Search

Campylobacter’ler hem ishal, hem de sistemik hastalıklara yol açan ve dünyada en yaygın enfeksiyon etkenleri arasındadır. Termofilik Campylobacter türlerinin sebep olduğu gastroenteritlerin genellikle gıda kaynaklı olduğu bildirilmesine rağmen son yıllarda su kaynaklı olgular da bildirilmiştir. Bu çalışmanın amacı, Edirne il merkezi, ilçe merkezleri ve kırsal bölgelerdeki (köy, belde ve özel işletmeler) içme sularından termofilik Campylobacter’lerin (C. jejuni, C. coli ve C. lari) tespit edilmesidir. Ayrıca tespit edilen termofilik Campylobacter’lerin mevsimlere ve su kaynaklarına göre değişkenliklerinin saptanmasıdır. Bunun için toplanan örneklerden, önce ISO 9308-1: 2014 standardına göre membran süzme yöntemiyle fekal kirliliğin kesin bir göstergesi olan Escherichia coli’nin araştırılması ve sayımı yapılmıştır. Daha sonra sadece E. coli’nin tespit edildiği örneklerden iki farklı ticari kit ile termofilik Campylobacter türlerinin qPCR analizleri yapılmıştır. Çalışmamızda, 455 farklı istasyondan alınan 1644 su örneğinin 67 tanesinde E. coli tespit edilmiştir. E. coli tespit edilen örneklerin tamamının yer altı suyu olduğu, herhangi bir arıtma işleminden geçirilmediği ve sadece 1 su örneğinde 0,3 ppm olup geri kalanların serbest klor miktarlarının 0 ppm olduğu görülmüştür. v Mericon Campylobacter Triple Kit ile multipleks qPCR analizinde 67 su örneğinin 32 tanesinde termofilik Campylobacter (C. jejuni, C. coli ve C. lari) tespit edilmiştir. Ancak Mericon Campylobacter Triple Kit ile üç türden hangisine ya da hangilerine ait olduğu saptanamadığından görülme ihtimali en fazla olan C. jejuni’nin tespiti için C. jejuni Standart Kit kullanılmıştır. C. jejuni Standart Kit ile qPCR analizinde 67 su örneğinin 5 tanesi pozitif tespit edilmiştir. Bölgemizde ve Türkiye’de ilk kez yapılan bu çalışmada, Edirne’nin bütün bölgelerindeki içme sularında termofilik Campylobacter’lerin bulunabileceğini ve içme suyu olarak kullanılan suyun arıtımı, depolanması ve dağıtımında meydana gelen aksaklıkların muhtemel termofilik Campylobacter salgınlarına sebep olabileceğini göstermektedir. Campylobacters are among the most common infectious agents in the world that cause both diarrhea and systemic diseases. Although gastroenteritis caused by thermophilic Campylobacter species has been reported due to food consumption, waterborne cases have also been reported in recent years. The aim of this study is to determine the presence of thermophilic Campylobacter (C. jejuni, C.coli and C. lari) in drinking water sampled from Edirne city center, district centers and rural areas (villages, towns and private enterprises). We also aimed to determine the variations in the distribution of thermophilic Campylobacter according to the seasons and water resources. For this purpose, Escherichia coli, which is a definite indicator of fecal pollution, was investigated and counted by membrane filtration method according to ISO 9308-1: 2014 Standard. Then, qPCR analyses of thermophilic Campylobacter species were performed by using two different commercial kits for E. coli detected samples. In our study, E. coli was detected in 67 out of 1644 water samples taken from 455 different stations. It was observed that all of the samples contaminated with E. coli were groundwater samples, which were not subjected to any treatment process, and only 1 water sample contained 0,3 ppm of chlorine. The free chlorine amount was 0 ppm in the rest of the samples vii Thermophilic Campylobacter (C. jejuni, C. coli and C. lari) was detected in 32 out of 67 water samples by multiplex qPCR analysis using Mericon Campylobacter Triple Kit. However, since the Mericon Campylobacter Triple Kit could not determine the bacterial species, C. jejuni Standard Kit was used to detect the C. jejuni which is the most likely species to be seen. In qPCR analysis by using the C. jejuni Standard Kit, 5 of 67 water samples were positive. This study, which was carried out for the first time in our region, and in Turkey, shows that thermophilic Campylobacter can be found in drinking water in all regions of Edirne, and disruptions in the treatment, storage and distribution of water may cause possible thermophilic Campylobacter epidemics.

Amaç: Çalışmamız, oyun parklarının engelli çocuklara uygunluğunun değerlendirilmesi amacıyla Ankara’da gerçekleştirildi. Gereç ve Yöntem: Çalışmaya Ankara’da bulunan, belediyelerin internet sitelerinde engellilere özel dizayn edildiği belirtilen beş oyun grubu dahil edildi. Kişi-Çevre-Aktivite Modeli çerçevesinde ebeveyn ve çocuk memnuniyeti, oyun grupları, ve oyun alanında çocuğun nasıl oynadığı yarı yapılandırılmış değerlendirme formu, nicel ve nitel gözlemler ile değerlendirildi. Sonuçlar: 25 ebeveynden 13’ünün (%52), 25 çocuktan 10’unun (%40) oyun gruplarından hiç memnun olmadıkları belirlendi. Parkların görme engelli çocuklar için uygun olmadığı tespit edildi. Bedensel engelli çocuklar için de oyun araçlarının bağımsız transfere uygun olmadığı, çocukların kendi başına oynamasına olanak sağlamadığı, ailelerin oyun gruplarının güvenliği konusunda tereddütlü olduğu tespit edildi. Oyun gruplarında çocukların gelişimsel ihtiyaçlarını karşılayacak çeşitliliğin olmadığı gözlendi. Tartışma: Oyun gruplarının engelli çocuklar için kullanıma uygun olmadığı sonucuna ulaşıldı. Bir standardın olmayışı, gerekli bakım çalışmalarının yapılmayışı ve dizayn profesyonellerinin bilinçsiz tutumu engelli çocukların Ankara’daki oyun alanlarına erişiminde sorun teşkil etmektedir. Bu kapsamda ergoterapistler, Türk Standartları Enstitüsü yetkililerinin, oyun grubu üretim şirketleri, çocuk gelişimi uzmanları, özel eğitim öğretmenleri ile birlikte oyun alanlarını fiziksel ve sosyal ayrıma izin vermeden erişilebilir hale getirmek ve kişilerin memnuniyetini artırmak amacıyla yerel yönetimlerin, oyun alanlarına verdiği önemi artırması konusunda çalışmalar yürütebilir, Purpose: This study’s aim was, to assess the compliance of playgrounds for disabled children in Ankara. Materials and Methods: Located on websites of municipality that are specially designed for disabled, five play ground included the study. Parents and children pleasure, play grounds and how children play at disabled play areas had evalutaioned by PEO Model. Result: 13 of the 25 parents (%52) 10 of 25 children (%40) satisfaction level from play grounds iswas 0. The evaluations carried out, there is not any an extra precaution for visually impaired children at play areas. Any one of the play vehicle was t appropriate to independent transfer for physically disabled children. It has been observed that, there is not a diversity to meet the developmental needs of the children in the play group. Conclusion: Play areas were not suitable for disabled children. Disabled children cannot access to the playgrounds in Ankara due to lack of a standard, maintance problems and unconscious attitudes of design professional. In this context occupational therapist can cooperate with local authority and the professionals like special educators and pedagogs about developing better playgrounds which suppots child development.

Background: The adhesion process of Borrelia burgdorferi to susceptible host cell has not yet been completely understood regarding the function of OspA, OspB and OspC proteins and a conflict exists in the infection process. Aims: The adhesion rates of pathogenic (low BSK medium passaged or susceptible rat joint tissue co-cultivated ) or non-pathogenic Borrelia burgdorferi (high BSK medium passaged) isolate (FNJ) to human umbilical vein endothelial cells (HUVEC) cultured on coverslips and the synthesis of OspA and OspC proteins were investigated to analyze the infection process of this bacterium. Study Design: In-vitro study. Methods: Spirochetes were cultured in BSK medium or in a LEW/N rat tibiotarsal joint tissue feeder layer supported co-culture system using ESG coculture medium and labelled with 3H-adenine for 48 hours. SDS-PAGE, Western Blotting, Immunogold A labeling as well as radiolabeling experiments were used to compare pathogenic or non pathogenic spirochetes during the adhesion process. Results: Tissue co-cultured B. burgdorferi adhered about ten times faster than BSK-grown spirochetes. Trypsin inhibited attachment to HUVEC and coculture of trypsinized spirochetes with tissues reversed the inhibition. Also, the synthesis of OspC protein by spirochetes was increased in abundance after tissue co-cultures, as determined by SDS-PAGE and by electron microscopy analysis of protein A-immunogold staining by anti-OspC antibodies. OspA protein was synthesized in similar quantities in all Borrelia cultures analyzed by the same techniques. Conclusion: Low BSK passaged or tissue co-cultured pathogenic Lyme disease spirochetes adhere to HUVEC faster than non-pathogenic high BSK passaged forms of this bacterium. Spirochetes synthesized OspC protein during host tissue-associated growth. However, we did not observe a reduction of OspA synthesis during host tissue co-cultivation in vitro.

Çalışmamızın yapılmasının amacı laboratuvar ortamında patojen bakterilerin izolasyonunun hızlandırılması, kültürel metotların hata paylarının azaltılması ve maliyetinin düşürülmesidir. Çalışmada, E.coli O157:H7 (ATCC 43888) ve Salmonella ssp. (ATCC 13076) suşları ve 103 adet Edirne ilinden temin edilen gıda örnekleri kullanılmıştır. Deneylerde suşlar ve gıda örnekleri 3 paralel olarak test edilmiştir ve test edilen suşlar ve gıda örneklerindeki patojen mikroorganizmanın varlığı " Tespit Edildi / Tespit Edilemedi " şeklinde tanımlanmıştır. Çalışmada %0,5 ’ lik sodyum klorür (NaCl) ile 1 N (Normal) hidroklorik asit (HCl) solüsyonunun dilüsyonları (1/2 N,1/4N, 1/6 N, 1/8 N ve 1/10 N HCl asit) kullanılarak düşük asit direncine sahip patojen mikroorganizmaların gıdalardan izolasyonu amaçlanmıştır. HCl asit dilüsyonları sayesinde patojen mikroorganizmaların Uluslararası Standardizasyon Örgütü (ISO) yöntemleri ışığında, daha az besiyeri kullanılarak ve kısa zamanda gıdadaki mevcut mikroorganizmaların izolasyonunu gerçekleştirmek hedeflenmiştir. Aside dirençli olan suşları gıdalardan daha kolay izolasyonu için zenginleştirme kullanılarak veya kullanılmadan patojen mikroorganizmaların izolasyonu çalışılmıştır. ISO yöntemlerinde kullanılan besiyerleri başka mikroorganizmaların üremelerine imkân sağlayacak içeriğe sahiptir, bu yüzden HCl asit dilüsyonları kullanılarak gıdada bulunan saprofit mikroorganizmaların uzaklaştırılması amaçlanmıştır. Böylelikle seçici izolasyon tekniği ilk kez asit solüsyonları ile uygulanmıştır. Örneklerden Salmonella ssp. ve E.coli O157H:7 bakterilerinin izolasyonu için: çalışma örnekleri öncelikle ISO 6579-1:2017 ve ISO 16654:2001/Amd 1:2017 yöntemiyle çalışılmıştır. Aynı örnekler klasik metotlarında yer alan ön zenginleştirme aşaması yapılmadan HCl asit dilüsyonlarında bekletilmesi (30 sn. ve 1 dakika) yapılıp seçici besiyerlerine ekimleri gerçekleştirilip uygun sıcaklıkta inkübasyonu yapılmıştır. Aynı örnekler klasik metotta yer alan ön zenginleştirme sonrası HCl asitte dilüsyonlarında bekletilme (30 saniye ve 1 dakika) yapılıp seçici besiyerlerine ekimleri gerçekleştirilip uygun sıcaklıkta inkübasyonu yapılmıştır. Çalışması yapılan 103 örnekten dördünde asit dilüsyonlarında ve klasik izolasyon yönteminde bakteri üremeleri tespit edildi. Sucuk (A) örneğinde ön zenginleştirme öncesi ve sonrası 1/10 N HCl asit dilüsyonunda ve klasik izolasyon metodunda E.coli O157:H7 bakterisi tespit edilmiştir. Taze sığır eti örneği ön zenginleştirme öncesi ve sonrası 1/2 N, 1/10 N HCl asit dilüsyonlarında ve klasik izolasyon metodunda E.coli O157:H7 bakterisi izole edilmiştir. Kremşanti(B) örneğinde zenginleştirme öncesi ve sonrası 1/6 N, 1/10 N HCl asit dilüsyonlarında ve klasik izolasyon yönteminde Salmonella ssp. bakterisi izole edilmiştir. Toz çorba (C) örneğinde ön zenginleştirme öncesi ve sonrası 1/6N, 1/8N, 1/10N HCl asit dilüsyonlarında ve klasik izolasyon yönteminde Salmonella ssp. tespit edilmiştir. HCl asit ile muamele etme işleminin duyarlılık veya dirençlilik açısından bakteri izolasyonlarını hızlandırdığı gözlenmiştir. Böylelikle, bakterilerin izolasyonlarının daha güvenilir ve hızlı bir şekilde yapılabileceği belirlenmiştir. Çalışmamız bu yöntemi ilk kez gıda numunelerinde doğrulamıştır. The reason of our study is to accelerate the isolation of enteric bacteria in the laboratory environment, to reduce the margin of error and to reduce the cost of cultural methods. In this study Escherichia coli O157: H7 (ATCC 43888) and Salmonella ssp. (ATCC 13076) strains and 103 food samples obtained from Edirne province were used. In experiments, strains and food samples were tested in triplicates and the presence of pathogenic microorganism in the tested strains and food samples were defined as "Detected / Not Detected" in our study. Dilutions of 0.5% sodium chloride (NaCl) and 1 N (Normal) hydrochloric acid (HCl) solution (1/2 N, 1/4 N, 1/6 N, 1/8 N and 1/10 N HCl acid) were applied. It was aimed to isolate pathogenic microorganisms with low acid resistance from foods. Was HCl acid dilutions, it was aimed to isolate pathogenic microorganisms in the light of International Organization of Standardization (ISO) methods, using less medium in a short time. Isolation of pathogenic microorganisms without the use of food enrichment for easier isolation of the acid resistant strains were studied. The media used in ISO methods have a content that allows other microorganisms to grow, so we aimed to remove saprophyte microorganisms in food by using HCl acid dilutions. Thus, the selective isolation technique was applied for the first time with acid solutions. Salmonella ssp. and E.coli O157H:7 working samples were first studied with the method of ISO 6579-1: 2017 and ISO 16654: 2001 / Amd 1: 2017. The same samples were kept in HCl acid dilutions (30 seconds and 1 minute) without the pre-enrichment step in classical methods, they were cultivated on selective media and incubated at the appropriate temperature. The same samples were kept in dilutions (30 seconds and 1 minute) in HCl acid after the pre-enrichment in the classical method, they were cultivated on selective media and incubated at the appropriate temperature. Bacterial growth was detected in acid dilutions and classical isolation method in four of the 103 samples studied. E.coli O157: H7 bacteria were detected in the 1/10 N HCl acid dilution before and after pre-enrichment in the sausage(A) sample and in the classical isolation method. E.coli O157: H7 bacteria were isolated from fresh beef sample before and after preenrichment in 1/2 N, 1/10 N HCl acid dilutions and classical isolation method. In the heavy cream (B) sample before and after enrichment, in 1/6 N, 1/10 N HCl acid dilutions and in the classical isolation method, Salmonella ssp. bacteria isolated. Salmonella ssp. in acid dilutions of 1/6 N, 1/8 N, 1/10 N HCl before and after pre-enrichment in the powdered soup (C) sample and in the classical isolation method. It has been observed that the treatment with HCl acid accelerates bacterial isolation in terms of sensitivity and acid resistance. Thus, it has been shown that the isolation of bacteria can be done more safely and quickly. Our study has confirmed the usefulness of this method for the first time in food samples.

Bu çalışmada, Edirne'deki çevresel sulardan alınan su numunelerinde ve çevresel sularda yaşayan kurbağalarda Leptospira sp. cinsi bakterilerin varlığı araştırılmıştır. Çevresel sulardan alınan 44 su numunesinde ve 100 kurbağa böbreğinde alınan doku örneklerinde moleküler ve bakteriyolojik yöntemler kullanılarak patojen bakteriler araştırılmıştır. Ayrıca karanlık alan mikroskopisi ile Leptospira sp. cinsi bakteriler saptanmıştır. 5-FU içeren EMJH besiyerinde kültürü yapılan bakteriler giemsa yöntemi ile boyanmıştır. Su numunelerinin membran filtrasyon yöntemi ile çalışılarak hazırlanan kültürlerin karanlık alan mikroskopisi ile değerlendirilmesinde 44 su numunesinin sadece 1' inde (%2,27) Leptospira spp. tespit edilmiştir. Kurbağa böbreğinden alınan doku örneklerinden yapılan kültürlerin karanlık alan mikroskobunda değerlendirilmesi sonucu 100 adet kurbağa böbreğine ait kültürden 7'sinde (%7) Leptospira spp. tespit edilmiştir. Leptospira spp. tespit edilen toplam 8 kültürden hazırlanan preperatlar Giemsa yöntemi ile boyanarak spiroketler ışık mikroskobu ile görüntülenmiştir. Leptospira tespit edilen 8 adet kültürden izole edilen DNA'lar sec Y (preprotein translocase for Leptospira) proteinini kodlayan gen bölgesine ait primerler (GCGATTCAGTTTAATCCTGC ve GAGTTAGAGCTCAAATCTA) kullanılarak Real-Time PCR ile çoğaltılmıştır. Bu çalışma ile ilk kez Edirne ve çevresindeki sularda ve bu sularda yaşayan kurbağalarda non-patojen, saprofit Leptospira cinsi spiroketlerin varlığı gösterilmiştir. In this study, presence of bacteria of the genus Leptospira were investigated in surface water and frog tissue samples collected from Edirne and surroundings. By using the dark field microscopy, Giemsa staining and by inoculating EHJH medium with 5-FU, presence of Leptospira were investigated. Cultivated bacteria were genotyping by using the RT-PCR technique and species-specific probes to determine the pathogenic Leptospira interrogans complex. As a result, when water samples were prepared by the membrane filtration method and evaluated by dark field microscopy, only 1 'of water samples (2,27%) were contained Leptospira spp. Also cultured frog kidney samples were evaluated in the dark field microscope. Seven (7%) of the frog kidney sampels belonging to the frog kidney were found to be positive for Leptospira. Bacterie were stained from positive cultures by using Giemsa method. DNA sampeles isolated from 8 leptospira cultures were amplified by Real-Time PCR using the gene locus primers (GCGATTCAGTTTAATCCTGC and GAGTTAGAGCTCAAATCTA) encoding the sec-Y (preprotein translocase for Leptospira) protein. Pathogen Leptospira interrogans was not found in the study. First time, in this study, non- patogenic, saprophitic Leptospira genus spirochetes were demonstrated in surface waters and frog tissue samples in Edirne and surrounding. 79

Bu çalışmada, Edirne’deki çevresel sulardan alınan su numunelerinde ve çevresel sularda yaşayan kurbağalarda Leptospira sp. cinsi bakterilerin varlığı araştırılmıştır. Çevresel sulardan alınan 44 su numunesinde ve 100 kurbağa böbreğinde alınan doku örneklerinde moleküler ve bakteriyolojik yöntemler kullanılarak patojen bakteriler araştırılmıştır. Ayrıca karanlık alan mikroskopisi ile Leptospira sp. cinsi bakteriler saptanmıştır. 5-FU içeren EMJH besiyerinde kültürü yapılan bakteriler giemsa yöntemi ile boyanmıştır. Su numunelerinin membran filtrasyon yöntemi ile çalışılarak hazırlanan kültürlerin karanlık alan mikroskopisi ile değerlendirilmesinde 44 su numunesinin sadece 1’ inde (%2,27) Leptospira spp. tespit edilmiştir. Kurbağa böbreğinden alınan doku örneklerinden yapılan kültürlerin karanlık alan mikroskobunda değerlendirilmesi sonucu 100 adet kurbağa böbreğine ait kültürden 7’sinde (%7) Leptospira spp. tespit edilmiştir. Leptospira spp. tespit edilen toplam 8 kültürden hazırlanan preperatlar Giemsa yöntemi ile boyanarak spiroketler ışık mikroskobu ile görüntülenmiştir. Leptospira tespit edilen 8 adet kültürden izole edilen DNA’lar sec Y (preprotein translocase for Leptospira) proteinini kodlayan gen bölgesine ait primerler (GCGATTCAGTTTAATCCTGC ve GAGTTAGAGCTCAAATCTA) kullanılarak Real-Time PCR ile çoğaltılmıştır. Bu çalışma ile ilk kez Edirne ve çevresindeki sularda ve bu sularda yaşayan kurbağalarda non-patojen, saprofit Leptospira cinsi spiroketlerin varlığı gösterilmiştir. In this study, presence of bacteria of the genus Leptospira were investigated in surface water and frog tissue samples collected from Edirne and surroundings. By using the dark field microscopy, Giemsa staining and by inoculating EHJH medium with 5-FU, presence of Leptospira were investigated. Cultivated bacteria were genotyping by using the RT-PCR technique and species-specific probes to determine the pathogenic Leptospira interrogans complex. As a result, when water samples were prepared by the membrane filtration method and evaluated by dark field microscopy, only 1 'of water samples (2,27%) were contained Leptospira spp. Also cultured frog kidney samples were evaluated in the dark field microscope. Seven (7%) of the frog kidney sampels belonging to the frog kidney were found to be positive for Leptospira. Bacterie were stained from positive cultures by using Giemsa method. DNA sampeles isolated from 8 leptospira cultures were amplified by Real-Time PCR using the gene locus primers (GCGATTCAGTTTAATCCTGC and GAGTTAGAGCTCAAATCTA) encoding the sec-Y (preprotein translocase for Leptospira) protein. Pathogen Leptospira interrogans was not found in the study. First time, in this study, non- patogenic, saprophitic Leptospira genus spirochetes were demonstrated in surface waters and frog tissue samples in Edirne and surrounding.

Yeryüzünde tanımlanan ve sistematikteki yeri belirlenen canlıların %80'den fazlasını teşkil eden arthropodlar en önemli vektörlerdir. Medikal ve veteriner öneme sahip arthropodlar; kan emerek, toksisiteye neden olarak konaklarına zarar verebildiği gibi; aynı zamanda bakteriyel, viral, paraziter, spiroketal ve riketsiyal birçok hastalığı insan ve hayvanlara nakletmektedir. Ülkemiz Arthropoda şubesinde yer alan kenelerin yaşamaları için uygun koşullara sahiptir. Bu çalışmada, Edirne İli'ndeki dişi Rhipicephalus sanguineus kene ekstraktlarının biyolojik aktiviteleri ilk kez araştırılmıştır. Çalışmamızda, Edirne İli'ndeki sert keneler örneklenmiş; teşhisleri yapılmış; kene ekstraktları hazırlanmış ve bunların olası mutajenik etkisi Ames testi ile; olası antimikrobiyal etkisi disk difüzyon testi ile; HeLa (insan servikal adenokarsinoma) ve MEF [Mouse embryonic fibroblast (fare embriyonik fibroblast)] hücre hatlarına olası apoptotik etkileri Annexin-V testi ile; HeLa ve MEF hücre hatlarına olası antiproliferatif etkileri MTT testi ile; HeLa ve MEF hücre hatlarının migrasyonuna olası etkileri Boyden Chamber testi ile incelenmiştir. Sonuç olarak, bu çalışmada kene ekstraktlarının hücre hatlarında apoptotik ve antiproliferatif etkisi gözlemlenmiştir. Arthropods are the most important vectors that constitute more than 80% of living species that are identified and taxonomized on Earth. Arthropods which have medical and veterinary importance; may damage their hosts by sucking blood, causing toxicity; and also transmit various bacterial, viral, parasitic, spirochetal and rickettsial diseases to human and animals. Our country has suitable conditions for survival of ticks of the phylum Arthropoda. In this study, we seeked biological activities of extracts of female ticks of Rhipicephalus sanguineus that are found in Edirne Province first time. Our study included the following work flow: sampling and identification of ticks in Edirne Province, preparation of tick extracts, examination of possible mutagenic effects of them by Ames test, examination of possible antimicrobial effects by disc diffusion test; examination of possible apoptotic effects on HeLa (human cervical adenocarcinoma) and MEF (Mouse embryonic fibroblast) cell lines by Annexin-V test, examination of possible antiproliferative effects on HeLa ve MEF cell lines by MTT test and examination of possible effects on migration of HeLa ve MEF cell lines. As a result, apoptotic and antiproliferative effects of tick extracts on tissue cell lines were observed in this study. 98

Kanser normal olmayan hücrelerin kontrolsüz bir biçimde çoğalması ve bazen bu hücrelerin diğer dokulara da yayılmasıdır. Moleküler düzeyde kanser, onkogenlerin aktive olması ve tümör baskılayıcı genlerin inaktive olmasını da içeren birçok basamaktan oluşmaktadır. Kanser tedavisinde kullanılan radyoterapi, ameliyat ve kemoterapi gibi geleneksel yöntemlerin yeterli düzeyde başarılı olamadığı durumlar bulunmaktadır. Tümörlerin tam hedeflenememesi, ilaçların yetersiz doku penetrasyonu, sınırlı terapötik indeks, ilaçlara karşı ortaya çıkan direnç ve mikrometastazların varlığı geleneksel tedavilerin en zayıf noktalarıdır.Kanser tedavisinde kullanılması amaçlanan başarılı bir terapötik ajanın kanser hücrelerini seçici olarak hedeflemesi, kanserli dokuya kendiliğinden yönlenebilmesi, kanser mikroçevresini algılayabilmesi, dış sinyaller tarafından yönlendirilebilmesi ve kolaylıkla dışarıdan saptanabilmesi beklenir. Robot fabrikalar olarak adlandırılan bakterilerin bütün bu beklentileri karşılama potansiyeli bulunmaktadır. Genetik olarak modifiye edilmiş veya edilmemiş bakteriler ve onların metabolitlerinin kanserli hücrelerin çoğalmasını engellemek, kanseri tedavi etmek ya da metastazları önlemek için kullanılmasına bakteriyel kanser tedavisi adı verilmektedir. Kanser tedavisinde artan bir sıklıkla araştırılan bakteriler Salmonella, Escherichia ve Bacillus türleridir.Bu çalışmanın amacı, Escherichia coli OP50, Bacillus thuringiensis, Salmonella enteriditis subsp. enteriditis (ATCC 14028) serovar typhimurium, Salmonella enteriditis, Salmonella telaviv, Serratia entomophila suşlarının, fare embriyonik fibroblast hücre hattı MEF, insan aort beyaz kas hücresi TG HA-VSMEC üzerindeki etkilerini ve rahim kanseri hücre hattı HeLa, prostat kanseri hücre hattı DU145 ve meme kanseri hücre hattı MCF-7 üzerine antikanserojenik etkilerinin araştırılmasıdır. Bu amaçla MEF, TG HA-VSMEC, MCF-7, DU145 ve HeLa hücre kültürleri, Salmonella, E. coli, B. thuringiensis ve S. entomophila suşları ile değişen enfeksiyon çarpanı (bakteri sayısı:hücre sayısı) oranlarında kokültive edilmiş; hücre canlılıkları kolorimetrik MTT sitotoksisite testi ile ölçülmüş; apoptoza giren hücre yüzdeleri görüntü tabanlı sitometre ile değerlendirilmiş ve Kaspaz-3 aktiviteleri kolorimetrik olarak belirlenmiştir. Patojenik S. telaviv (A22) suşunun, patojen olmayan S. enteriditis (A17) ve S. typhimurium ATCC 14028 suşlarına göre apoptozu daha etkili bir biçimde tetiklediği saptanmıştır. Patojenik S. telaviv (A22) suşu tarafından indüklenen apoptoza giren tüm hücre tiplerinin ortalamaları için hücre yüzdesi %15 civarında olurken, patojen olmayan S. enteriditis (A17) ve S. typhimurium ATCC 14028 suşları için %5 civarında kalmıştır. Benzer şekilde, MEF, HeLa veDU145 hücreleri için kaspaz-3 aktivitesini gösteren ortalama OD405 değerleri, patojen olmayan S. enteriditis (A17) ve S. typhimurium ATCC 14028 suşları için 0.01 civarında kalırken, patojenik S. telaviv (A22) suşu için 0.02'ye yaklaşmış ve kontrol grubuna göre tüm hücre türlerin ortalaması iki kat artış göstermiştir. Hücreleri apoptoza sürekleyen en etkili bakteri ortalama bazında %21 ile E. coli OP50 suşu olarak bulunmuştur. Ancak E. coli suşu DU145 ve MEF hücrelerinde yüksek apoptoz etkisi gösterirken HeLa hücrelerinde beklenen etkiyi göstermeyerek kontrol değeri olan %4'ün altında kalmıştır. Ayrıca S. entomophila, DU145 hücrelerinde benzer bir etki yaparak apoptoza giren hücre yüzdesini %23'e yükseltmiştir ve S. entomophila'ya ait SCS (tüketilmiş kültür süpernatanı)'nin DU145, HeLa ve MEF hücre canlılıklarının ortalamasını besiyeri ile yarı yarıya karıştırıldığında %20 civarına kadar düşürdüğü açığa çıkarılmıştır. Çalışmamızın sonuçları, S. telaviv (A22) suşunun DU145, HeLa ve MEF hücrelerinde kaspaz-3 aktivitesini artırdığını, apoptozu tetiklediğini göstermesi ve E. coli (OP50) ile S. entomophila suşlarının DU145 hücreleri üzerinde seçici sitotoksisitesi olduğunun açığa çıkarılması açısından önem taşımaktadır. Bu çalışma ile Salmonella sp., S. entomophila, E. coli (OP50) suşlarının bakteriyel kanser tedavide etkili olma potansiyellerine sahip oldukları görülmektedir.Ayrıca bu çalışmada Amber hastalığı ile biyolojik mücadele amacı ile kullanılan S. entomophila'nın insan kanser hücre hatları üzerinde apoptotik etkiye sahip olduğu ilk kez gösterilmiştir. GDO'lu gıdaların ortaya çıkartılmasında kullanılan Bacillus thuringiensis bakterisinin MEF hücreleri üzerinde sitotoksik ve apoptotik etkisi ilk kez ortaya konmuştur. Cancer is an uncontrolled division of abnormal cells and sometimes these cells can spread into other tissues. At the molecular level, cancer is the combination of many steps involving activation of oncogenes and inactivation of tumor supressor genes. There are cases where conventional techniques such as radiotherapy, surgery and chemotherapy used for the treatment of cancer are failed to succeed. Unable to target tumors selectively, insufficient tissue penetration of drugs, limited therapatic index, emergence of resistance to drugs and micrometastasis are the weakest points of the conventional therapies.Succesful therapeutic drug should have some features possessing selective targeting of cancer cells, self propensity to cancerous tissue, detection of microenvironment, orientability by extrinsic signals and easy noninterventional detection. Bacteria which are called robotic factories have potential to provide all these features. The use of genetically modified or native bacteria and their metabolites with the aim of prevention of cancer propagation, the treatment of cancer and the halting of metastasis is called bacterial cancer therapy. Mostly, enteriditis on the bacterial cancer therapy is focused on Salmonella spp., Escherichia spp. and Bacillus spp..The aim of this study was to investigate the antitumorigenic effects of Escherichia coli OP50, Bacillus thuringiensis, Salmonella typhimurium, Salmonella enteriditis, Salmonella telaviv, Serratia entomophila strains on MEF, TG HA VSMEC, HeLa, MCF-7 and DU145 cell cultures. MEF (mouse embryonic fibroblasts), TG HA- VSMEC (normal aorta smooth muscle), MCF-7(human breast cancer) DU145 (human prostate cancer cells), and HeLa (human cervical cancer cells) cell lines were cocultivated with Salmonella, E. coli, B. thuringiensis ve S. entomophila strains ofvarying multiplicity of infection (number of bacteria:number of cell) ratios. The cell viability was measured by MTT cytotoxicity assay, the percentage of apoptosis was assessed by image based cytometry and the caspase-3 activity was determined by colorimetric assay. It was shown that pathogenic S. telaviv (A22) strain induces apoptosis more effectively than non-pathogenic S. enteriditis (A17) and S. typhimurium ATCC 14028 strains. The percentage of apoptosis induced by pathogenic S. telaviv (A22) strain was approximately 15% while 5% for both non-pathogenic S. enteriditis (A17) and S. typhimurium ATCC 14028 strains. Similarly, average OD405 values of caspase-3 activity was shown as 0.01 for both non-pathogenic S. enteriditis (A17) and S. typhimurium ATCC 14028 strains whereas average OD405 value of caspase-3 activity for pathogenic S. telaviv (A22) strain was very close to 0.02 and it doubled the value of negative control. Our findings are important in terms of the demonstration of food-borne pathogenic S. telaviv (A22) strain which enhanced caspase-3 activity and induced apoptosis, and non-pathogenic S. enteriditis (A17) strain that showed selective cytotoxicity on DU145. The most effective bacteria strain that triggers cell apoptosis was found to be non-pathogenic E. coli OP50 with the average of 21%. However, E. coli strain showed higher apoptosis inducer effect on DU145 and MEF cells, it did not possess same effect on HeLa cells by having values enteriditis the control values of 4% . In addition, S. entomophila had the same apoptosis inducer effect on DU145 cells by increasing apoptosis to 23% and S. entomophila SCS diluted with cell culture medium in 1:1 mix decreased the cell viability of DU145 cells up to 20%. Results of the study have the importance of illuminating that pathogenic S. Telaviv (A22) strain increases Caspase-3 activity and induces apoptosis, in addition E. coli (OP50) and S. entomophila strains have selective cytotoxicity on DU145 cells. By the study, it is obvious that Salmonella sp., S. entomophila, E. coli (OP50) strains are potential candidates for effective cancer therapy.In addition, the apoptotic effect of S. entomophila that is used as biopesticide against Amber disease is demonstrated on human cancer cell lines for the first time. It is also firstly shown that Bacillus thuringiensis bacteria used for the generation of GMO containing foods have cytotoxic and apoptotic effect on MEF cell lines. 119

daha sonra doldurulacaktır daha sonra doldurulacaktır 0

Bu çalışma, Edirne ilindeki tavuk karkaslarından izole edilmiş olan Salmonella izolatlarının patojenite fenotiplerinin saptanması ve patogenez determinantlarının belirlenmesi amacı ile yapılmıştır. Toplam 32 izolat bu çalışmaya dahil edilmiştir ve izolatlardan 26'sı Infantis, 4'ü Enteritidis, 1'er tanesi de Telaviv ve Kentucky serotiplerine dahildir. İzolatların tamamında kullandığımız antibiyotiklerden en az bir tanesine karşı direnç ve 26 tanesinde çoklu ilaç dirençliliği gözlemlenmiştir. Plazmid analizi sonuçlarına göre 6 izolatın, büyüklükleri 1.2-42.4 kb arasında değişen 1-3 plazmid taşıdığı saptanmıştır. Infantis serotipinden 6 ve Enteritidis serotipinden 4 tane olmak üzere toplam 10 izolatın Caenorhabditis elegans için patojen olmadığı, Infantis, Kentucky ve Telaviv serotiplerine ait izolatları içeren diğer 22 izolatın ise patojen olduğu belirlenmiştir (p

Yüksek Lisans Tezi İnsanın yaşamında gerekli olan su, çevresel ve antropojenik kaynaklı kimyasal, fiziksel ve mikrobiyal kirlilik riski taşımaktadır. Bu tez çalışmasının amacı Edirne İli kent merkezi ve yakınlarındaki bazı süs havuzları, nehirler, dere ve Ergene Nehri kıyısında bulunan bir çeltik tarlası olmak üzere toplam on istasyondan su örneği alarak mikrobiyal kirlilik indikatörü bakteriler ve bazı yeni/yeniden ortaya çıkan, son yıllarda önem kazanan patojenlerin varlığının ve kantitatif incelemelerinin, konvansiyonel seçici/ayırt edici besiyerlerine ekim yapılarak ve moleküler yöntemlerle araştırılmasıdır. Membran filtrasyonu ve 220C ve 36 0C’de inkübasyon yöntemiyle toplam koloni sayısı, koliformlar, Escherichia coli, fekal enterokoklar, sülfit indirgeyen anaerop Clostridium’lar ve Aeromonas cinsi bakterilerin izolasyonu ve sayımı yapıldı. Gerçek zamanlı polimeraz zincir reaksiyonu (real time PCR) (Q-PCR) yöntemiyle Escherichia coli’nin beş patojenik tipi (EHEC, ETEC, EPEC, EIEC ve EAEC), Enterococcus faecalis, Clostridium perfringens, Legionella pneumophila ve Leptospira interrogans bakterilerinin varlığı araştırıldı. Sonuçlara göre, nehirler, dere ve çeltik tarlasındaki mikrobiyal kirlilik düzeylerinin süs havuzlarına göre daha yüksek olduğu görüldü. Q-PCR yöntemiyle Leptospira interrogans ve Escherichia coli’nin patojenik tiplerinden EIEC incelediğimiz su örneklerinde tespit edilmedi, ancak, bazı numunelerde bu bakterinin diğer patojenik tipleri ve ayrıca E.faecalis, C.perfringens, L.pneumophila patojenleri saptandı. Çalışma, klasik kirlilik indikatörü olan koliform bakteriler kadar C.perfringens bakterisinin de su numunelerinde fekal kirliliği etkin olarak gösterdiğini ve patojen bakterilerin varlığıyla fekal kirlilik indikatörü bakterilerin konvansiyonel ve moleküler yöntemlerle saptanması arasında pozitif korelasyon bulunduğunu kanıtlamıştır. Anahtar Kelimeler : Edirne, çevresel sular, indikatör, patojen, bakteri, moleküler yöntemler, konvansiyonel yöntemler Abstract Water which is essential for human life carries the risk of chemical, physical and microbial pollution coming from environmental and anthropogenic sources. The aim of this dissertation is investigating the presence and quantification of microbial pollution indicator bacteria and some newly emerging or re-emerging pathogens which are recently gaining importance by inoculating into conventional selective/differential media and by using molecular methods for the water samples collected from a total of 10 stations including decorational fountains, rivers, a creek and a rice field located near the Ergene river in Edirne and surroundings. Investigation of the total colony counts of coliform bacteria, E.coli fecal enterococci, sulfate reducing anaerobic Clostridia and bacteria of the Aeromonas sp. were done by using membrane filtration and incubation at 220C ve 36 0C. Presence of five pathogenic types of E.coli (EHEC, ETEC, EPEC, EIEC and EAEC), Enterococcus faecalis, Clostridium perfringens, Legionella pneumophila and Leptospira interrogans bacteria were investigated by using real time PCR (RTPCR) (Q-PCR) methods. According to the results, the microbial pollution levels in rivers , creek and rice field were higher than the levels of the decorational fountains. Leptospira interrogans and EIEC, one of the pathogenic types of Escherichia coli was not detected in any of the water samples that we tested by the RT-PCR method, however, other pathogenic types of this bacterium and also E.faecalis, C.perfringens, L.pneumophila pathogens were found in some of these samples. This study has been proven that the detection of C.perfringens in water samples demonstrated the presence of fecal pollution as efficient as the detection of coliform bacteria which are the classical fecal pollution indicators and a positive correlation exists between the presence of pathogens and fecal pollution levels detected by using classical and molecular methods.

Bu çalışmada, Mart 2012- Haziran 2012 tarihleri arasında, Tunca, Meriç, Arda ve Ergene Nehirleri'ndeki belirlenen istasyonlardan alınan su ve sediment örnekleri, musluk suyu örnekleri ve 22 °C (oda sıcaklığı), 4 °C (buzdolabı) ve 50 °C'de (güneşte veya arabada tutulan su örnekleri olarak) bekletilen pet (polietilen tereftalat) şişe su örneklerine, Salmonella typhimurium TA100 suşu bakterileri kullanılarak, Ames mutajenite testinin Spot test ve Standart plak inkorporasyon testi versiyonları uygulanmıştır. Çalışmada, musluk suyu örnekleri, Trakya Üniversitesi kampüsünden alınmış; pet şişe su örneklerinin incelenmesi için, on üç farklı marka pet şişe suyu kullanılmıştır. Deneylerde, Salmonella typhimurium TA100 suşu ile metabolik aktivasyon (S9) yokluğunda, her test maddesi ve test maddelerinin yapılan her seyreltmesi, 3 paralel plak kullanılarak test edilmiştir. Sonuçların değerlendirilebilmesi için, test maddeleriyle yapılan deneylere paralel olarak, spontan kontrol, negatif (solvent) ve pozitif (diagnostik) kontroller yapılmıştır. Pozitif kontrol olarak, TA100 suşu için metabolik aktivasyon (S9) yokluğunda sodyum azid kullanılmıştır. Test sonuçlarına göre, Tunca, Meriç, Arda ve Ergene Nehir sedimentleri örneklerinde, Ergene Nehri ve Ergene Nehri'nin suladığı çeltik tarlasından alınan su örneklerinde mutajenite gözlemlenmiştir. Yapılan testlerde, Arda Nehri sediment örnekleri 10-1, Meriç Nehri sediment örnekleri 10-2, Tunca Nehri sediment örnekleri 10-3, Ergene Nehri sediment örnekleri 10-3 seyreltmede en düşük oranda mutajenite göstermiştir. Benzer şekilde, Ergene Nehri suyu ve çeltik tarlasından alınan su örnekleri seyreltme olmadan mutajenite göstermiş; bu su örneklerinin 10-1 seyreltmelerinde mutajenik olmadığı görülmüştür. Mutajenitesi hem Spot test hem de Standart plak inkorporasyon testleriyle saptanan nehir su ve sediment örneklerinin mutajenik olmayan ilk seyreltmeleri tespit edilmiş; elde edilen standart plak inkorporasyon testi sonuçları kullanılarak, bu seyreltme değerlerine Independent Samples Testi ile istatistiksel analiz uygulanmış ve test sonuçlarıyla tutarlı veriler elde edilmiştir. Bu sonuçlara göre, Meriç, Ergene, Tunca, Arda Nehri sediment örnekleri, Ergene Nehri su örnekleri ve Ergene Nehri'nin suladığı çeltik tarlasından alınan su örnekleri mutajenik madde ya da maddeler içermektedir. Tunca, Meriç ve Arda Nehirleri'nden alınan su örnekleri, musluk suyu ve pet (polietilen tereftalat) şişe su örneklerinde mutajenite gözlemlenmemiştir.Temmuz 2012, 120 sayfaAnahtar kelimeler: Edirne, Ames testi, mutajenite, Salmonella typhimurium, sediment, nehir suyu, musluk suyu, pet şişe suyu In this study, between March 2012-June 2012, Spot test and Standard plate incorporation test versions of the Ames test were applied by using Salmonella typhimurium TA100 strain bacteria to the water and sediment samples collected from stations of Tunca, Meriç, Arda and Ergene Rivers, tap water samples and Pet (polyethylene tereftalate) bottled water samples which were kept at 22 °C (room temperature), 4 °C (refregirator) and 50 °C (as water samples kept under sun or in the car). Tap water samples were taken from the campus of Trakya University; and 13 different brands of pet bottled water were used in this study. In the experiments, in the absence of metabolic activation (S9), all test materials and all dilutions of them were tested in triplicates with Salmonella typhimurium TA100 strain. In order to evaluate the results, parallel to the test materials, spontaneous control, negative (solvent) and positive (diagnostic) controls were performed. As the positive control, in the absence of metabolic activation (S9), sodium azide was used for TA100 strain. According to the test results, mutagenicity was observed in Tunca, Meriç, Arda and Ergene River sediment samples and rice plantation samples irrigated by Ergene River water. Sediment samples demonstrated the lowest rate of mutagenicity at the dilutions of 10-1 for Arda River sediment, 10-2 for Meriç River sediment, 10-3 for Tunca River sediment and 10-3 for Ergene River sediment. Similarly, Ergene River water and water samples collected from rice plantations demonstrated mutagenicity without dilution; there was no mutagenicity in these water samples at 10-1 dilution. First dilutions of non-mutagenic concentrations were determined for river water and sediment samples in which their mutagenicity were determined by Spot test and Standard plate incorporation tests, statistical analyses were applied to these dilution values according to the Standard plate incorporation test with Independent Samples Test and reliable data were obtained. According to these results, Meriç, Ergene, Tunca, Arda River sediment samples, Ergene River water samples and water samples from rice plantations contain mutagenic materials. Water samples collected from stations of Tunca, Meriç, Arda Rivers, tap water and pet (poliethylene tereftalate) bottle samples did not have any mutagenicity.July 2012, 120 pagesKey words: Edirne, Ames test, mutagenicity, Salmonella typhimurium, sediment, river water, tap water, pet bottled water 134