Search

Abstract Background Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent–offspring trios and proband only analysis. Methods We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. Results Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. Conclusion CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

Abstract Background Preeclampsia, one of the most lethal pregnancy-related diseases, is associated with the disruption of uterine spiral artery remodeling during placentation. However, the early molecular events leading to preeclampsia remain unknown. Results By analyzing placentas from preeclampsia, non-preeclampsia, and twin pregnancies with selective intrauterine growth restriction, we show that the pathogenesis of preeclampsia is attributed to immature trophoblast and maldeveloped endothelial cells. Delayed epigenetic reprogramming during early extraembryonic tissue development leads to generation of excessive immature trophoblast cells. We find reduction of de novo DNA methylation in these trophoblast cells results in selective overexpression of maternally imprinted genes, including the endoretrovirus-derived gene PEG10 (paternally expressed gene 10). PEG10 forms virus-like particles, which are transferred from the trophoblast to the closely proximate endothelial cells. In normal pregnancy, only a low amount of PEG10 is transferred to maternal cells; however, in preeclampsia, excessive PEG10 disrupts maternal vascular development by inhibiting TGF-beta signaling. Conclusions Our study reveals the intricate epigenetic mechanisms that regulate trans-generational genetic conflict and ultimately ensure proper maternal–fetal interface formation.

ABSTRACTThe epidemiological and clinical aspects of Human Papillomavirus (HPV) infection in women have been extensively studied. However, there is a lack of information regarding HPV characteristics in males. In this study, we conducted a retrospective and observational study of 3737 consecutive male individuals attending outpatient clinics of Guangdong Women and Children Hospital from 2012 to 2023 in Guangzhou, South China, to determine the age- and genotype-specific prevalence of HPV in men. The results showed the overall prevalence of HPV among men was 42.15% (1575/3737), with variations ranging from 29.55% to 81.31% across distinct diagnostic populations. Low-risk HPV6 (15.47%), HPV11 (8.94%), and high-risk HPV52 (5.51%) were the most common types. The annual HPV prevalence decreased significantly (Z = −3.882, p

ABSTRACTBackground Enteroviruses (EV) are common and can cause severe diseases, particularly in young children. However, the information of EV infection in infants in China is limited due to the vast population size and extensive geographical area of the country. Here, we conducted a retrospective multicenter analysis of available EV data to assess the current epidemiological situation in the infant population in southern China.Methods The study enrolled infants with suspected EV infection from 34 hospitals across 12 cities in southern China between 2019 to 2022, and the confirmation of EV was done using RT-PCR and VP1 gene sequencing.Results Out of 1221 infants enrolled, 330 (27.03%) were confirmed as EV-infected. Of these, 260 (78.79%) were newborns aged 0–28 days. The EV belonged to three species: EV-B (80.61%), EV-A (11.82%), and human rhinovirus (7.58%). Newborns were more susceptible to EV-B than older infants (p

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Abstract Objective To share our experience on prenatal diagnosis of 7q11.23 microduplication syndrome and to further delineate the fetal phenotypes of the syndrome. Methods A retrospective study was conducted to evaluate seven cases of dup7q11.23 syndrome diagnosed prenatally by chromosomal microarray (CMA). Clinical data were reviewed, including maternal characteristics, indications for prenatal diagnosis, sonographic findings, CMA results, pregnancy outcomes and follow-ups. Results Seven cases, including 2 pairs of MCDA twins, were prenatally identified with dup7q11.23 syndrome. The most common prenatal sonographic features were ventriculomegaly, low-lying conus medullaris, and dilated ascending aorta. All 7 fetuses presented with typical 7q11.23 duplications (1.40–1.55 Mb). Parental chromosome analysis was performed in four pairs of parents, and indicated that the duplications of Case 6 and 7 were inherited from their asymptomatic mother. Conclusion Our case series suggest that prenatal features of dup7q11.23 cases are diversified, with ventriculomegaly and low-lying conus medullaris being the most common intrauterine phenotypes. Additionally, cleft palate, dilated ascending aorta, and renal abnormalities were also observed, and should be taken into consideration in subsequent studies.

Abstract To determine the association between cell-free DNA fetal fraction (cffDNA) and various prenatal characters to better guide the clinical application of noninvasive prenatal screening (NIPS), a retrospective cohort study of 27,793 women with singleton pregnancies was conducted. Results indicated that no significant difference on cffDNA between trisomy/sex chromosome aneuploidy (SCA) and non-trisomy groups was found. However, the fetal fraction (FF) in the T18 and T13 subgroups were significantly lower than that in the non-trisomy group, while the FF in the T21 group was significantly higher than the non-trisomy group. Pearson’s correlation analysis revealed a positive correlation between √FF and gestational week in the T21, SCA, and non-trisomy groups. A negative correlation between maternal age and √FF in T21 and non-trisomy cases was found, but a positive correlation in SCA group. Compared to the decreasing trend in FF in the T21 group, no significant difference was observed in the SCA group. The √FF level was negatively correlated to maternal BMI in T21 and non-trisomy group, while a positive correlation in SCA group. FF was close related to the result of NIPS and related maternal factors. Though NIPS has increased accuracy, the complexity still should be recognized especially in clinical practice.

AbstractBackground In the current study, we sought to characterise the methylation haplotypes and nucleosome positioning patterns of placental DNA and plasma cell-free DNA of pregnant women with early-onset preeclampsia using whole genome bisulphite sequencing (WGBS) and methylation capture bisulphite sequencing (MCBS) and further develop and examine the diagnostic performance of a generalised linear model (GLM) by incorporating the epigenetic features for early-onset preeclampsia.Methods This case-control study recruited pregnant women aged at least 18 years who delivered their babies at our Hospital. In addition, non-pregnant women with no previous history of diseases were included. Placental samples of the villous parenchyma were taken at the time of delivery and venous blood was drawn from pregnant women during non-invasive prenatal testing at 12–15 weeks of pregnancy and nonpregnant women during the physical check-up. WGBS and MCBS were carried out of extracted genomic DNA. Then, we established the GLM by incorporating preeclampsia-specific methylation haplotypes and nucleosome positioning patterns and examined the diagnostic performance of the model by receiver operating characteristic (ROC) curve analysis.Results The study included 135 pregnant women and 50 non-pregnant women. Our high-depth MCBS revealed notably different DNA methylation and nucleosome positioning patterns between women with and without preeclampsia. Preeclampsia-specific hypermethylated sites were found predominantly in the promoter regions and particularly enriched in CTCF on the X chromosome. Totally, 2379 preeclampsia-specific methylation haplotypes were found across the entire genome. ROC analysis showed that the area under the ROC curve (AUC) was 0.938 (95%CI 0.877, 1.000). At a GLM cut-off of 0.341, the AUC was the maximum, with a sensitivity of 95.6% and a specificity of 89.7%.Conclusion Pregnant women with early-onset preeclampsia exhibit DNA methylation and nucleosome positioning patterns in placental and plasma DNA.

ABSTRACTPersistent high-risk human papillomavirus (HPV) infection is the pivotal cause of cervical carcinogenesis. HPV types distribution varies greatly by region, and its long-term changes of prevalence remain to be fully characterized in China. Here, the largest population of 198,111 consecutive women who underwent routine cervical screening were investigated from 2015 to 2021 in Guangzhou, south China. The results showed that the overall HPV prevalence was 21.66% (42,911/198,111), and the annual prevalence increased significantly from 2015 to 2021 (p

Hemoglobin Santa Ana [β88(F4)Leu→Pro (CTG > CCG) HBB: c.266T > C] is an unstable hemoglobin variant characterized by a substitution of the amino acid leucine by proline at the 88th position of the β-globin chain. We for the first time identified this hemoglobin variant in a Chinese patient by capillary electrophoresis (CE). The proband was an 8-year-old boy with chronic anemia, brown urine and splenomegaly. He had been affected by moderate anemia, twice approaching a severe degree, that was attributed to infection. The CE result revealed an abnormal hemoglobin peak at electrophoretic zone 4 that correspond to the hemoglobin Santa Ana peak, and a CTG > CCG mutation at codon 88 of the β-globin gene was confirmed by DNA sequencing. To avoid misdiagnosis and genetic risks, a literature review of other unstable hemoglobins that migrate similarly to the hemoglobin Santa Ana was performed. Our findings indicate that hemoglobin Santa Ana can be clearly separated by CE, with accurate diagnosis depending on molecular analysis. This information will be useful for providing appropriate genetic counselling and for prenatal diagnosis.

Objective: To assess the performance of diverse prenatal diagnostic approaches for nuchal translucency (NT) thickening and to investigate the optimal prenatal screening or diagnostic action with a NT thickening of 95th percentile-3.50 mm.Methods: A retrospective analysis of 2,328 pregnancies with NT ≥ 95th percentile through ultrasound-guided transabdominal chorionic villus sampling (CVS), amniocentesis, or cordocentesis obtained clinical samples (chorionic villi, amniotic fluid, and cord blood), and real-time quantitative fluorescent PCR (QF-PCR), chromosome karyotyping (CS), chromosome microarray analysis (CMA), or whole exome sequencing (WES) were provided to identify genetic etiologies.Results: In this study, the incidence of chromosomal defects increased with NT thickness. When NT ≥ 6.5 mm, 71.43% were attributed to genetic abnormalities. The 994 gravidas with fetal NT thickening underwent short tandem repeat (STR), CS, and CMA. In 804 fetuses with normal karyotypes, CMA detected 16 (1.99%) extra pathogenic or likely pathogenic copy number variations (CNVs). The incremental yield of CMA was only 1.16% (3/229) and 3.37% (10/297) in the group with NT 95th percentile-2.99 mm and NT 3.0–3.49 mm, separately. Among the 525 gravidas with fetal NT thickening who underwent STR, CMA, and WES, the incremental yield of WES was 4.09% (21/513). In the group of NT 95th percentile-2.99 mm, there were no additional single-nucleotide variations (SNVs) detected in WES, while in 143 cases with NT of 3.0–3.49 mm, the incremental yield of WES was 5.59% (8/143).Conclusion: In the group of NT 95th percentile-3.0 mm, since chromosomal aneuploidy and chromosomal copy number variation were the primary causes and the additional contribution of CMA and WES was not significant, we recommend NIPT-Plus for pregnant women with a NT thickening of 95th percentile-3.0 mm first. In addition, comprehensive prenatal genetic testing involving CMA and WES can benefit pregnancies with NT thickening of 3.0–3.49 mm.

ObjectiveTo share our experience on prenatal diagnosis of Williams-Beuren syndrome(WBS) and to improve the awareness, diagnosis, and intrauterine monitoring of the fetuses of this disease.MethodsThe study retrospectively evaluated 14 cases of WBS diagnosed prenatally by single nucleotide polymorphism array (SNP-array). Clinical data from these cases were systematically reviewed, including maternal demographics, indications for invasive prenatal diagnosis, ultrasound findings, SNP-array results, trio-medical exome sequencing (Trio-MES) results, QF-PCR results, pregnancy outcomes and follow-ups.ResultsA total of 14 fetuses were diagnosed with WBS and their prenatal phenotypes were assessed retrospectively. In our case series, the most common ultrasound features were intrauterine growth retardation (IUGR), congenital cardiovascular defects, abnormal fetal placental doppler indices, thickened nuchal translucency(NT) and polyhydramnios. Other less common ultrasound features include fetal hydrops, hydroderma, bilateral pleural effusion, subependymal cysts, etc. Parental chromosome analysis was performed in seven pairs of parents, and all the deletions on chromosome 7q11.23 were de novo.ConclusionPrenatal ultrasound features of WBS cases are highly variable, with IUGR, cardiovascular abnormalities and abnormal fetal placental doppler indices, being the most common intrauterine phenotypes. Our case series expand the intrauterine phenotypes of WBS, including cardiovascular abnormalities right aortic arch(RAA) combined with persistent right umbilical vein(PRUV) and elevated the ratio of end-systolic peak flow velocity to end-diastonic peak flow velocity(S/D). In the meantime, with the decrease in the cost of the next-generation sequencing, the method may become widely used in prenatal diagnosis in the near future.

Background: Prenatal diagnosis of fetal short long bones (SLBs) was reported to be associated with skeletal dysplasias, chromosomal abnormalities, and genetic syndromes. This study aims to identify the genetic causes for fetal short long bones, and retrospectively evaluate the additional diagnostic yield of exome sequencing (ES) for short long bones following the use of conventional genetic testing.Methods: A cohort of ninety-four fetuses with sonographically identified short long bones was analyzed by trio-exome sequencing between January 2016 and June 2021. Fetuses with abnormal results of karyotype or chromosomal microarray analysis were excluded. Variants were interpreted based on ACMG/AMP guidelines. All diagnostic de novo variants were validated by Sanger sequencing.Results: Of the 94 fetuses, 38 (40.4%) were found to carry causal genetic variants (pathogenic or likely pathogenic) in sixteen genes with 38 variants. Five fetuses (5.3%) had variant(s) of uncertain significance. Thirty-five cases (37.2%) were diagnosed as genetic skeletal dysplasias including 14 different diseases that were classified into 10 groups according to the Nosology and Classification of Genetic Skeletal Disorders. The most common disease in the cohort was achondroplasia (28.9%), followed by osteogenesis imperfecta (18.4%), thanatophoric dysplasia (10.5%), chondrogenesis (7.9%), and 3-M syndrome (5.3%). The diagnostic yield in fetuses with isolated short long bones was lower than the fetuses with non-isolated short long bones, but not reached statistical significance (27.3% vs. 44.4%; p = 0.151). Whereas, the rate in the fetuses with other skeletal abnormalities was significantly higher than those with non-skeletal abnormalities (59.4% vs. 32.5%, p = 0.023), and the diagnostic rate was significantly higher in femur length (FL) below -4SDs group compared with FL 2-4SDs below GA group (72.5% vs. 16.7%; p < 0.001). A long-term follow-up showed that outcomes for fetuses with FL 2-4SDs below GA were significantly better than those with FL below -4SDs. Additionally, fourteen (36.8%) novel short long bones-related variants were identified in the present study.Conclusion: The findings suggest that in fetuses with short long bones routine genetic tests failed to determine the underlying causes, exome sequencing could add clinically relevant information that could assist the clinical management of pregnancies. Novel pathogenic variants identified may broaden the mutation spectrum for the disorders and contributes to clinical consultation and subsequent pregnancy examination.

Variants in TTN are associated with a broad range of clinical phenotypes, from dominant adult-onset dilated cardiomyopathy to recessive infantile-onset myopathy. However, few foetal cases have been reported for multiple reasons. Next-generation sequencing has facilitated the prenatal identification of a growing number of suspected titinopathy variants. We investigated six affected foetuses from three families, completed the intrauterine course of the serial phenotypic spectrum of TTN, and discussed the genotype-phenotype correlations from a broader perspective. The recognizable prenatal feature onset at the second trimester was started with reduced movement, then contracture 3–6 weeks later, followed with/without hydrops, finally at late pregnancy was accompanied with polyhydramnio (major) or oligohydramnios. Two cases with typical arthrogryposis-hydrops sequences identified a meta-only transcript variant c.36203-1G>T. Deleterious transcriptional consequences of the substitution were verified by minigene splicing analysis. Case 3 identified a homozygous splicing variant in the constitutively expressed Z-disc. It presented a milder phenotype than expected, which was presumably saved by the isoform of corons. A summary of the foetal-onset titinopathy cases implied that variants in TTN present with a series of signs and a spectrum of clinical severity, which followed the dosage/positional effect; the meta-only transcript allele involvement may be a prerequisite for the development of fatal hydrops.

Background: Joubert syndrome (JBS) is a rare neurodevelopmental disorder associated with progressive renal, liver, and retinal involvement that exhibits heterogeneity in both clinical manifestations and genetic etiology. Therefore, it is difficult to make a definite prenatal diagnosis.Methods: Whole-exome sequencing and Sanger sequencing were performed to screen the causative gene variants in a suspected JBS family. RNA-seq and protein model prediction were performed to clarify the potential pathogenic mechanism. A more comprehensive review of previously reported cases with OFD1 variants is presented and may help to establish a genotype–phenotype.Results: We identified a novel non-sense variant in the OFD1 gene, OFD1 (NM_003611.3): c.2848A>T (p.Lys950Ter). Sanger sequencing confirmed cosegregation among this family. RNA-seq confirmed that partial degradation of mutant transcripts, which was predicted to be caused by the non-sense-mediated mRNA decay (NMD) mechanism, may explain the reduction in the proportion of mutant transcripts. Protein structure prediction of the non-sense variant transcript revealed that this variant may lead to a change in the OFD1 protein structure.Conclusion: The genetic variation spectrum of JBS10 caused by OFD1 was broadened. The novel variants further deepened our insight into the molecular mechanism of the disease.

Abstract Background Trisomy 16 (T16) is thought to be the most frequent chromosome abnormality at conception, which is often associated with a high risk of abnormal outcomes. Methods A retrospective analysis of 14 cases with high risk of T16 by noninvasive prenatal testing (NIPT) was conducted. All cases in the analysis involved prenatal diagnosis, karyotyping and chromosomal microarray analysis. Case reports NIPT detected 12 cases of T16 and 2 cases of T16 mosaicism. Prenatal diagnosis confirmed 5 true positive cases and 9 false positive cases. Among the 5 true positive cases, 3 cases had ultrasound abnormalities. All of the 9 false positive cases continued their pregnancies. The newborns who were from these 9 false positive cases except 1 case (case 7) had low birth weights (

Abstract Objective To evaluate the performance of noninvasive prenatal testing (NIPT) and NIPT-PLUS for the detection of genome-wide microdeletion and microduplication syndromes (MMSs) at different sequencing depths. The NIPT sequencing depth was 0.15X, and the data volume was 3 million reads; the NIPT-PLUS sequencing depth was 0.4X, and the data volume was 8 million reads. Methods A cohort of 50,679 pregnancies was recruited. A total of 42,969 patients opted for NIPT, and 7710 patients opted for NIPT-PLUS. All high-risk cases were advised to undergo invasive prenatal diagnosis and were followed up. Results A total of 373 cases had a high risk of a copy number variation (CNV) as predicted by NIPT and NIPT-PLUS: NIPT predicted 250 high-risk CNVs and NIPT-PLUS predicted 123. NIPT-PLUS increased the detection rate by 1.02% (0.58% vs 1.60%, p < 0.001). A total of 291 cases accepted noninvasive prenatal diagnosis, with 197 cases of NIPT and 94 cases of NIPT-PLUS. The PPV of CNV > 10 Mb for NIPT-PLUS was significantly higher than that for NIPT (p = 0.02). The total PPV of NIPT-PLUS was 12.56% higher than that of NIPT (43.61% vs 30.96%, p = 0.03). Conclusion NIPT-PLUS had a better performance in detecting CNVs in terms of the total detection rate and total PPV. However, great care must be taken in presenting results and providing appropriate counseling to patients when deeper sequencing is performed in clinical practice.

Background: Non-invasive prenatal diagnosis (NIPD) can identify monogenic diseases early during pregnancy with negligible risk to fetus or mother, but the haplotyping methods involved sometimes cannot infer parental inheritance at heterozygous maternal or paternal loci or at loci for which haplotype or genome phasing data are missing. This study was performed to establish a method that can effectively recover the whole fetal genome using maternal plasma cell-free DNA (cfDNA) and parental genomic DNA sequencing data, and validate the method’s effectiveness in noninvasively detecting single nucleotide variations (SNVs), insertions and deletions (indels).Methods: A Bayesian model was developed to determine fetal genotypes using the plasma cfDNA and parental genomic DNA from five couples of healthy pregnancy. The Bayesian model was further integrated with a haplotype-based method to improve the inference accuracy of fetal genome and prediction outcomes of fetal genotypes. Five pregnancies with high risks of monogenic diseases were used to validate the effectiveness of this haplotype-assisted Bayesian approach for noninvasively detecting indels and pathogenic SNVs in fetus.Results: Analysis of healthy fetuses led to the following accuracies of prediction: maternal homozygous and paternal heterozygous loci, 96.2 ± 5.8%; maternal heterozygous and paternal homozygous loci, 96.2 ± 1.4%; and maternal heterozygous and paternal heterozygous loci, 87.2 ± 4.7%. The respective accuracies of predicting insertions and deletions at these types of loci were 94.6 ± 1.9%, 80.2 ± 4.3%, and 79.3 ± 3.3%. This approach detected pathogenic single nucleotide variations and deletions with an accuracy of 87.5% in five fetuses with monogenic diseases.Conclusions: This approach was more accurate than methods based only on Bayesian inference. Our method may pave the way to accurate and reliable NIPD.

Recessive mutations in BRAT1 cause lethal neonatal rigidity and multifocal seizure syndrome (RMFSL), a phenotype characterized by neonatal microcephaly, hypertonia, and refractory epilepsy with premature death. Recently, attenuated disease variants have been described, suggesting that a wider clinical spectrum of BRAT1-associated neurodegeneration exists than was previously thought. Here, we reported a 10-year-old girl with severe intellectual disability, rigidity, ataxia or dyspraxia, and cerebellar atrophy on brain MRI; two BRAT1 variants in the trans configuration [c.1014A > C (p.Pro338 = ); c.706delC (p.Leu236Cysfs*5)] were detected using whole-exome sequencing. RNA-seq confirmed significantly decreased BRAT1 transcript levels in the presence of the variant; further, it revealed an intron retention between exon 7 and exon 8 caused by the synonymous base substitute. Subsequent prenatal diagnosis for these two variants guided the parents to reproduce. We expand the phenotypic spectrum of BRAT1-associated disorders by first reporting the pathogenic synonymous variant of the BRAT1 gene, resulting in clinical severity that is mild compared to the severe phenotype seen in RMFSL. Making an accurate diagnosis and prognostic evaluation of BRAT1-associated neurodegeneration is important for reproductive consultation and disease management.

Abstract Background Small subchromosomal deletions and duplications caused by copy number variants (CNVs) can now be detected with noninvasive prenatal testing (NIPT) technology. However, the clinical utility and validity of this screening for CNVs are still unknown. Here, we discuss some special conditions in which both cases simultaneously exhibited false positives caused by maternal CNVs and false negatives due to limitations of the technology. Case presentation In case 1, NIPT indicated a 1.1 Mb deletion at 21q21.1, but the umbilical cord for array CGH (aCGH) revealed a 422 kb deletion at 15q13.3. Peripheral blood of the parents for aCGH showed a 1.1 Mb deletion at 21q21.1 in the mother’s sample, and the same deletion at 15q13.3 was detected in the father’s blood. In case 2, NIPT showed a 1.5 Mb deletion at 22q11.21, but aCGH of amniocytes revealed a 1.377 Mb duplication rather than a 1.5 Mb deletion at 22q11.21. Furthermore, aCGH analysis of the parental blood revealed a 647 kb deletion at 22q11.21 in the mother and a 2.8 Mb duplication of 22q11.21 in the father. Conclusions Our findings not only highlight the significance of diagnostic testing following a positive cfDNA sequencing result but also the necessity for additional analytical and clinical validation before routine use in practice.

Background: National immunization schedules in many countries recommend HPV vaccination for females until the age of 26 years, and thus substantial numbers with reproductive age may be exposed to HPV vaccines. Objective: To assess whether inadvertent HPV vaccine exposures in the periconceptional period or during pregnancy were associated with increased risks for adverse pregnancy outcomes. Search strategy: A search of PubMed, Cochrane Library, China National Knowledge Infrastructure (CNKI), and WanFang databases (until March 31, 2019) was performed. Selection criteria: Studies that assess the risk of adverse pregnancy outcomes in HPV vaccine exposed/unexposed pregnancies were included. The adverse pregnancy outcomes included spontaneous abortion, stillbirth, small for sestational age, preterm birth, and birth defects. Data collection and analysis: The pooled relative risk (RR) was applied for the effect measure of the study. RRs and 95% confidence interval (CI) were measured when the paper did not report the effect. Heterogeneity between studies was assessed using the Cochrane’s Q and I2 statistics. Main results: Of 374 identified citations, 8 met inclusion criteria. Compared with the unexposed pregnancies, HPV vaccine exposed pregnancies were associated with no higher risk for spontaneous abortion (RR, 0.99 [95% CI, 0.90 to 1.08]); stillbirth (RR, 1.16 [95% CI, 0.71 to 1.90]); small for gestational age (RR, 0.96 [95% CI, 0.86 to 1.07]); preterm birth (RR, 1.04 [95% CI, 0.91 to 1.18]); or birth defects (RR, 1.18 [95% CI, 0.97 to 1.43]). Conclusions: Inadvertent bivalent/quadrivalent HPV vaccination during pregnancy was not associated with significantly greater risks of adverse pregnancy outcomes.

Abstract Background The identification of cell-free fetal DNA (cffDNA) facilitated non-invasive prenatal screening (NIPS) through analysis of cffDNA in maternal plasma. However, challenges regarding its clinical implementation become apparent. Factors affecting fetal fraction should be clarified to guide its clinical application. Results A total of 13,661 pregnant subjects with singleton pregnancies who undertook NIPS were included in the study. Relationship of gestational age, maternal BMI, and maternal age with the cffDNA fetal fraction in maternal plasmas for NIPS was investigated. Compared with 13 weeks (12.74%) and 14–18 weeks group (12.73%), the fetal fraction in gestational ages of 19–23 weeks, 24–28 weeks, and more than 29 weeks groups significantly increased to 13.11%, 16.14%, and 21.17%, respectively (P

Abstract Introduction Although over 1000 hemoglobin (Hb) variants were identified so far, Hb Port Phillip compound with α‐thalassemia deletion had no reported before. Methods Two patients and the associated families from Guangdong province in China were recruited. Hematological parameters were determined by blood routine examination and hemoglobin electrophoresis. Genotyping was performed by Gap‐PCR and Sanger sequencing. Results One patient was diagnosed as Hb Port Phillip, while her daughter was compounded with ‐α4.2 deletion, with normal Hb level (150 g/L), mean corpuscular volume (MCV) 108.4 fl and mean corpuscular hemoglobin (MCH) (30.5 pg). Another patient was diagnosed as compound Hb Port Phillip and ‐‐SEA deletion. This proband presented with more severe α‐thalassemia trait than the patient compounded with ‐α4.2 deletion, with hemoglobin 80 g/L, MCV 61.7 fl, and MCH 18.7 pg. Conclusion Here we first time identified two patients compound with Hb Port Phillip and ‐α4.2 and ‐‐SEA deletions, respectively, which had never been reported. Our study widens the genotypes of hemoglobinopathy and provides reference for genetic counselling and prenatal diagnosis in this population.

The long-term prognosis of a fetus with cardiac rhabdomyoma (CR) depends on the correlation with tuberous sclerosis complex (TSC). In recent years, the numerous variations of uncertain significance (VUS) of TSC genes produced by high-throughput sequencing have made counseling challenging, studies until now have tended to side-step the tricky topics. Here, we integrated detailed parental phenotype, echocardiography, neuro MRI, and genetic information to conduct a comprehensive evaluation of 61 CR fetuses. As a result, multiple CRs and cerebral lesions appeared in 90 and 80%, respectively of fetuses with pathogenic (P)/likely pathogenic (LP) TSC1/TSC2 variations. Overall, 85.7% of the live-born infants with P/LP presented with TSC-associated signs. While, 85.7% of VUS without nervous findings had good prognoses. Genetic evidence and cerebral MRI findings are the most sensitive index to assess long-term prognosis, which complement and confirm each other for a TSC diagnosis. In total, 68.9% of fetuses with CR could benefit from this multidisciplinary approach, which turned out to be potentially clinically actionable with precise clinical/genetic diagnosis or had a foreseeable outcome. Our practice provides a practical and feasible solution for perinatal management and prognostic guidance for fetuses with CR.

PACS1 neurodevelopmental disorder (PACS1-NDD) is a category of rare disorder characterized by intellectual disability, speech delay, dysmorphic facial features, and developmental delay. Other various physical abnormalities of PACS1-NDD might involve all organs and systems. Notably, there were only two unique missense mutations [c.607C > T (p.Arg203Trp) and c.608G > A (p.Arg203Gln)] in PACS1 that had been identified as pathogenic variants for PACS1-NDD or Schuurs-Hoeijmakers syndrome (SHMS). Previous reports suggested that these common missense variants were likely to act through dominant-negative or gain-of-function effects manner. It is still uncertain whether the intragenic deletion or duplication in PACS1 will be disease-causing. By using whole-exome sequencing, we first identified a novel heterozygous multi-exon deletion covering exons 12–24 in PACS1 (NM_018026) in four individuals (two brothers and their father and grandfather) in a three-generation family. The younger brother was referred to our center prenatally and was evaluated before and after the birth. Unlike SHMS, no typical dysmorphic facial features, intellectual problems, and structural brain anomalies were observed among these four individuals. The brothers showed a mild hypermyotonia of their extremities at the age of 3 months old and recovered over time. Mild speech and cognitive delay were also noticed in the two brothers at the age of 13 and 27 months old, respectively. However, their father and grandfather showed normal language and cognitive competence. This study might supplement the spectrum of PACS1-NDD and demonstrates that the loss of function variation in PACS1 displays no contributions to the typical SHMS which is caused by the recurrent c.607C > T (p.Arg203Trp) variant.

Abstract Background Hearing loss is a prevalent sensorineural disorder and a major public health issue in China. It is suggested that half of all cases of hearing loss can be prevented through public health measures. However, national strategies for hearing healthcare are not implemented well in Guangdong and some other regions in China. Methods To develop a community-based service model for the prevention and control of hearing loss in Guangdong, we integrated the model with multiple maternal and child healthcare models, and set up a series of clinical programs along with an optimum timeline for the preventive measures and intervention treatments to take place. A total of 36,090 families were enrolled in the study, including 358 high-risk families and 35,732 general-risk families. Results The study lasted for 6.5 years, and 30,769 children were born during that period. A total of 42 children were born with congenital deafness; 17 of them were born into families with advanced genetic risks for hearing loss, 9 were born with specific medical conditions, and 16 were born into general-risk families. About one third of them were diagnosed prenatally, others were diagnosed within 3 months of age, and 72% of them received interventions initiated before 6 months of age. 13 children presented with delayed hearing loss; 9 of them were diagnosed with delayed hereditary sensorineural deafness in neonatal period, and 4 were diagnosed within 3 months after onset. Timely interventions were provided to them, with appropriate referrals and follow-ups. Beside these, 80 families were identified with genetic susceptibility to aminoglycoside ototoxicity. Detailed medication guides were provided to prevent aminoglycoside-induced hearing loss. Moreover, through health education and risk reduction strategies, the prevalence of TORCH syndrome decreased from 10.7 to 5.2 per 10,000. Additionaly, the awareness rates of health knowledge about hearing healthcare significantly increased in the cohort. Conclusions Adapting national strategies for local or district projects could be an important step in implementing hearing loss prevention measures, and developing community-based service models could be of importance in carrying them out.

Abstract Background Phenotypic difference is general in Mendelian disease. Due to the extremely low incidence for a single disease, phenotype spectrum needs to be expanded. Meanwhile, earlier knowledge says patients who suffered from two kinds of different Mendelian disease are very rare. Case presentation We describe a case of neonatal male with genital anomalies, growth delay, skin hyperpigmentation, chronic lung disease with recurrent infection, anemia, and severe deafness. Without any clear etiology after routine workflow, whole exome sequencing was carried on. A pathogenic de novo SAMD9 mutation and compound heterozygous likely-pathogenic variants in SLC19A2 were identified. Some symptoms were improved after the patient was treated with vitamin B1. Unfortunately, the boy died from sepsis and multiple organ failure before 1 year old. Conclusion Combining the phenotype and clinical progress of treatment, we report that it is the first case of a patient with both MIRAGE syndrome and TRMA syndrome.

Abstract Background This study was an evaluation of the role of noninvasive prenatal testing (NIPT) in the detection of trisomy 7 in prenatal diagnosis. Method A total of 35 consecutive cases underwent screening for trisomies by cell-free DNA testing between April 2015 and November 2017 due to suspicious NIPT results; these cases represented 0.11% of patients (35/31,250) with similar frequencies of abnormal results among the laboratories performing the tests. NIPT was offered to further screen for common fetal chromosomal abnormalities. Karyotype analysis, chromosomal microarray analysis (CMA), and next-generation sequencing (NGS) were used to detect 20, 14, and 25 patients, respectively, who accepted confirmatory diagnostic testing. Results High-risk results by NIPT were recorded for trisomy 7 alone in 29 women: dual aneuploidy in 4 patients and multiple aneuploidy in 2 patients. Karyotype analysis of amniotic fluid cells was normal in all 20 pregnancies, suggesting a probability of confined placental mosaicism. Further CMA data were obtained in 14 of the cases mentioned above, and 2 fetuses were detected with positive results with copy number variation. The NGS results suggested that all these samples were placental chimerisms of chromosome 7, except for one sample that was found to be an additional chimerism of chromosome 2, which was also consistent with the NIPT result. Conclusion Our results may be useful for the counseling of pregnant women in the detection of trisomy 7 by NIPT.

Abstract Background Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are clinically distinct neurodevelopmental disorders caused by absence of paternally or maternally expressed imprinted genes on chromosome 15q11.2-q13.3 region. Methods 3331 individuals was recruited from June 2013 to December 2016 under an institutional review board-approved protocol of informed consent. The methylation-specific PCR was employed as a first-tier screening test. The multiplex-fluorescent-labeled STR linkage analysis was carried out to define the underlying genetic mechanisms. The chromosomal microarray analysis was employed to identify chromosomal breakpoints in confirmed cases, and to detect other chromosomal abnormalities in undiagnosed cases. Genetic counseling and recurrence risk assessment were provided to families with affected individuals. Results The methylation-specific PCR identified 36 PWS suspected patients and 13 AS suspected patients. UBE3A sequence analysis identified another 1 patient with AS. The STR linkage analysis define the underlying genetic mechanisms. Thirty PWS patients were with paternal deletions on chromosome region 15q11-q13, 5 with isodisomic uniparental disomy and 1 with mixed segmental isodisomic/ heterodisomic uniparental disomy of maternal chromosome 15. Twelve AS patients were with maternal deletions, 1 with isodisomic uniparental disomy and 1 with UBE3A gene mutation. The chromosomal microarray analysis identified chromosomal breakpoints in confirmed cases, and detected chromosomal abnormalities in another 4 patients with clinically overlapped features but tested negative for PWS/AS. Genetic counseling was offered to all families with affected individuals. Conclusions Identifying the disorders at early age, establishing the molecular mechanisms, carrying out treatment intervention and close monitoring can significantly improve the prognosis of PWS/AS patients.

Abstract Background Isodicentric chromosomes are the most frequent structural aberrations of human Y chromosome, and usually present in mosaicism with a 45, X cell line. Several cytogenetic techniques have been used for diagnosing of uncommon abnormal sex chromosome abnormalities in prenatal cases. Case presentation A 26-year-old healthy woman was referred to our centre at 24 weeks of gestation age. Ultrasound examination indicated she was pregnant with imbalanced development of twins. Amniocentesis was referred to the patient for further genetic analyses. Quantitative Fluorescent Polymerase Chain Reaction (QF-PCR) indicated the existence of an extra Y chromosome or a structurally abnormal Y chromosome in primary amniotic cells. Chromosome microarray (CMA) analysis based on Comparative Genomic Hybridization (aCGH) platform was performed and identified a 10.1 Mb deletion on Y chromosome in 8-days cultured amniotic cells. Combined with the data of QF-PCR and aCGH, karyotyping and fluorescence in situ hybridization (FISH) revealed a mosaic cell line of 45,X[27]/46,X, idic(Y)(q11.22) [14] in fetus.The karyotyping analysis of cord blood sample was consistent with amniotic cells. The parental karyotypes were normal, which indicated this mosaic case of isodicentric Y (idicY) chromosomes of the fetus was a de novo case. Conclusion Several approaches have been used for the detection of numerical and structural chromosomal alterations of on prenatal cases. Our report supported the essential role of incorporating multiple genetic techniques in prenatal diagnosing and genetic counseling of potential complex sex chromosomal rearrangements.

Background We describe 2 unusual haemoglobin (Hb) Bart’s hydrops cases that could not be explained by traditional factors. Case presentation: Two families with a diagnosis or history of foetal hydrops were enrolled. A suspension-array system was used to detect the 23 most frequent mutations in southern China. Multiplex ligation-dependent probe amplification (MLPA) was used to screen for possible deletions. Precise characterisation of the breakpoints of the novel variants and uniparental disomy analysis were performed using a single nucleotide polymorphism (SNP) array. Quantitative fluorescence PCR was used to eliminate maternal cell contamination and nonpaternity. In case 1, the suspension-array system indicated a maternal heterozygous (– SEA /) deletion, and the paternal sample was negative. The foetal hydrops was caused by the maternal (– SEA /) deletion and a de novo α-globin gene deletion (– 193 ). In case 2, the paternal sample had a heterozygous (– SEA /) deletion, and MLPA and SNP array analysis revealed a large maternal deletion (– 227 ) that encompassed the α-globin gene, which explained the history of Hb Bart’s foetal hydrops. Conclusions Our cases describe 2 new α 0 -thalassaemia deletions and illustrate the importance of using a combination of methods to detect rare types of α-thalassaemia.

Background Congenital ventricular diverticulum is a rare abnormality that may occur as an isolated malformation. Most cases are accompanied by pericardial effusion. Prenatal counseling can be difficult because the prognosis is uncertain and there is no consensus approach to prenatal management. Case presentation: We describe a case of congenital cardiac diverticulum complicated by large pericardial effusion in one of monochorionic diamniotic twins. The case was diagnosed by ultrasonography at 21 weeks of gestation. Therapeutic pericardiocentesis at 22 weeks resulted in complete resolution of the effusion and led to a favorable fetal outcome. We summarize the interventions and pregnancy outcomes in cases of cardiac diverticula reported in the literature. Conclusions Better awareness of clinical features, in utero therapies, and pregnancy outcomes could help define and improve prenatal management of congenital ventricular diverticula.

We report two unrelated cases of compound heterozygosity for hemoglobin (Hb) variant Broomhill and the Southeast Asian (- - SEA /) α-thalassemia deletion, whose clinical features and laboratory findings have never been reported. Hematological analyses revealed abnormal values for both cases as α-thalassemia traits, and capillary electrophoresis suggested an abnormal peak that was incompletely separated from the Hb A peak. A suspension array system and Sanger sequencing were used to characterize the genotypes. Sanger sequencing confirmed the presence of Hb Broomhill [α114(GH2)Pro→Ala; HBA1 : c.343C>G]. Eventually, both cases were accurately diagnosed as compound heterozygotes for Hb Broomhill and the (- - SEA /) α-thalassemia deletion, which is the first known report of these variants. This information will be useful when providing appropriate genetic counselling and prenatal diagnosis.

Abstract Background Cell-free fetal DNA in maternal plasma represents a source of fetal genetic material that can be sampled noninvasively. There are ample studies confirming the accuracy of NIPT in singleton pregnancies, but there is still relatively little studies demonstrate the feasibility and clinical application of a NIPT for fetal aneuploidy screening in twin pregnancies. Results In this study, we have finished 432 twin pregnancies screening by NIPT. There were 4 double chorionic dichorionic diamniotic (DCDA) cases of true positive NIPT results, including 1of T18 and 3 of T21, and 1 monochorionic diamniotic (MCDA) cases of true positive NIPT results, including 1of T21. The combined false-positive frequency for trisomies 21, 18 was 0%. Furthermore, there were 2 cases of false positive NIPT results, including 1 of T7 and 1 of sex chromosome aneuploidy. There was no false negative case, which gave a combined sensitivity and specificity of 100 and 99.53% respectively. Conclusion Our study demonstrated NIPT performed well in the detection of trisomy 21 in twin pregnancy. It is feasible and clinical applicable of NIPT for fetal aneuploidy screening in twin pregnancies. But, it needs a large number of clinical samples to demonstrate the applicability of other chromosomal abnormalities besides trisomies 21 and 18 in both singleton pregnancies and twin pregnancies.

Abstract Background The non-invasive prenatal testing that evaluates circulating cell free DNA, and has been established as an additional pregnancy test for detecting the common fetal trisomies 21, 18 and 13 is rapidly revolutionizing prenatal screening as a result of its increased sensitivity and specificity. However, false positive and false negative results still exist. Case presentation We presented a case in which the non-invasive prenatal testing results were normal at 15 gestational age (GA), but an ultrasound examination at 30GA showed that the fetus had heart abnormalities, and the third trimester ultrasound at 33GA noted multiple anomalies including a 3.0 mm ventricular septal defect. Along with cordocentesis at 33GA, the cord blood sample cytogenetics analysis showed a mos 47,XN,+18[61]/46,XN[39] T18 karyotype. Six placental biopsies confirmed that the chromosome 18 placenta chimerism ratio had changed from 33% to 72%. Ultimately, the pregnancy was interrupted at 34GA. Conclusions We presented this case to highlight the need to clearly explain false positive or false negative results to patients. We believe that this information will also influence the development of future diagnostic test methodologies.

Congenital leukemia (CL), defined as manifestations of leukemia within the first 4 weeks of life, is a rare condition with an estimated incidence of only 1 to 5 per million live births. Despite extensive research and the clinical application of new therapies, the prognosis of CL remains poor. Few large-scale studies have investigated the factors affecting the outcomes of infants with CL. Here, we conducted a retrospective study and analysis of CL cases published in the English language from 1 January 2001 to 1 May 2016. Our goal was to provide updated information about this rare disease and to investigate factors that may affect the outcomes of patients with CL.

Gut microbiota has been implicated as a pivotal contributing factor in diet-related obesity; however, its role in development of disease phenotypes in human genetic obesity such as Prader–Willi syndrome (PWS) remains elusive. In this hospitalized intervention trial with PWS (n = 17) and simple obesity (n = 21) children, a diet rich in non-digestible carbohydrates induced significant weight loss and concomitant structural changes of the gut microbiota together with reduction of serum antigen load and alleviation of inflammation. Co-abundance network analysis of 161 prevalent bacterial draft genomes assembled directly from metagenomic datasets showed relative increase of functional genome groups for acetate production from carbohydrates fermentation. NMR-based metabolomic profiling of urine showed diet-induced overall changes of host metabotypes and identified significantly reduced trimethylamine N-oxide and indoxyl sulfate, host-bacteria co-metabolites known to induce metabolic deteriorations. Specific bacterial genomes that were correlated with urine levels of these detrimental co-metabolites were found to encode enzyme genes for production of their precursors by fermentation of choline or tryptophan in the gut. When transplanted into germ-free mice, the pre-intervention gut microbiota induced higher inflammation and larger adipocytes compared with the post-intervention microbiota from the same volunteer. Our multi-omics-based systems analysis indicates a significant etiological contribution of dysbiotic gut microbiota to both genetic and simple obesity in children, implicating a potentially effective target for alleviation. Research in context: Poorly managed diet and genetic mutations are the two primary driving forces behind the devastating epidemic of obesity-related diseases. Lack of understanding of the molecular chain of causation between the driving forces and the disease endpoints retards progress in prevention and treatment of the diseases. We found that children genetically obese with Prader–Willi syndrome shared a similar dysbiosis in their gut microbiota with those having diet-related obesity. A diet rich in non-digestible but fermentable carbohydrates significantly promoted beneficial groups of bacteria and reduced toxin-producers, which contributes to the alleviation of metabolic deteriorations in obesity regardless of the primary driving forces.

ObjectiveTo reveal the familial prevalence and molecular variation of α- and β-globin gene mutations in Guangdong Province.MethodsA total of 40,808 blood samples from 14,332 families were obtained and analyzed for both hematological and molecular parameters.ResultsA high prevalence of α- and β-globin gene mutations was found. Overall, 17.70% of pregnant women, 15.94% of their husbands, 16.03% of neonates, and 16.83% of couples (pregnant women and their husbands) were heterozygous carriers of α- or β-thalassemia. The regions with the highest prevalence were the mountainous and western regions, followed by the Pearl River Delta; the region with the lowest prevalence was Chaoshan. The total familial carrier rate (both spouses were α- or β-thalassemia carriers) was 1.87%, and the individual carrier rates of α- and β-thalassemia were 1.68% and 0.20%, respectively. The total rate of moderate-to-severe fetal thalassemia was 12.78% among couples in which both parents were carriers.ConclusionsThere was a high prevalence of α- and β-thalassemia in Guangdong Province. This study will contribute to the development of thalassemia prevention and control strategies in Guangdong Province.

The aim of this study was to determine whether the concentration of disintegrin and metalloprotease protein12 (ADAM12) in first trimester maternal serum can be used as a marker for first-trimester complete spontaneous abortions, missed abortions, ectopic pregnancies and hydatidiform moles.The maternal serum concentrations of ADAM12 were measured in the range of 5-9+6 weeks of gestation using an automated AutoDelfia immunoassay platform in 9 cases of complete spontaneous abortion, 27 cases of missed abortions, 56 cases of ectopic pregnancies, 12 cases of hydatidiform moles, and 100 controls. Logistic regression analysis was used to determine significant factors for predicting adverse pregnancy outcomes in early pregnancy. Screening performance was assessed using receiver operating characteristic curves.Two hundred and four women were enrolled in the study. In the control group, the level of ADAM12 increased with gestational age. The median ADAM12 levels in the spontaneous abortion (0.430 MoM), ectopic pregnancy (0.460 MoM) and hydatidiform mole (0.037 MoM) groups were lower than that in the control group, while the median ADAM12 level in the missed abortion group (1.062 MoM) was not significant from the controls (1.002 MoM). Logistic regression analysis demonstrated that the level of ADAM12 in maternal serum facilitated the detection of ectopic pregnancies (OR = 0.909; 95% CI = 0.841 ∼ 0.982) and complete spontaneous abortion (OR = 0.863; 95% CI = 0.787 ∼ 0.946).In complete spontaneous abortion and ectopic pregnancy, ADAM12 maintained at low levels in early pregnancies, and there were significant differences compared to normal pregnancies. ADAM12 is a promising marker for the diagnosis of complete spontaneous abortion and ectopic pregnancy in symptomatic women, and under certain conditions, ADAM12 can diagnose ectopic pregnancy and spontaneous abortion before an ultrasonographic detection of the conditions.