Search

Within the context of Ni photoredox catalysis, halogen atom photoelimination from Ni has emerged as a fruitful strategy for enabling hydrogen atom transfer (HAT)-mediated C(sp3)-H functionalization. Despite the numerous synthetic transformations invoking this paradigm, a unified mechanistic hypothesis that is consistent with experimental findings on the catalytic systems and accounts for halogen radical formation and facile C(sp2)-C(sp3) bond formation remains elusive. We employ kinetic analysis, organometallic synthesis, and computational investigations to decipher the mechanism of a prototypical Ni-catalyzed photochemical C(sp3)-H arylation reaction. Our findings revise the previous mechanistic proposals, first by examining the relevance of SET and EnT processes from Ni intermediates relevant to the HAT-based arylation reaction. Our investigation highlights the ability for blue light to promote efficient Ni-C(sp2) bond homolysis from cationic NiIII and C(sp2)-C(sp3) reductive elimination from bipyridine NiII complexes. However interesting, the rates and selectivities of these processes do not account for the productive catalytic pathway. Instead, our studies support a mechanism that involves halogen atom evolution from in situ generated NiII dihalide intermediates, radical capture by a NiII(aryl)(halide) resting state, and key C-C bond formation from NiIII. Oxidative addition to NiI, as opposed to Ni0, and rapid NiIII/NiI comproportionation play key roles in this process. The findings presented herein offer fundamental insight into the reactivity of Ni in the broader context of catalysis.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Abstract Interest in winter limnology is growing rapidly, but progress is hindered by a shortage of standardized multivariate datasets on winter conditions. Addressing the winter data gap will enhance our understanding of winter ecosystem function and of lake response to environmental change. Here, we describe a dataset generated by a multi‐institutional winter sampling campaign across all five Laurentian Great Lakes and some of their connecting waters (the Great Lakes Winter Grab). The objective of Winter Grab was to characterize mid‐winter limnological conditions in the Great Lakes using standard sample collection and analysis methods. Nineteen research groups sampled 49 locations varying widely in depth and trophic status, collecting a range of limnological data. This dataset includes physical, chemical, and biological measurements. These data can be used to examine diverse aspects of Great Lakes ecosystems or integrated with winter observations from other lakes to improve understanding of winter limnology across different aquatic systems.

Abstract Atrial fibrillation (AF) is the most common sustained arrhythmia in humans, yet the molecular basis of AF remains incompletely understood. To determine the cell type-specific transcriptional changes underlying AF, we perform single-nucleus RNA-seq (snRNA-seq) on left atrial (LA) samples from patients with AF and controls. From more than 175,000 nuclei we find that only cardiomyocytes (CMs) and macrophages (MΦs) have a significant number of differentially expressed genes in patients with AF. Attractin Like 1 (ATRNL1) was overexpressed in CMs among patients with AF and localized to the intercalated disks. Further, in both knockdown and overexpression experiments we identify a potent role for ATRNL1 in cell stress response, and in the modulation of the cardiac action potential. Finally, we detect an unexpected expression pattern for a leading AF candidate gene, KCNN3. In sum, we uncover a role for ATRNL1 which may serve as potential therapeutic target for this common arrhythmia.

Abstract Social connections among individuals are essential components of social‐ecological systems (SESs), enabling people to take actions to more effectively adapt or transform in response to widespread social‐ecological change. Although scholars have associated social connections and cognitions with adaptive capacity, measuring actors' social networks may further clarify pathways for bolstering resilience‐enhancing actions. We asked how social networks and socio‐cognitions, as components of adaptive capacity, and SES regime shift severity affect individual landscape management behaviours using a quantitative analysis of ego network survey data from livestock producers and landcover data on regime shift severity (i.e. juniper encroachment) in the North American Great Plains. Producers who experienced severe regime shifts or perceived high risks from such shifts were not more likely to engage in transformative behaviour like prescribed burning. Instead, we found that social network characteristics explained significant variance in transformative behaviours. Policy implications: Our results indicate that social networks enable behaviours that have the potential to transform SESs, suggesting possible leverage points for enabling capacity and coordination toward sustainability. Particularly where private lands dominate and cultural practices condition regime shifts, clarifying how social connections promote resilience may provide much needed insight to bolster adaptive capacities in the face of global change. Read the free Plain Language Summary for this article on the Journal blog.

Framed by Bakhtinian theories of authoritative discourse and heteroglossia, this study examines perceptions of a Science-of-Reading-based state reading initiative five years into implementation. Using interview transcripts, researchers engaged in polyphonic analysis to bring the voices of teachers, reading interventionists, parents, administrators, and state department of education officials into created dialogue. Findings from this qualitative study suggest there were contrasting perspectives about reading and the SRI, that many participants felt the initiative narrowed reading instruction and constrained teachers' agency, and that, overall, there have been limited opportunities for dialogue about the initiative. Findings demonstrate that a narrow view of reading research may silence and delegitimize some stakeholder voices. This state's goal of sharpening the focus of reading instruction led to instruction that was perceived by some stakeholders as narrow, boring, and meaningless, unlikely to create the statewide culture of reading that was targeted. Implications for this and future state reading initiatives point to the value of dialogue among varied stakeholders, which might allow for the idiosyncrasies of the teaching and learning of reading and writing to be addressed.

Summary: We sought to characterize cellular composition across the cardiovascular system of the healthy Wistar rat, an important model in preclinical cardiovascular research. We performed single-nucleus RNA sequencing (snRNA-seq) in 78 samples in 10 distinct regions, including the four chambers of the heart, ventricular septum, sinoatrial node, atrioventricular node, aorta, pulmonary artery, and pulmonary veins, which produced 505,835 nuclei. We identified 26 distinct cell types and additional subtypes, with different cellular composition across cardiac regions and tissue-specific transcription for each cell type. Several cell subtypes were region specific, including a subtype of vascular smooth muscle cells enriched in the large vasculature. We observed tissue-enriched cellular communication networks, including heightened Nppa-Npr1/2/3 signaling in the sinoatrial node. The existence of tissue-restricted cell types suggests regional regulation of cardiovascular physiology. Our detailed transcriptional characterization of each cell type offers the potential to identify novel therapeutic targets and improve preclinical models of cardiovascular disease.

Background The relationship between alcohol consumption and ectopic fat distribution, both known factors for cardiovascular disease, remains understudied. Therefore, we aimed to examine the association between alcohol consumption and ectopic adiposity in adults at risk for cardiovascular disease. Methods and Results In this cross-sectional analysis, we categorized alcohol intake among participants in MESA (Multi-Ethnic Study of Atherosclerosis) as follows (drinks/day): 2 (heavy drinking), former drinking, and lifetime abstention. Binge drinking was defined as consuming ≥5 drinks on 1 occasion in the past month. Visceral, subcutaneous, and intermuscular fat area, pericardial fat volume, and hepatic fat attenuation were measured using noncontrast computed tomography. Using multivariable linear regression, we examined the associations between categories of alcohol consumption and natural log-transformed fat in ectopic depots. We included 6756 MESA participants (62.1±10.2 years; 47.2% women), of whom 6734 and 1934 had chest computed tomography (pericardial and hepatic fat) and abdominal computed tomography (subcutaneous, intermuscular, and visceral fat), respectively. In adjusted analysis, heavy drinking, relative to lifetime abstention, was associated with a higher (relative percent difference) pericardial 15.1 [95% CI, 7.1-27.7], hepatic 3.4 [95% CI, 0.1-6.8], visceral 2.5 [95% CI, -10.4 to 17.2], and intermuscular 5.2 [95% CI, -6.6 to 18.4] fat but lower subcutaneous fat -3.5 [95% CI, -15.5 to 10.2]). The associations between alcohol consumption and ectopic adiposity exhibited a J-shaped pattern. Binge drinking, relative to light-to-moderate drinking, was also associated with higher ectopic fat. Conclusions Alcohol consumption had a J-shaped association with ectopic adiposity. Both heavy alcohol intake and binge alcohol drinking were associated with higher ectopic fat.

Virtual reality (VR) integration into surgical education has gained immense traction by invigorating skill-building in ways that are unlike the traditional modes of training. This systematic review unites current literature relevant to VR in surgical education to showcase tool transferability, and subsequent impact on knowledge acquisition, skill development, and technological innovation. This review followed the PRISMA guidelines and included three databases. Among the 1926 studies that were screened, 31 studies met the inclusion criteria. ChatGPT assisted in generating variables for data extraction, and the authors reached unanimous consensus on 13 variables that provided a framework for assessing VR attributes. Surgical simulation was examined in 26 studies (83.9%). VR applications incorporated anatomy visualization (83.9%), procedure planning (67.7%), skills assessment (64.5%), continuous learning (41.9%), haptic feedback (41.9%), research and innovation (41.9%), case-based learning (22.6%), improved skill retention (19.4%), reduction of stress and anxiety (16.1%), and remote learning (12.9%). No instances of VR integration addressed patient communication or team-based training. Novice surgeons benefited the most from VR simulator experience, improving their confidence and accuracy in tackling complex procedural tasks, as well as decision-making efficiency. Enhanced dexterity compared to traditional modes of surgical training was also notable. VR confers significant potential as an adjunctive teaching method in plastic and reconstructive surgery (PRS). Studies demonstrate the utility of virtual simulation in knowledge acquisition and skill development, though they lack targeted approaches for augmenting training related to collaboration and patient communication. Given the underrepresentation of PRS among surgical disciplines regarding VR implementation in surgical education, longitudinal curriculum integration and PRS-specific technologies should be further investigated.

Mapping gene networks requires large amounts of transcriptomic data to learn the connections between genes, which impedes discoveries in settings with limited data, including rare diseases and diseases affecting clinically inaccessible tissues. Recently, transfer learning has revolutionized fields such as natural language understanding1,2 and computer vision3 by leveraging deep learning models pretrained on large-scale general datasets that can then be fine-tuned towards a vast array of downstream tasks with limited task-specific data. Here, we developed a context-aware, attention-based deep learning model, Geneformer, pretrained on a large-scale corpus of about 30 million single-cell transcriptomes to enable context-specific predictions in settings with limited data in network biology. During pretraining, Geneformer gained a fundamental understanding of network dynamics, encoding network hierarchy in the attention weights of the model in a completely self-supervised manner. Fine-tuning towards a diverse panel of downstream tasks relevant to chromatin and network dynamics using limited task-specific data demonstrated that Geneformer consistently boosted predictive accuracy. Applied to disease modelling with limited patient data, Geneformer identified candidate therapeutic targets for cardiomyopathy. Overall, Geneformer represents a pretrained deep learning model from which fine-tuning towards a broad range of downstream applications can be pursued to accelerate discovery of key network regulators and candidate therapeutic targets.

BACKGROUND: As the largest conduit vessel, the aorta is responsible for the conversion of phasic systolic inflow from ventricular ejection into more continuous peripheral blood delivery. Systolic distention and diastolic recoil conserve energy and are enabled by the specialized composition of the aortic extracellular matrix. Aortic distensibility decreases with age and vascular disease. OBJECTIVES: In this study, we sought to discover epidemiologic correlates and genetic determinants of aortic distensibility and strain. METHODS: We trained a deep learning model to quantify thoracic aortic area throughout the cardiac cycle from cardiac magnetic resonance images and calculated aortic distensibility and strain in 42,342 UK Biobank participants. RESULTS: Descending aortic distensibility was inversely associated with future incidence of cardiovascular diseases, such as stroke (HR: 0.59 per SD; P = 0.00031). The heritabilities of aortic distensibility and strain were 22% to 25% and 30% to 33%, respectively. Common variant analyses identified 12 and 26 loci for ascending and 11 and 21 loci for descending aortic distensibility and strain, respectively. Of the newly identified loci, 22 were not significantly associated with thoracic aortic diameter. Nearby genes were involved in elastogenesis and atherosclerosis. Aortic strain and distensibility polygenic scores had modest effect sizes for predicting cardiovascular outcomes (delaying or accelerating disease onset by 2%-18% per SD change in scores) and remained statistically significant predictors after accounting for aortic diameter polygenic scores. CONCLUSIONS: Genetic determinants of aortic function influence risk for stroke and coronary artery disease and may lead to novel targets for medical intervention.

With the emergence of large-scale sequencing data, methods for improving power in rare variant association tests are needed. Here we show that adjusting for common variant polygenic scores improves yield in gene-based rare variant association tests across 65 quantitative traits in the UK Biobank (up to 20% increase at α = 2.6 × 10-6), without marked increases in false-positive rates or genomic inflation. Benefits were seen for various models, with the largest improvements seen for efficient sparse mixed-effects models. Our results illustrate how polygenic score adjustment can efficiently improve power in rare variant association discovery.

IntroductionIndigenous communities globally are inequitably affected by non-communicable diseases such as cancer and coronary artery disease. Increased focus on personalized medicine approaches for the treatment of these diseases offers opportunities to improve the health of Indigenous people. Conversely, poorly implemented approaches pose increased risk of further exacerbating current inequities in health outcomes for Indigenous peoples. The advancement of modern biology techniques, such as three-dimensional (3D) in vitro models and next generation sequencing (NGS) technologies, have enhanced our understanding of disease mechanisms and individualized treatment responses. However, current representation of Indigenous peoples in these datasets is lacking. It is crucial that there is appropriate and ethical representation of Indigenous peoples in generated datasets to ensure these technologies can be used to maximize the benefit of personalized medicine for Indigenous peoples.MethodsThis project discusses the use of 3D tumor organoids and single cell/nucleus RNA sequencing to study cancer treatment responses and explore immune cell roles in coronary artery disease. Using key pillars from currently available Indigenous bioethics frameworks, strategies were developed for the use of Māori participant samples for live tissue and sequencing studies. These were based on extensive collaborations with local Māori community, scientific leaders, clinical experts, and international collaborators from the Broad Institute of MIT and Harvard. Issues surrounding the use of live tissue, genomic data, sending samples overseas and Indigenous data sovereignty were discussed.ResultsThis paper illustrates a real-world example of how collaboration with community and the incorporation of Indigenous worldviews can be applied to molecular biology studies in a practical and culturally responsive manner, ensuring fair and equitable representation of Indigenous peoples in modern scientific data.

Introduction As the usage of online platforms becomes increasingly prevalent to share information, it is essential to garner a better understanding of the content disseminated across the internet. Studies have found that patients are relying on online resources to gather medical information, potentially encountering misinformation. The sharing of information concerning primary headaches, despite affecting a large portion of the world’s population, has not been comprehensively analysed through the lens of online content. This scoping review seeks to explore the extent of available information, uncover existing gaps in knowledge, and to serve as a resource for healthcare providers to educate themselves to provide informed care to patients.Methods and analysis Studies considered for inclusion are those focused on primary headache (including migraines, tension headaches and cluster headaches) content posted on a community platform. Any online community forum will be eligible, including but not limited to TikTok, Twitter, Facebook, YouTube, Instagram, online forums and blogs. Studies will be limited to those published in English, with no geographic restriction. Five electronic databases, namely PubMed, Cochrane Library, Scopus, EMBASE, PsycInfo, will be searched for published reports. Two reviewers will independently screen titles and abstracts. The reviewers will then assess the full texts selected. In both cases, disagreements will be discussed with a third reviewer and consensus will be achieved. Data analysis will be descriptive with a narrative summary.Ethics and dissemination Since this is a scoping review of previously published summary data, ethical approval for this study is not needed. Findings will be published in a peer-reviewed journal.Trial Registration Number This protocol is registered on the Open Science Framework Repository (https://doi.org/10.17605/OSF.IO/2MAFN).

BACKGROUND: Solid organ transplantation is the therapy of choice for many patients with end-stage organ failure; however, recipients must remain on lifelong immunosuppression, leaving them susceptible to infections and cancer. The study of transplant tolerance to prolong graft survival in the absence of immunosuppression has been restricted to recipients of living donor allografts; however, deceased donors significantly outnumber living donors. Mobilization of hematopoietic stem cells (HSCs) from the bone marrow to peripheral blood (PB) could allow PB-HSCs to be used to induce tolerance in deceased donor kidney recipients; however, a major concern is the well-known concomitant mobilization of immune cells into the liver. METHODS: We mobilized HSCs to the PD using a protocol of 2 doses of granulocyte colony-stimulating factor and 1 dose of plerixafor, followed by the collection of mobilized cells via apheresis in 3 deceased donors. The physiological, laboratory, and radiographic parameters were monitored throughout the procedure. Longitudinal biopsies were performed to assess the potential for ectopic liver mobilization. RESULTS: The use of both agents led to the successful mobilization of peripheral blood CD34+ cells, demonstrating the potential for use in transplant tolerance protocols. Increased immune cell trafficking into the liver was not observed, and apheresis of mobilized cells resulted in a uniform decrease in all liver leukocyte subsets. CONCLUSIONS: HSCs can be mobilized and collected from the PB of brain-dead donors. This new approach may facilitate the dissemination of immune tolerance trials beyond living-donor kidney transplantation to deceased-donor transplantation, without sacrificing the transplantability of the liver.

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

BackgroundA key goal of precision medicine is to disaggregate common, complex diseases into discrete molecular subtypes. Rare coding variants in the low-density lipoprotein receptor gene (LDLR) are identified in 1% to 2% of coronary artery disease (CAD) patients, defining a molecular subtype with risk driven by hypercholesterolemia.MethodsTo search for additional subtypes, we compared the frequency of rare, predicted loss-of-function and damaging missense variants aggregated within a given gene in 41 081 CAD cases versus 217 115 controls.ResultsRare variants in LDLR were most strongly associated with CAD, present in 1% of cases and associated with 4.4-fold increased CAD risk. A second subtype was characterized by variants in endothelial nitric oxide synthase gene (NOS3), a key enzyme regulating vascular tone, endothelial function, and platelet aggregation. A rare predicted loss-of-function or damaging missense variants in NOS3 was present in 0.6% of cases and associated with 2.42-fold increased risk of CAD (95% CI, 1.80-3.26; P=5.50×10-9). These variants were associated with higher systolic blood pressure (+3.25 mm Hg; [95% CI, 1.86-4.65]; P=5.00×10-6) and increased risk of hypertension (adjusted odds ratio 1.31; [95% CI, 1.14-1.51]; P=2.00×10-4) but not circulating cholesterol concentrations, suggesting that, beyond lipid pathways, nitric oxide synthesis is a key nonlipid driver of CAD risk.ConclusionsBeyond LDLR, we identified an additional nonlipid molecular subtype of CAD characterized by rare variants in the NOS3 gene.

The liver regulates energy partitioning and use in a sex-dependent manner, coupling hepatic substrate availability to female reproductive status. Fibroblast growth factor 21 (FGF21) is a hepatokine produced in response to metabolic stress that adaptively directs systemic metabolism and substrate use to reduce hepatic lipid storage. Here we report that FGF21 altered hepatic transcriptional and metabolic responses, and reduced liver triglycerides, in a sex-dependent manner. FGF21 decreased hepatic triglycerides in obese male mice in a weight loss-independent manner; this was abrogated among female littermates. The effect of FGF21 on hepatosteatosis is thought to derive, in part, from increased adiponectin secretion. Accordingly, plasma adiponectin and its upstream adrenergic receptor → cAMP → exchange protein directly activated by cAMP signaling pathway was stimulated by FGF21 in males and inhibited in females. Both ovariectomized and reproductively senescent old females responded to FGF21 treatment by decreasing body weight, but liver triglycerides and adiponectin remained unchanged. Thus, the benefit of FGF21 treatment for improving hepatosteatosis depends on sex but not on a functional female reproductive system. Because FGF21 provides a downstream mechanism contributing to several metabolic interventions, and given its direct clinical importance, these findings may have broad implications for the targeted application of nutritional and pharmacological treatments for metabolic disease.