their educational pursuit with traditional role expectations within their gendered familial domain. This study advances the requirement to critique the socio-cultural principles that impede females' succession in postgraduate studies while simultaneously engaging in discourse on the concealed practices in higher educational institutions separating students based on gender., (© 2019 Published by Elsevier Ltd.)

This study was aimed at investigating the effect of internal and external social capital on the financial and non-financial performance of businesses in the Nigerian informal sector. The study further investigated the controlling role of firm age. A cross-sectional survey of 650 informal business owners in the Ikeja region of Lagos state, Nigeria was carried out. The analysis was carried out using the partial least square method of the structural equation model (SEM). Findings revealed that without the controlling variable of firm age, social capital had a significant effect on business performance, internal social capital had a significant effect on non-financial performance, it, however, had no significant effect on financial performance, while external social capital had no significant effect on financial and non-financial performance. With the controlling variable of firm age, social capital had a significant effect on business performance, internal social capital had a significant effect on financial and non-financial performance, while external social capital had no significant effect on financial and non-performance. The study, therefore, recommended that informal entrepreneurs take advantage of their internal social capital resources and also try to build their external social capital as they may become vital for their business success.

A novel ssRNA (+) virus with molecular properties typical of members of the genus Vitivirus (family Betaflexiviridae; subfamily Trivirinae) was discovered by high-throughput sequencing in samples of the American hybrid bunch grape cultivar Blanc du Bois in Texas. The results were independently confirmed by Sanger sequencing of the virus isolate, whose genome length is 7,387 nt, excluding the polyA tail. The genome sequence contains five ORFs that are homologous and phylogenetically related to ORFs of grapevine-infecting vitiviruses. The name "grapevine virus M" is proposed for this new virus, whose sequence divergence exceeds the current ICTV species demarcation threshold for the genus Vitivirus.

Maize and sugarcane are two economically important crops often grown in adjacent fields or co-cultivated in the northern guinea savannah agroecological zone, a major cereal production region of Nigeria. This study was conducted to determine the prevalence of mosaic disease in sugarcane and maize fields in the northern guinea savannah agroecological zone and to molecularly characterize the associated sugarcane mosaic virus (SCMV, genus Potyvirus ) isolates. Surveys were conducted from June to July 2015, and sugarcane mosaic disease (SCMD) incidence was assessed across 21 farmer's fields. Mean SCMD incidence varied across states with ∼82% (308/376), ∼66% (143/218), and ∼67% (36/54) recorded in Kaduna, Kano, and Katsina states, respectively. RT-PCR analysis of 415 field-collected samples using genus-specific primers confirmed potyvirus infection in 63.7% (156/245) of sugarcane, 29.7% (42/141) of maize crops, and 45% (13/29) of itch grass samples. Cloning and sequencing of gene-specific DNA amplicons from a subset of 45 samples (sugarcane = 33, maize = 9, itch grass = 3) confirmed their specificities to SCMV. Phylogenetic analysis of the partial gene sequences showed that they all belong to a single monophyletic clade of SCMV. These results were supported by analysis of complete polyprotein sequences of representative maize and sugarcane isolates from Nigeria. Both isolates shared 94.9%/97.3% complete polyprotein nucleotide (nt)/amino acid (aa) identities with each other and 75.2%/97.6% nt/aa identities with corresponding sequences of global SCMV isolates. The detection of identical populations of SCMV isolates in both crop species and a weed host suggests possible vector mediated interspecies spread within cereal landscapes in the study area with implications for the integrated and sustainable management of SCMD in cereal cropping systems in Nigeria.

Background: Even though maternal mortality, which is a pregnancy-related death is preventable, it has continued to increase in many nations of the world, especially in the African countries of the sub-Saharan regions caused by factors which include a low level of socioeconomic development., Aim: This paper focuses on cogent issues affecting maternal mortality by unpacking its precipitating factors and examining the maternal health care system in Nigeria., Methods: Contemporary works of literature were reviewed, and the functionalist perspective served as a theoretical guide to examine the interrelated functions of several sectors of the society to the outcome of maternal mortality., Results: It was noted that apart from the medical related causes (direct and indirect) of maternal mortality, certain socio-cultural and socioeconomic factors influence the outcome of pregnancy. Also, a poor health care system, which is a consequent of weak social structure, is a contributing factor., Conclusion: As a result, maternal mortality has debilitating effects on the socioeconomic development of any nation. It is therefore pertinent for the government to improve maternal health and eradicate poverty to ensure sustainable development.

Increased use of metagenomics for routine virus diagnosis has led to the characterization of several genus level geminiviruses from tree fruit long thought to exclusively host RNA viruses. In this study, the identification and molecular characterization of a novel geminivirus is reported for the first time in Prunus spp. The virus, provisionally named Prunus geminivirus A (PrGVA), was identified by Illumina sequencing from an asymptomatic plum tree. PrGVA was subsequently confirmed by rolling cycle amplification, cloning, and Sanger sequencing of its complete genome (3,174 to 3,176 nucleotides) from an additional 18 (9 apricot and 9 plum) field isolates. Apart from the nonanucleotide motif TAATATT↓AC present in its virion strand origin of replication, other conserved motifs of PrGVA support its geminiviral origin. PrGVA shared highest complete genome (73 to 74%), coat protein amino acid (83 to 85%) and rep-associated amino acid (74%) identities with Grapevine red blotch virus (GRBV). PrGVA was graft but not mechanically transmissible. Quantitative polymerase chain reaction screening of Prunus spp. in the National Clonal Germplasm Repository collection using newly designed primers and probes revealed 69.4% (apricot), 55.8% (plum), and 8.3% (cherry) incidences of PrGVA. PrGVA is proposed as a novel member of the genus Grablovirus based on its close genome and phylogenetic relationship with GRBV.

A diagnostic survey was conducted in July 2017 in two northern districts of Zambia to investigate presence or absence of cassava brown streak disease (CBSD) and its causal viruses. In total, 29 cassava fields were surveyed and cassava leaf samples were collected from 116 plants (92 symptomatic and 24 nonsymptomatic). CBSD prevalence was approximately 79% (23 of 29) across fields. Mean CBSD incidence varied across fields but averaged 32.3% while mean disease severity was 2.3 on a 1-to-5 rating scale. Reverse-transcription polymerase chain reaction screening of all 116 samples with one generic and two species-specific primer pairs yielded DNA bands of the expected sizes from all symptomatic plants with the generic (785 bp) and Ugandan cassava brown streak virus (UCBSV)-specific (440 bp) primers. All 24 nonsymptomatic samples were negative for UCBSV and all samples tested negative with primers targeting Cassava brown streak virus. The complete genome of a representative isolate of UCBSV (WP282) was determined to be 9,050 nucleotides in length, minus the poly A tail. A comparative analysis of this isolate with global virus isolates revealed its nature as a sequence variant of UCBSV sharing 94 and 96% maximum complete polyprotein nucleotide and amino acid identities, respectively, with isolates from Malawi (MF379362) and Tanzania (FJ039520). This is the first report of CBSD and UCBSV in Zambia, thus expanding the geographical distribution of the disease and its causal virus and further reinforcing the need to strengthen national and regional phytosanitary programs in Africa.

Huanglongbing is a devastating disease of citrus. In this study, a comprehensive profile of phloem sap amino acids (AA) in four permissive host plants of Candidatus Liberibacter asiaticus (CLas) and three non-permissive Rutaceae plants was conducted to gain a better understanding of host factors that may promote or suppress the bacterium. The AA profiles of Diaphorina citri nymphs and adults were similarly analyzed. A total of 38 unique AAs were detected in phloem sap of the various plants and D. citri samples, with phloem sap of young shoots containing more AAs and at higher concentrations than their mature counterparts. All AAs detected in phloem sap of non-permissive plants were also present in CLas -permissive hosts plus additional AAs in the latter class of plants. However, the relative composition of 18 commonly shared AAs varied between CLas -permissive hosts and non-permissive plants. Multivariate analysis with a partial least square discriminant methodology revealed a total of 12 AAs as major factors affecting CLas host status, of which seven were positively related to CLas tolerance/resistance and five positively associated with CLas susceptibility. Most of the AAs positively associated with CLas susceptibility were predominantly of the glutamate family, notably stressed-induced AAs such as arginine, GABA and proline. In contrast, AAs positively correlated with CLas tolerance/resistance were mainly of the serine family. Further analysis revealed that whereas the relative proportions of AAs positively associated with CLas susceptibility did not vary with host developmental stages, those associated with CLas tolerance/resistance increased with flush shoot maturity. Significantly, the proline-to-glycine ratio was determined to be an important discriminating factor for CLas permissivity with higher values characteristic of CLas -permissive hosts. This ratio could be exploited as a biomarker in HLB-resistance breeding programs.

Severe virus-like symptoms consisting of mosaic, distortion, yellowing, and brittleness were observed on papaya plants in a 20-ha orchard in South Texas during the 2014-15 growing season. Incidence of symptomatic plants increased from ∼40 to 100% within 6 months of the outbreak; the most severely affected plants were stunted, and fruit yield and quality were reduced compared with asymptomatic plants. The orchard papaya plant virome was explored using the Illumina NextSeq 500 platform and results were validated by Sanger DNA sequencing of complete viral genomes obtained by PCR amplification. The combined results revealed the presence of Papaya ringspot virus (PRSV; Potyvirus), Lettuce chlorosis virus (LCV; Crinivirus), and Tomato yellow leaf curl virus-IL (TYLCV-IL; Begomovirus). The RT-PCR analyses of leaves from 51 randomly sampled papaya plants indicated the presence of PRSV, LCV, and TYLCV-IL in 100, 39.2, and 15.7% of the samples, respectively. Plants infected with PRSV, in combination with LCV and/or TYLCV-IL, exhibited more severe symptoms compared with plants infected with PRSV alone. Furthermore, successful whitefly-mediated transmission of TYLCV-IL and LCV was accomplished by exposing virus-free papaya seedlings to viruliferous Bemisia tabaci (Genn.) under greenhouse conditions. The results of this study document a new host record for LCV and the first successful whitefly-mediated transmission of TYLCV-IL and LCV to papaya. As a perennial crop, infected papaya serving as an over-seasoning reservoir for TYLCV-IL and LCV, presents a new challenge to viral disease management in papaya orchards.

Sugarcane and maize plants showing symptoms typical of those described for the so-called "African streak viruses" (AfSVs) were encountered during field surveys conducted from February to July 2015 to document viruses infecting both crops across the northern Guinea savannah region of Nigeria. As part of this study, two categories of complete mastrevirus-like genome sequences were obtained from nine samples (maize = 2; sugarcane = 7). In pairwise comparisons, the full-length genomes of the first sequence category (2,687 nt each; maize = 2; sugarcane = 2) shared 96 to 99% identity with global isolates of the A-strain of maize streak virus (MSV-A), indicating that sugarcane may also serve as a reservoir host to MSV-A. Analysis of the complete genomes belonging to the second sequence category (2,757 nt each; sugarcane = 5) showed that they shared 42 to 67% identity with their closest AfSV relatives, thus indicating that they represent sequences of a novel mastrevirus. Both sequence categories shared 61-62% sequence identity with each other. Further analysis revealed that the novel sugarcane-infecting virus, tentatively named as sugarcane chlorotic streak virus (SCSV), arose from a putative interspecific recombination event involving two grass-infecting mastreviruses, eragrostis streak virus and urochloa streak virus, as putative parental sequences. The results of this study add to the repertoire of diverse AfSVs present in cereal and sugarcane mixed cropping landscapes in the northern Guinea savannah region of Nigeria, with implications for disease epidemiology.

A novel virus was detected in grapevines by Illumina sequencing during the screening of two table grape (Vitis vinifera) accessions, cultivars Black Beet and Nagano Purple, from South Korea. The monopartite circular ssDNA genome sequence was subsequently confirmed by rolling cycle amplification, cloning and Sanger sequencing. The complete viral genomic sequence from both accessions ranged from 2,903 to 2,907 nucleotides in length and contained the conserved nonanucleotide sequence TAATATT↓AC and other sequence features typical of the family Geminiviridae, including two predicted sense and four complementary-sense open reading frames. Phylogenetic analysis placed the novel virus in a unique taxon within the family Geminiviridae. A naturally occurring defective subviral DNA was also discovered. This defective DNA molecule carried a deletion of approximately 46% of the full-length genome. Both the genomic and defective DNA molecules were graft-transmissible although no disease is yet correlated with their occurrence in Vitis spp. The tentative names Grapevine geminivirus A (GGVA) and GGVA defective DNA (GGVA D-DNA) are proposed. PCR assays developed using primers designed in the coat protein gene led to the detection of GGVA in 1.74% of 1,262 vines derived from 15 grapevine cultivars from six countries across three continents.

Studies were conducted to relate the influence of the physical characteristics, leaf nutrient content and phloem sap amino acid concentration of citrus flush shoots on the densities of various Diaphorina citri life stages. Adult D. citri preferentially selected young shoots for feeding and numbers of D. citri immatures were positively correlated with flush shoot softness. Young flush shoots had higher concentrations of macro and micro nutrients relative to mature ones and this was associated with higher densities of all D. citri life stages. All D. citri life stages were positively correlated with higher nitrogen-carbon (N:C), nitrogen:sulfur (N:S) and nitrogen:calcium (N:Ca) ratios in leaf tissue, while densities of adults were negatively related to calcium, manganese and boron levels. Concentrations of total and essential amino acids were highest in phloem sap of young expanding flush shoots in both grapefruit and lemon, but dramatically declined as flush shoots matured. The sulfur-containing amino acids cystine, methionine and taurine occurred only in younger flush shoots. In contrast, cystathionine was only present in phloem sap of mature shoots. These results clearly indicate that young citrus flush shoots are a nutritionally richer diet relative to mature shoots, thus explaining their preference by D. citri for feeding and reproduction. Conversely, tissue hardness and the lower nutritional quality of mature flush shoots may limit oviposition and immature development. The data suggest that both physical characteristics and nutritional composition of flush shoots and their phloem sap are important factors regulating host colonization and behavior of D. citri, and this interaction can impact the dynamics and spread of HLB in citrus groves., Competing Interests: The authors have declared that no competing interests exist.

The Asian citrus psyllid preferentially feeds and exclusively reproduces on young, newly emerged flush shoots of citrus. Asian citrus psyllid nymphs feed and complete their life stages on these flush shoots. Recent studies conducted under greenhouse conditions have shown that the transmission rates of 'Candidatus Liberibacter asiaticus' (CLas), the putative causal agent of huanglongbing disease of citrus, are enhanced when flush shoots are present. However, it is unclear if CLas acquisition by migrant adult Asian citrus psyllids is similarly enhanced. To address this knowledge gap, cohorts of Asian citrus psyllid adults were allowed 1-wk acquisition access period (AAP) on flushing and nonflushing shoots of qPCR-tested symptomatic (CLas+) and asymptomatic (CLas-) 10-yr-old sweet orange trees under field conditions. After the AAP, they were tested for CLas by qPCR. Progeny Asian citrus psyllid adults that emerged 4 wk post-AAP were similarly retrieved and tested. Eighty percent of flushing and 30% of nonflushing CLas+ trees produced infective Asian citrus psyllid adults, indicating that flush shoots have greater potential to be inoculum sources for CLas acquisition. Concomitantly, 21.1% and 6.0% infective adults were retrieved, respectively, from flushing and nonflushing CLas+ trees, indicating that Asian citrus psyllid adults acquire CLas more efficiently from flush shoots relative to mature shoots. In addition, 12.1% of infective Asian citrus psyllid adult progeny were obtained from 70% of flushing CLas+ trees. Significantly lower mean Ct values were also obtained from infective adults retrieved from flushing relative to nonflushing trees. The results underscore the role of flush shoots in CLas acquisition and the need to protect citrus trees from Asian citrus psyllid infestations during flush cycles., (© The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.)

A SYBR(®) Green-based real-time quantitative reverse transcription PCR (qRT-PCR) assay in combination with melt-curve analysis (MCA) was optimized for the detection of nine grapevine viruses. The detection limits for simplex qRT-PCR for all nine grapevine viruses were estimated to be in the range of 214-1112 copies of the virus genome. Amplicons with melting temperatures (Tm) separated by at least 2°C in the MCA could differentiate two viruses in the same reaction. Therefore, eight of the nine viruses could be co-diagnosed in five different combinations of duplex assays. Of 305 grape leaf samples from the field or greenhouse, 162 were positive for at least one of the nine grapevine viruses using the duplex qRT-PCR assays. In contrast, only 127 samples were positive using endpoint RT-PCR and PCR assays, indicating the enhanced sensitivity of duplex real-time PCR. In addition, the duplex qRT-PCR assays were be used to detect Grapevine leafroll associated virus 3 (GLRaV-3) in its vector, the grape mealybug (Pseudococcus maritimus Ehrhorn), and Grapevine red blotch-associated virus (GRBaV) in Virginia creeper leafhopper (Erythroneura ziczac Walsh). The simplex and duplex real-time PCR assays developed in this study can be used to examine transmission of co-occruing viruses by insect vectors as well as for rapid and sensitive detection of viruses in infected grapevines., (Copyright © 2016 Elsevier B.V. All rights reserved.)

A novel virus-like sequence from grapevine was identified by Illumina sequencing. The genomic organization was most similar to that of members of the genus Fabavirus Polyproteins RNA-1 and RNA-2 of the virus tentatively named grapevine fabavirus (GFabV) shared 34 to 23% sequence identities with Broad bean wilt virus 2 (BBWV2), respectively. GFabV was successfully graft transmitted to Vitis vinifera cv. Cabernet Franc., (Copyright © 2016 Al Rwahnih et al.)