Search

Objective. Homozygous recessive germline mutations of the 15-hydroxyprostaglandin dehydrogenase (HPGD) gene, encoding 15-hydroxyprostaglandin dehydrogenase, result in persistent elevation of circulating PGE2 levels, causing the syndrome of primary hypertrophic osteoarthropathy (PHO). Homozygous HPGD mutations have so far been reported in 10 families, all but one displaying parental consanguinity. Only two of these families were of European origin. We wished to determine the role of HPGD in causing PHO in non-consanguineous European families. Methods. Five previously unreported families of Caucasian European origin, with one or more individuals affected with typical PHO, were characterized clinically and by complete sequencing of the HPGD coding exons. Results. Biallelic HPGD mutations were identified in affected individuals in all the five families, confirming a very specific association of this phenotype with HPGD mutations. The previously described c.175_176delCT frameshift mutation was observed in association with two different alleles of an adjacent single nucleotide polymorphism. Conclusions. Biallelic HPGD mutations are found in the majority of patients with typical PHO, and sequencing of the HPGD gene is a highly specific first-line investigation for patients presenting in this way, particularly during childhood. The c.175_176delCT frameshift mutation appears to be recurrent and to be the commonest HPGD mutation in Caucasian families.

We document the inheritance pattern of multicystic dysplastic kidney in 3 affected families and screen first-degree relatives of a cohort of children with prenatally detected multicystic dysplastic kidney for renal anomalies. The study also afforded an opportunity to document the natural history of prenatally detected multicystic dysplastic kidney.We identified 3 families during clinical treatment of children with prenatally detected multicystic dysplastic kidneys. Other members of these families were evaluated with renal ultrasonography. For the family screening study index cases were identified from a fetal uropathy database. A total of 94 first-degree relatives (52 parents, 35 full siblings and 7 half siblings) of 29 children with prenatally detected multicystic dysplastic kidneys were studied with urinary tract ultrasonography, blood pressure measurement, urinalysis and plasma biochemistry.Two families had affected sibling pairs, 1 of which also had a half sibling with vesicoureteral reflux. The third family included 3 individuals with multicystic dysplastic kidney and 1 with renal agenesis thought to have resulted from involution of multicystic dysplastic kidney. This family is consistent with autosomal dominant inheritance with variable expressivity and reduced penetrance. In the screening study ultrasonography did not demonstrate significant renal anomalies in any of the 94 first-degree relatives of the multicystic dysplastic kidney index cases. Followup assessment of prenatally detected multicystic dysplastic kidneys in index cases demonstrated total involution in 52% at a median age of 6.5 years with no multicystic dysplastic kidney related morbidity.Multicystic dysplastic kidney can be familial but is most commonly a sporadic anomaly. Formal screening of relatives is not recommended. Followup data on a cohort of children with prenatally detected multicystic dysplastic kidney add further support to conservative management.

We have modified the automated differential display reverse transcription polymerase chain reaction technique (DDRTPCR) such that a single fluorescently labeled universal primer (d[F]CTCACGGATCCGTCGATTTT) is used in all PCRs together with a selection of arbitrary primers. We term this fluorescent detection procedure FDDRT-PCR. Anchoring primers of general structure dTGGTCTCACGGATCCGTCGA- (T)12 VN (where N can be any deoxynucleoside and V can be any deoxynucleoside other than thymidine) are used for the RT step, and the universal primer together with selected arbitrary primers are then used for the PCR amplification. Advantages of this approach are: (i) the fluorescently labeled universal primer is a constant feature in every PCR, so that changes in banding profile are highly likely to reflect the incorporation of different arbitrary 10-mer primers; (ii) artifacts that result from arbitrary 10-mer to arbitrary 10- mer primer amplifications are not observed by fluoresence detection on an automated gene scanner because such products are not fluorescently labeled; (iii) sample throughput and ease of data handling are increased when compared with the conventional radioactive/ manual approach and (iv) using a single fluorescently labeled primer in all PCRs is highly cost-effective.

We describe a sensitive technique for mutation detection using clonal sequencing. We analyzed DNA extracted from 13 cancer cell lines and 35 tumor samples and applied a novel approach to identify disease-associated somatic mutations. By matching reads against an index of known variants, noise can be dramatically reduced, enabling the detection and quantification of those variants, even when they are present at less than 1% of the total sequenced population; this is comparable to, or better than, current diagnostic methods. Following the identification or exclusion of known variants, unmatched reads are grouped for BLAST searching to identify novel variants or contaminants. Known variants, novel variants, and contaminants were readily identified in tumor tissue using this approach. Our approach also enables an estimation of the per-base sequencing error rate, providing a confidence threshold for interpretation of the results in the clinic. This novel approach has immediate applicability to clinical testing for disease-associated genetic variants.

Bisulfite sequencing is a widely-used technique for examining cytosine DNA methylation at nucleotide resolution along single DNA strands. Probing with cytosine DNA methyltransferases followed by bisulfite sequencing (MAPit) is an effective technique for mapping protein–DNA interactions. Here, MAPit methylation footprinting with M.CviPI, a GC methyltransferase we previously cloned and characterized, was used to probe h MLH1 chromatin in HCT116 and RKO colorectal cancer cells. Because M.CviPI-probed samples contain both CG and GC methylation, we developed a versatile, visually-intuitive program, called MethylViewer, for evaluating the bisulfite sequencing results. Uniquely, MethylViewer can simultaneously query cytosine methylation status in bisulfite-converted sequences at as many as four different user-defined motifs, e.g. CG, GC, etc., including motifs with degenerate bases. Data can also be exported for statistical analysis and as publication-quality images. Analysis of h MLH1 MAPit data with MethylViewer showed that endogenous CG methylation and accessible GC sites were both mapped on single molecules at high resolution. Disruption of positioned nucleosomes on single molecules of the PHO5 promoter was detected in budding yeast using M.CviPII, increasing the number of enzymes available for probing protein–DNA interactions. MethylViewer provides an integrated solution for primer design and rapid, accurate and detailed analysis of bisulfite sequencing or MAPit datasets from virtually any biological or biochemical system.

The structure and sequence of the human gene for aldose reductase (AR) was determined by analysis of cDNA and genomic clones. The AR gene was independently isolated from two different cosmid libraries and the clones were characterized by restriction mapping, Southern blotting, and DNA sequencing. The gene extends over approximately 18 kilobases and consists of 10 exons giving rise to a 1,384 nucleotide mRNA (excluding the poly(A) tail). The human aldose reductase gene codes for a 316-amino acid protein with a molecular mass of 35,858 daltons. The size range for the exons is 82-168 base pairs (bp), whereas that for the introns is 325 to about 7,160 bp. A major site of transcription initiation in liver was mapped to an A residue 31 nucleotides upstream from the A of the ATG initiation codon. The promotor region of the gene contains a TATA (TATTTA) box and a CCAAT box which are located 37 and 104 nucleotides upstream, respectively, from the transcription initiation site. We have found four Alu elements in the AR gene; two are found in intron 1 and one each in intron 4 and intron 9.

Pseudogenes are commonly encountered during investigation of the genomes of a wide range of life forms. This review concentrates on vertebrate, and in particular mammalian, pseudogenes and describes their origin and subsequent evolution. Consideration is also given to pseudogenes that are transcribed and to the unusual group of genes that exist at the interface between functional genes and non-functional pseudogenes. As the sequences of different genomes are characterised, the recognition and interpretation of pseudogene sequences will become more important and have a greater impact in the field of molecular genetics.

We have prepared several novel phosphoramidites and have synthesised oligonucleotides incorporating them internally. The presence of these residues in an oligonucleotide template presents an impossible barrier to primed synthesis by Taq DNA polymerase. When extended as polymerase chain reaction products, these oligonucleotides no longer serve as templates for the polymerase beyond the insertion sites of the modified intermediates, thereby producing single-stranded tails on amplification products. These tails can then be used for solid phase capture and colorimetric detection of PCR products.

Completion of the human genome project it providing us with a complete catalogue of human genes. However, the function of many of these genes remains obscure. One approach to establishing gene function is to study the consequences of transgenic knockouts. Unfortunately, the phenotype generated in mouse knockouts does not always match that arising in man. We have been studying a highly inbred population in which consanguineous marriage leads to the occurrence of rare, autosomal recessive diseases. The technique of [autozygosity mapping] allows the gene mutated in each of these diseases to be located in the genome, and subsequently cloned. Functional pointers are provided by the disease phenotype. Examples of genes mutated in hereditary forms of deafness, tooth decay and cleft palate will be presented.

Six human minisatellite sequences (MS1, MS8, MS29, MS31, MS43, g3) have been subcloned into a stable host/vector system. Allele frequencies at the hypervariable loci detected by five of these probes were determined in a Caucasian population (200 individuals). Mendelian inheritance has been demonstrated in 5 large multi-generation pedigrees. The mutation rate has been determined in 59 families. The highest mutation rate was observed with MS1, as might be predicted from the observed high heterozygosity and in agreement with previous direct measurement of germ line mutation rates. The data presented on allele frequencies and mutation rates provide preliminary data supporting the use of these probes in paternity analysis and forensic investigations.

Reliable and reproducible protocols have been developed for the routine DNA fingerprinting of individuals using the highly polymorphic minisatellite DNA probes 33.15 and 33.6. Comparison of DNA fingerprinting from 50 individuals has generated further data on the level of band sharing in the DNA fingerprints of unrelated individuals, as well as the number of bands scorable in individuals. These results are consistent with previous studies. The occurrence of mutant bands in offspring has been examined in over 100 families. Further support is presented for the Mendelian inheritance of minisatellite loci and for lack of significant allelism and linkage between different variable DNA fragments detected in a human DNA fingerprint.

A previously cloned partial adenosine deaminase cDNA insert (0.8 kilobase) was used to clone additional nucleotide sequences from human HPB ALL cDNA libraries. cDNA encompassing the entire coding, and 3'-untranslated regions as well as nearly all of the 5'-untranslated region was obtained. The complete amino acid sequence of the enzyme deduced from the cDNA sequence and protein sequencing consists of 362 amino acids, excluding the initiator Met, and accounts for Mr = 40,638. Secondary structure predictions assign adenosine deaminase to the alpha/beta class of proteins. Northern blot analysis with a cDNA probe showed adenosine deaminase mRNA to be present in normal to above normal amounts in B-lymphoblasts derived from adenosine deaminase-deficient patients with severe combined immunodeficiency disease. Knowledge of the cDNA and primary amino acid sequence of adenosine deaminase will be pivotal in further defining the genetic abnormality and its functional consequences in adenosine deaminase expression defects.

A phosphotriester solid phase method on a polyamide support has been used to prepare oligodeoxyribonucleotides up to 12 units long. Compared to solid phase phosphodiester synthesis the new methodology is quicker, more flexible and gives 10-60-fold better overall yields.

Antithrombin III (ATIII) is an important plasma protease inhibitor with a central role in the coagulation system. On the basis of its protein sequence, ATIII is one member of a "super family" of protease inhibitors that includes alpha 1-antitrypsin and chicken ovalbumin. An increased risk of thromboembolism is associated with inherited ATIII deficiency. To study the structure and expression of the human ATIII gene, we have isolated complementary (cDNA) clones for ATIII from human liver mRNA. ATIII cDNA clones were identified by hybridization to a mixture of synthetic oligodeoxynucleotides encoding amino acids 251-256 of the ATIII protein sequence. The largest cDNA clone (1.4 kilobases) included the coding region of ATIII mRNA from codon 10 through a 3'-untranslated region. Comparison of ATIII cDNA clones from two different sources revealed a sequence polymorphism at an internal PstI restriction site. Analysis of both total genomic DNAs and an ATIII gene cloned in a bacteriophage Charon 4A showed that the ATIII gene is present once per haploid genome and is distributed over 10-16 kilobases of DNA. Computer-assisted comparison of the cDNA sequence with those for baboon alpha 1-antitrypsin and chicken ovalbumin revealed homologies consistent with their inclusion in the protease inhibitor superfamily.

Phosphoglycerate kinase (PGK), a major enzyme in glycolysis, is encoded by the X chromosome in mammals. We have initiated molecular analysis of the PGK structural gene by isolating a full-length cDNA clone from a human fetal liver cDNA library. Synthetic oligonucleotide mixtures encoding two different portions of PGK were used as direct in situ hybridization probes for the cDNA library. Several classes of clones were obtained based on their hybridization at different stringencies to one or both of the PGK oligonucleotide mixtures. One clone, designated pHPGK-7e, which hybridized at high stringency to each of the synthetic probes, encoded the complete PGK protein sequence as well as 82 base pairs of 5' and 437 base pairs of 3' untranslated regions. Southern blot analysis of human genomic DNAs revealed a complex pattern of hybridizing fragments, two of which were non-X in origin. These results suggest that the human genome contains a small family of dispersed PGK or PGK-like genes.

Specific synthesis of some oligoadenylates including A2'p5'A2'p5'Ap(2'), the 2'-phosphorylated oligoribonucleotide core of the recently discovered protein synthesis inhibitor pppA2'p5'A2'p5'A is described using a novel solid-phase method. The CD spectra of A2'p5'Ap(2'), A2'p5'A2'p5'Ap(2') and A2'p5'A2'p5'A (derived by treatment of the phosphorylated synthetic trimer with E. coli alkaline phosphatase) are presented. Comparison of the latter spectrum with that of A2'p5'A2'p5'A obtained similarly from a biologically derived sample of pppA2'p5'A2'p5'A provides further evidence that this molecule is in fact the first naturally-occurring 2'-5'-linked oligoribonucleotide.

Atactic and syndiotactic poly(acrylic acid hydrazide) and atactic, syndiotactic and isotactic poly(methylacrylic acid hydrazide) have been reacted with the di-aldehydes derived from adenosine, guanosine, inosine, cytidine and uridine to give polymers each containing a single type of base residue. Not all of the hydrazide residues of the polymeric hydrazides reacted; guanosine dialdehyde gave the most reaction and inosine dialdehyde the least. Isotactic poly(methylacrylic acid hydrazide) was much less reactive than the other polymeric hydrazides. The adenine-containing and the cytosine-containing polymers with atactic backbones had a low solubility in water whereas those with syndiotactic backbones had a relatively high solubility. For a given polymeric hydrazide backbone the adenine-containing polymers were always the least soluble in water. Most of the ribonucleoside dialdehyde-containing polymers, with the exception of those containing uridine dialdehyde, had only a low solubility in salt solution (0.3M sodium chloride, 0.03M trisodium citrate). No evidence could be obtained for any interaction of these polymers with polynucleotides.

A 514-base pair fragment of double-stranded DNA coding for human interferon-alpha 1 (166 amino acid residues), and containing initiation and termination signals plus appropriate restriction enzyme sites for plasmid insertion, has been totally synthesized. The synthesis involved preparation of 66 oligodeoxyribonucleotides, ranging in size from 14 to 21 residues, plus 1 deoxydecanucleotide, by rapid, solid phase procedures, and enzymatic ligation of the oligonucleotides. After ligation of the synthetic gene to a plasmid vector and transformation of Escherichia coli, clones containing the anticipated gene sequence were obtained.

We have compared sequencing of cloned "polymerase chain reaction" (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with alpha 1-antitrypsin (AAT) deficiency. In families where paternity was in question we confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. We demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, we demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. We have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.

Using a mixture of synthetic 17-mer oligonucleotides encoding the 64 possible sequences for a peptide of adenosine deaminase as probe, we have isolated a clone for adenosine deaminase mRNA sequences from a collection of T-cell cDNA recombinants. This cDNA clone, phADA-1, contains an insert of 0.8 kilobase. In addition to the peptide chosen for synthesis of the oligonucleotide probe, the complete DNA sequence predicts 16 other experimentally determined peptides. Mapping of total cellular human DNAs with several restriction enzymes revealed relatively simple patterns of hybridization with phADA-1 as probe, including a polymorphism for PvuII cleavage. In agreement with previous studies, the adenosine deaminase gene was localized by blot hybridization to chromosome 20 in a hybrid cell mapping panel. Using the cDNA as probe, an 18-kilobase EcoRI fragment of human cellular DNA was also cloned in bacteriophage Charon 4A. These adenosine deaminase clones will prove valuable in the full characterization of the cellular gene, molecular analysis of inherited enzyme deficiency associated with immunodeficiency, and regional mapping of human chromosome 20.

It has been suggested that there is a close linkage between specific restriction fragment polymorphism patterns, defined as haplotypes, in the beta-globin gene cluster and specific mutations in Mediterranean people with thalassaemia. This association formed the basis of a strategy for the efficient characterization of beta-thalassaemia mutations from the DNA sequence of one or two beta-thalassaemia genes derived from each haplotype in each ethnic group. Subsequently, Robertson and Hill argued that this strategy greatly underestimates the number of mutations on haplotypes which are frequent among normal chromosomes. We have therefore now analysed the proposed association and strategy quantitatively by the use of oligonucleotide hybridization and direct restriction analysis. Our results suggest that: (1) the association of specific haplotypes with specific mutations is high, but not invariant; (2) a different beta-thalassaemia mutation has arisen within each haplotype in Mediterraneans; and (3) mutation spread from one haplotype to another occurs mainly through meiotic recombination within a 9-kilobase region 5' to the beta-globin gene.

In an attempt to improve the antiviral efficacy of 5′-amino-2′,5′-dideoxy-5-iodouridine (AIdU) the N-acetyl and N,3′-O-diacetyl derivatives were prepared. N-Acetylation of AIdU increased its ability to inhibit the phosphorylation of thymidine by the deoxypyrimidine kinase of herpes simplex virus type 1 (HSV1) while diacetylation had the converse effect. The affinity of the corresponding compounds containing uracil or thymine for virus deoxypyrimidine kinase was also determined. A range of N-acyl-, N-sulphonyl- and N,3′-O-diacyl- derivatives of AIdU were synthesised; enhanced inhibition of deoxypyrimidine kinase by a number of these compounds was observed. The previous observation that 5′-azido-2′,5′-dideoxy-5-iodouridine has antiherpetic activity in vivo led us to investigate its 3′-O-acetyl derivative as well as the corresponding compound containing uracil. None of the derivatives described showed antiviral activity in cell culture against HSV1; acylation failed to enhance the potency of AIdU against HSV1 in vivo.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.

Deficiency of adenosine deaminase (ADA) is the cause of an autosomal recessive form of immunodeficiency. We sought to define, at a molecular level, the mutations responsible for ADA deficiency in the cell line GM-1715, derived from an immunodeficient patient. Full-length complementary DNA (cDNA) for ADA was synthesized and cloned from the cell line. Sequence analysis of the clones revealed a point mutation in codon 101 (CGG to CAG) that predicts an amino acid change from arginine to glutamine. Southern blot analysis, based on silent polymorphisms in the cDNA sequence, indicated that only one of the defective alleles of the GM-1715 line had been sequenced. The mutation that was identified appears to be responsible for the loss of function in this allele, since the predicted primary structure of the enzyme is otherwise entirely normal.

To perform a systematic analysis of beta-thalassemia genes among Chinese, we have determined the DNA haplotype in the beta-globin gene region of 37 Chinese beta-thalassemia chromosomes. Only four haplotypes were found. Blot hybridization analysis of erythroid RNA from patients homozygous for haplotypes 1, 2, and 3 demonstrated different patterns, suggesting that a different mutation was associated with each haplotype. The mutation associated with haplotype 1 was a C----T substitution at IVS-2, position 654. This mutation produces a new donor splice site and leads to formation of a beta-globin RNA with an insertion of 73 nucleotides. The mutation associated with haplotype 2 was a nucleotide insertion of A between codons 71 and 72, which results in a frameshift and premature termination of beta-globin synthesis. Haplotype analysis suggests that these two mutations may account for up to 85% of beta-thalassemia genes in this ethnic group. The haplotype 3 gene contained a transcriptional "TATA" box mutation that has been previously reported. Oligonucleotide hybridization demonstrated that the mutation associated with haplotype 4 was the same IVS-1 position 5 substitution commonly observed among beta-thalassemia genes in Asian Indians. Since haplotype 4 of Chinese differs at polymorphic sites on either side of the IVS-1 position 5 mutation from the haplotype associated with this mutation in Indians, the mutation presumably arose independently in these two populations.

A 511-base pair DNA fragment encoding human interferon-alpha 2 has been chemically synthesised and expressed from a lac UV5 and a synthetic trp promoter in Escherichia coli. The synthesis involved preparation of 68 oligodeoxyribonucleotides and their enzymic ligation. The product expressed from the trp promoter system had high antiviral activity and displayed biological effects similar to those of Namalwa interferon on natural killer cell activity and in a Daudi cell growth inhibition assay. E.coli minicells containing plasmid DNA with the synthetic IFN-alpha 2 gene under trp promoter control produce a protein with the same electrophoretic mobility as a sample of authentic IFN-alpha 2. The protein from E.coli cross-reacts with the monoclonal antibody NK-2 and was readily purified, close to homogeneity, by immunoadsorption chromatography on NK-2 sepharose.

We have improved the "polymerase chain reaction" (PCR) to permit rapid analysis of any known mutation in genomic DNA. We demonstrate a system, ARMS (Amplification Refractory Mutation System), that allows genotyping solely by inspection of reaction mixtures after agarose gel electrophoresis. The system is simple, reliable and non-isotopic. It will clearly distinguish heterozygotes at a locus from homozygotes for either allele. The system requires neither restriction enzyme digestion, allele-specific oligonucleotides as conventionally applied, nor the sequence analysis of PCR products. The basis of the invention is that unexpectedly, oligonucleotides with a mismatched 3'-residue will not function as primers in the PCR under appropriate conditions. We have analysed DNA from patients with alpha 1-antitrypsin (AAT) deficiency, from carriers of the disease and from normal individuals. Our findings are in complete agreement with allele assignments derived by direct sequencing of PCR products.

The complete amino acid sequence of one of the polypeptide chains of the human T3/T-cell receptor complex, the T3 glycoprotein (T3-delta-chain) of relative molecular mass 20,000, was deduced from cDNA clones derived from HPB-ALL cells and a human T-cell clone. Inspection of the 171-amino acid sequence reveals a signal peptide, a 79-amino acid extracellular domain, one transmembrane region and a 44-amino acid intracellular domain which show no sequence homology with members of the T-cell receptor/immunoglobulin/MHC multi-gene family. The T3 delta-chain is coded for by a single-copy gene the expression of which is restricted to T lymphocytes in humans and mice.

An inverted repeat has been created in a plasmid by ligation of two 13 nucleotide synthetic oligonucleotides into the cloning vector pAT153. The resulting recombinant plasmid, pIRbke8, is hypersensitive to cleavage by the single-strand-specific nuclease S1, and to modification by the single-strand-selective reagent bromoacetaldehyde, when the plasmid is negatively supercoiled. The new inverted repeat is a stronger S1 site than those derived from pBR322, but, in contrast to the ColE1 and phi X174 RF inverted repeats, these repeats share a similar temperature dependence. The kinetics of EcoRI cleavage at the centre of the synthetic inverted repeat have been studied in supercoiled and linear molecules. It is found that in the supercoiled molecule this target is not refractory to EcoRI cleavage to an extent which is greater than the resolution of the experiment. We conclude that in this molecule the cruciform is in a dynamic equilibrium with the regular duplex, in which the cruciform constitutes a relatively small subpopulation of conformational species.

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system.

The most common form of beta-thalassemia among Mediterraneans results from a single nucleotide substitution within the first intervening sequence (IVS-1) of the beta-globin gene. This particular mutation is not detectable in uncloned DNA by restriction enzyme analysis. Using synthetic DNA of 19-nucleotides in length corresponding to the normal and mutant IVS-1 sequences as probes, we have developed a direct assay for this gene defect. Under carefully controlled experimental conditions these synthetic probes detect only their homologous sequences in restriction digests of both cloned and uncloned DNA samples. The method is sufficiently sensitive to establish the genotype of individuals with respect to this defect using approximately 20 micrograms total DNA. This assay provides an alternative to fetal blood and DNA linkage analysis for the prenatal diagnosis of this variety of beta-thalassemia, particularly among Greek families where it is especially common.