Search

Two crosses of faba bean (Giza716xGiza40) and (Giza716xNubaria2), each represented by six population (P1, P2, F1, F2, BC1 and BC2) were tested for yield, yield components, growth attributes and two diseases (chocolate spot and rust). Heterosis in F1, which exhibited highly significant positive effects were detected for number of branches /plant, number of pod /plant, number of seed /plant, seed yield /plant and plant height in the two crosses over mid and better parents. Significant negative Heterosis effects were obtained for chocolate spot and rust diseases in the two crosses over mid parents. Highly significant positive values of inbreeding depression were detected for number of branches/ plant, number of pods/plant, number of seed /plant, seed yield /plant, 100-seed weight and plant height in both crosses. However, highly significant negative values of inbreeding depression were found for chocolate spot and rust diseases in the two crosses. Over dominance towards the higher parent were detected for number of branches/plant, number of pods/plant, number of seeds/plant, seed yield /plant and plant height in both crosses. It was also found that over dominance controls spot and rust diseases in the second cross. Additive gene effects were significant for all characters, excepted number of seed/plant and seed yield/plant in both crosses. Dominance effects were highly significant for all traits, excepted, seed yield/plant and plant height in both crosses and rust disease in second cross. Additive x additive, additive x dominance and dominance x dominance types of gene action were significant for most traits in both crosses, except, chocolate spot and rust disease. In both crosses, high heritability values in broad sense were detected for all traits which, ranged between 63.20 for rust disease and 85.32 % for reaction to chocolate spot and for cross (Giza 716 X Giza 40). However, cross (Giza 716 X Nubaria2) had values ranged from 60.7% for reaction to rust to 70.93% for seed yield/plant in (Giza 716 x Nubaria2). The values of heritability in narrow sense were detected for all traits which, ranged between 60.19 to 80.36% for resistance to rust and chocolate spot disease in first cross, respectively and between 59.36 and 68.42% for number of pods/plant and seed yield / plant in the cross (G.716 x Nubaria.2).The estimates of expected genetic advance from selection in F2 generation reflected low or moderate values for all studied traits in both crosses that ranged between 7.78 cm for plant height to 1.8 for rust disease in cross (Giza 716 X Giza 40) and between 8.13 cm for plant height to 1.84 for number of branches/plant in (Giza 716 X Nubaria2) cross. [ABSTRACT FROM AUTHOR]

Abstract Background Sugarcane smut, which is caused by Sporisorium scitamineum , is a severe fungal disease affecting sugarcane. However, the major pathways involved in the interaction between sugarcane and S. scitamineum remains unclear. Results In the present study, suppression subtractive hybridization (SSH) library construction, together with reverse northern blotting, was conducted on the most prevalent sugarcane genotype ROC22 challenged with S. scitamineum. After alignment and homologous expressed sequence tag (EST) assembly, a total of 155 differentially expressed unigenes were identified from SSH libraries. Totally, 26 of 155 differentially expressed unigenes were analyzed by qRT-PCR in sugarcane smut-resistant genotype YC05-179 and susceptible genotype ROC22. Genes encoded two unknown protein (Q1 and Q11), serine/threonine kinase (Q2), fiber protein (Q3), eukaryotic translation initiation factor 5A (Q23), and Sc14-3-3-like protein (Q24) were induced in sugarcane smut-resistant genotype YC05-179 but inhibited in susceptible genotype ROC22. Based on the differential expression data achieved from SSH libraries and qRT-PCR, we found that, serine/threonine kinases, Ca2+ sensors, mitogen-activated protein genes and some NBS-LRR genes may involve in the signal recognition and transduction of smut fungus infection in sugarcane. While in the plant hormone signaling pathways, the genes related to auxin, abscisic acid, salicylic acid and ethylene were more apparently in response to smut fungus invasion. The hypersensitive response, protein metabolism, polyamine synthesis, and cell wall formation may play an important role in sugarcane defense against smut fungus colonization. Additionally, the Sc14-3-3 might serve as a molecular modulator in sugarcane being immune to smut disease by interacting with proteins like ScGAPN (Q10), which have been further verified by BiFC assay. Conclusions The findings of the present study could provide a general view about gene pathways involving in sugarcane defense against smut disease and facilitate a better understanding of the molecular mechanism underlying sugarcane- S. scitamineum interaction. Highlights • Major pathways in response to S. scitamineum challenge of sugarcane were identified in this study. • The 26 differentially expressed unigenes were analyzed both in sugarcane smut-resistant and susceptible genotype. • There is an interaction between Sc14-3-3 and ScGAPN by Pearson correlation analysis and BiFC assay respectively. • The study extends the understanding of sugarcane in response to S. scitamineum infection [ABSTRACT FROM AUTHOR]

Summary: Plant NLR genes encode sensitive immune receptors that can mediate the specific recognition of pathogen avirulence effectors and activate a strong defence response, termed effector‐triggered immunity. The expression of NLRs requires strict regulation, as their ability to trigger immunity is dependent on their dose, and overexpression of NLRs results in autoimmunity and massive fitness costs. An elaborate interplay of different mechanisms controlling NLR transcript levels allows plants to maximize their defence capacity, whilst limiting negative impact on their fitness. Global suppression of NLR transcripts may be a prerequisite for the fast evolution of new NLR variants and the expansion of this gene family. Here, we summarize recent progress made towards a comprehensive understanding of NLR transcript‐level expression control. Multiple mechanistic steps, including transcription as well as co‐/post‐transcriptional processing and transcript turn‐over, contribute to balanced base levels of NLR transcripts and allow for dynamic adjustments to defence situations. [ABSTRACT FROM AUTHOR]

Summary: Expansin proteins, which loosen plant cell walls, play critical roles in normal plant growth and development. The horizontal acquisition of functional plant‐like expansin genes in numerous xylem‐colonizing phytopathogenic bacteria suggests that bacterial expansins may also contribute to virulence. To investigate the role of bacterial expansins in plant diseases, we mutated the non‐chimeric expansin genes (CmEXLX2 and RsEXLX) of two xylem‐inhabiting bacterial pathogens, the Actinobacterium Clavibacter michiganensis ssp. michiganensis (Cmm) and the β‐proteobacterium Ralstonia solanacearum (Rs), respectively. The CmmΔCmEXLX2 mutant caused increased symptom development on tomato, which was characterized by more rapid wilting, greater vascular necrosis and abundant atypical lesions on distant petioles. This increased disease severity correlated with larger in planta populations of the ΔCmEXLX2 mutant, even though the strains grew as well as the wild‐type in vitro. Similarly, when inoculated onto tomato fruit, ΔCmEXLX2 caused significantly larger lesions with larger necrotic centres. In contrast, the RsΔRsEXLX mutant showed reduced virulence on tomato following root inoculation, but not following direct petiole inoculation, suggesting that the RsEXLX expansin contributes to early virulence at the root infection stage. Consistent with this finding, ΔRsEXLX attached to tomato seedling roots better than the wild‐type Rs, which may prevent mutants from invading the plant's vasculature. These contrasting results demonstrate the diverse roles of non‐chimeric bacterial expansins and highlight their importance in plant–bacterial interactions. [ABSTRACT FROM AUTHOR]

Summary: The effector protein AvrP is secreted by the flax rust fungal pathogen (Melampsora lini) and recognized specifically by the flax (Linum usitatissimum) P disease resistance protein, leading to effector‐triggered immunity. To investigate the biological function of this effector and the mechanisms of specific recognition by the P resistance protein, we determined the crystal structure of AvrP. The structure reveals an elongated zinc‐finger‐like structure with a novel interleaved zinc‐binding topology. The residues responsible for zinc binding are conserved in AvrP effector variants and mutations of these motifs result in a loss of P‐mediated recognition. The first zinc‐coordinating region of the structure displays a positively charged surface and shows some limited similarities to nucleic acid‐binding and chromatin‐associated proteins. We show that the majority of the AvrP protein accumulates in the plant nucleus when transiently expressed in Nicotiana benthamiana cells, suggesting a nuclear pathogenic function. Polymorphic residues in AvrP and its allelic variants map to the protein surface and could be associated with differences in recognition specificity. Several point mutations of residues on the non‐conserved surface patch result in a loss of recognition by P, suggesting that these residues are required for recognition. [ABSTRACT FROM AUTHOR]

Specific scope: This Standard describes a diagnostic protocol for Ralstonia solanacearum, Ralstonia pseudosolanacearum and Ralstonia syzygii, i.e. phylotype/sequevar strain in the Ralstonia solanacearum Species Complex (RSSC). It should be used in conjunction with PM 7/76 Use of EPPO diagnostic protocols. Specific approval and amendment: Approved in 2003‐09. First revised in 2018‐02. [ABSTRACT FROM AUTHOR]

Strains of Phakopsora pachyrhizi with a lower SDHI sensitivity have been found for the first time in monitoring studies in the season 2015-2016. Such strains needed to be characterized with respect to the underlying mechanism and for the development of a molecular genetic monitoring method. A mutation in the SdhCgene, which causes the amino acid substitution C-I86F, was identified in strains with a lower SDHI sensitivity. A species-specific real-time PCR for the detection and quantification of alleles which cause C-I86F exchange in diseased plant tissue was developed. The frequency of C-I86F was highest when samples were first selected on SDHI-treated detached leaves, and there was * 50% mutated allele. The SDHIs included in this study were affected to a greater or lesser extent by C-I86F in detached leaf assays. This is the first report of a causal resistance mechanism toward SDHIs in P. pachyrhizi. The practical relevance of the C-I86F exchange on the field efficacy of SDHI containing fungicides needs further investigation. [ABSTRACT FROM AUTHOR]

Background: Clubroot is an important disease caused by the obligate parasite Plasmodiophora brassicae that infects the Brassicaceae. As a soil-borne pathogen, P. brassicae induces the generation of abnormal tissue in the root, resulting in the formation of galls. Root infection negatively affects the uptake of water and nutrients in host plants, severely reducing their growth and productivity. Many studies have emphasized the molecular and physiological effects of the clubroot disease on root tissues. The aim of the present study is to better understand the effect of P. brassicae on the transcriptome of both shoot and root tissues of Arabidopsis thaliana. Results: Transcriptome profiling using RNA-seq was performed on both shoot and root tissues at 17, 20 and 24 days post inoculation (dpi) of A. thaliana, a model plant host for P. brassicae. The number of differentially expressed genes (DEGs) between infected and uninfected samples was larger in shoot than in root. In both shoot and root, more genes were differentially regulated at 24 dpi than the two earlier time points. Genes that were highly regulated in response to infection in both shoot and root primarily were involved in the metabolism of cell wall compounds, lipids, and shikimate pathway metabolites. Among hormone-related pathways, several jasmonic acid biosynthesis genes were upregulated in both shoot and root tissue. Genes encoding enzymes involved in cell wall modification, biosynthesis of sucrose and starch, and several classes of transcription factors were generally differently regulated in shoot and root. Conclusions: These results highlight the similarities and differences in the transcriptomic response of above- and belowground tissues of the model host Arabidopsis following P. brassicae infection. The main transcriptomic changes in root metabolism during clubroot disease progression were identified. An overview of DEGs in the shoot underlined the physiological changes in above-ground tissues following pathogen establishment and disease progression. This study provides insights into host tissue-specific molecular responses to clubroot development and may have applications in the development of clubroot markers for more effective breeding strategies. [ABSTRACT FROM AUTHOR]

This study identified the genetic transmission pattern of the leaf blight resistance of Lilium species based on resistance distribution. A total of 133 hybrids of the ‘Sorbonne’ (female parent, highly resistant to Botrytis elliptica ) and ‘Francia’ (male parent, highly susceptible to B. elliptica ) cultivars were selected by inter-simple sequence repeat polymerase chain reaction. Among them, 17 were highly resistant, 42 moderately resistant, 46 moderately susceptible, and 28 susceptible. One F1 plant showed greater resistance than 'Sorbonne', and 17 showed greater susceptibility than 'Francia'. Disease resistance from 'Sorbonne' could be inherited and was a typical quantitative trait determined by polygenes. [ABSTRACT FROM AUTHOR]

Plant disease is a major challenge to agriculture worldwide, and it is exacerbated by abiotic environmental factors. During some plant-pathogen interactions, heat stress allows pathogens to overcome host resistance, a phenomenon which could severely impact crop productivity considering the global warming trends associated with climate change. Despite the importance of this phenomenon, little is known about the underlying molecular mechanisms. To better understand host plant responses during simultaneous heat and pathogen stress, we conducted a transcriptomics experiment for rice plants (cultivar IRBB61) containing Xa7, a bacterial blight disease resistance (R) gene, that were infected with Xanthomonas oryzae, the bacterial blight pathogen of rice, during high temperature stress. Xa7-mediated resistance is unusual relative to resistance mediated by other R genes in that it functions better at high temperatures. Using RNA-Seq technology, we identified 8,499 differentially expressed genes as temperature responsive in rice cultivar IRBB61 experiencing susceptible and resistant interactions across three time points. Notably, genes in the plant hormone abscisic acid biosynthesis and response pathways were up-regulated by high temperature in both mock-treated plants and plants experiencing a susceptible interaction and were suppressed by high temperature in plants exhibiting Xa7-mediated resistance. Genes responsive to salicylic acid, an important plant hormone for disease resistance, were down-regulated by high temperature during both the susceptible and resistant interactions, suggesting that enhanced Xa7-mediated resistance at high temperature is not dependent on salicylic acid signaling. A DNA sequence motif similar to known abscisic acid-responsive cis-regulatory elements was identified in the promoter region upstream of genes up-regulated in susceptible but down-regulated in resistant interactions. The results of our study suggest that the plant hormone abscisic acid is an important node for cross-talk between plant transcriptional response pathways to high temperature stress and pathogen attack. Genes in this pathway represent an important focus for future study to determine how plants evolved to deal with simultaneous abiotic and biotic stresses. [ABSTRACT FROM AUTHOR]

A novel virus was detected in grapevines by Illumina sequencing during the screening of two table grape (Vitis vinifera) accessions, cultivars Black Beet and Nagano Purple, from South Korea. The monopartite circular ssDNA genome sequence was subsequently confirmed by rolling cycle amplification, cloning and Sanger sequencing. The complete viral genomic sequence from both accessions ranged from 2,903 to 2,907 nucleotides in length and contained the conserved nonanucleotide sequence TAATATT↓AC and other sequence features typical of the family Geminiviridae, including two predicted sense and four complementary-sense open reading frames. Phylogenetic analysis placed the novel virus in a unique taxon within the family Geminiviridae. A naturally occurring defective subviral DNA was also discovered. This defective DNA molecule carried a deletion of approximately 46% of the full-length genome. Both the genomic and defective DNA molecules were graft-transmissible although no disease is yet correlated with their occurrence in Vitis spp. The tentative names Grapevine geminivirus A (GGVA) and GGVA defective DNA (GGVA D-DNA) are proposed. PCR assays developed using primers designed in the coat protein gene led to the detection of GGVA in 1.74% of 1,262 vines derived from 15 grapevine cultivars from six countries across three continents. [ABSTRACT FROM AUTHOR]

The cultivation of melon (Cucumis melo L.) in greenhouses has contributed to the increased incidence of fungal diseases, particularly gummy stem blight caused by Didymella bryoniae (Fuckel) Rehm. This disease is currently considered the main disease affecting this crop, causing conditions such as water soaked seedlings, and stem and fruit cankers, reducing productivity and fruit quality. Considering the importance of this disease, the aim of this study was to evaluate the reaction of different C. melo genotypes to D. bryoniae. Sixty-eight different melon genotypes were investigated. Two phenotyping assays were performed to investigate the resistance to the disease, following a randomized block design with four replicates. Subsequently, a new assay was conducted to validate the resistance of the genotypes selected in the previous step, using a randomized block design with three replicates. The plants were inoculated using the toothpick method and resistance was evaluated according to a grading scale. Also, reaction classes and assay groups were used for classifying the resistance level of the genotype. The JAB-11 and JAB-20 strains were susceptible to the pathogen, as well as the commercial hybrids Louis F1 and Fantasy F1. The hits AC-29, C160, Charentais Fom 1, PI 420145, PI 482398 and PI 532830 were resistant to D. bryoniae and could become an important gene source for the development of resistant cultivars. [ABSTRACT FROM AUTHOR]

Basal stalk rot (BSR), caused by Sclerotinia sclerotiorum, is a devastating disease in sunflower worldwide. The progress of breeding for Sclerotinia BSR resistance has been hampered due to the lack of effective sources of resistance for cultivated sunflower . Our objective was to transfer BSR resistance from wild annual Helianthus species into cultivated sunflower and identify the introgressed alien segments associated with BSR resistance using a genotyping-by-sequencing (GBS) approach. The initial crosses were made between the nuclear male sterile HA 89 with the BSR resistant plants selected from wild Helianthus argophyllus and H. petiolaris populations in 2009. The selected resistant F1 plants were backcrossed to HA 458 and HA 89, respectively. Early generation evaluations of BSR resistance were conducted in the greenhouse, while the BC2 F3 and subsequent generations were evaluated in the inoculated field nurseries. Eight introgression lines; six from H. argophyllus (H.arg 1 to H.arg 6), and two from H. petiolaris (H.pet 1 and H.pet 2), were selected. These lines consistently showed high levels of BSR resistance across seven environments from 2012 to 2015 in North Dakota and Minnesota, USA. The mean BSR disease incidence (DI) for H.arg 1 to H.arg 6, H.pet 1, and H.pet 2 was 3.0, 3.2, 0.8, 7.2, 7.7, 1.9, 2.5, and 4.4%, compared to a mean DI of 36.1% for Cargill 270 (susceptible hybrid), 31.0% for HA 89 (recurrent parent), 19.5% for HA 441 (resistant inbred), and 11.6% for Croplan 305 (resistant hybrid). Genotyping of the highly BSR resistant introgression lines using GBS revealed the presence of the H. argophyllus segments in linkage groups (LGs) 3, 8, 9, 10, and 11 of the sunflower genome, and the H. petiolaris segments only in LG8. The shared polymorphic SNP loci in the introgression lines were detected in LGs 8, 9, 10, and 11, indicating the common introgression regions potentially associated with BSR resistance. Additionally, a downy mildew resistance gene, Pl17, derived from one of the parents, HA 458, was integrated into five introgression lines. Germplasms combining resistance to Sclerotinia BSR and downy mildew represent a valuable genetic source for sunflower breeding to combat these two destructive diseases. [ABSTRACT FROM AUTHOR]

Phytophthora infestans, a pathogenic oomycete that is the causal agent of potato and tomato late blight, has devastating effects worldwide. The genetic composition of P. infestans populations in Canada has changed considerably over the last few years, with the appearance of several new genotypes showing different mating types and sensitivity to the fungicide metalaxyl. Genetic markers allowing for a rapid assessment of genotypes from small amounts of biological material would be beneficial for the early detection and control of this pathogen throughout Canada. Mining of the P. infestans genome revealed several regions containing single-nucleotide polymorphisms (SNP) within both nuclear genes and flanking sequences of microsatellite loci. Allele-specific oligonucleotide polymerase chain reaction (ASO-PCR) assays were developed from 14 of the 50 SNP found by sequencing. Nine optimized ASO-PCR assays were validated using a blind test comprising P. infestans and other Phytophthora spp. The assays revealed diagnostic profiles unique to each of the five dominant genotypes present in Canada. The markers developed in this study can be used with environmental samples such as infected leaves, and will contribute to the genomic toolbox available to assess the genetic diversity of P. infestans at the intraspecific level. For late blight management, early warning about P. infestans genotypes present in potato and tomato fields will help growers select the most appropriate fungicides and application strategies. [ABSTRACT FROM AUTHOR]

Meloidogyne haplanaria is a species originally found infesting peanut in Texas and, more recently, in Arkansas. In this study, we confirmed the presence of M. haplanaria in Florida based on morphological and molecular characterization. This species was identified from a sample submitted for diagnosis collected from Mi-resistant tomato rootstock grown in Naples, FL. The major diagnostic criteria to distinguish M. haplanaria from other closely related root-knot nematode (RKN) species are based on morphological differences and host range tests, which are time consuming and labor intensive and require living or well-preserved specimens. In our study, we provide an easy diagnostic strategy to distinguish M. haplanaria from other RKN species based on amplification of two mitochondrial DNA regions. These regions span the intergenic spacer and part of the adjacent large subunit ribosomal RNA gene (lrDNA) and sequence polymorphisms in lrDNA revealed by the restriction pattern following digestion with the restriction enzymes Hinfl and Mnll. A unique haplotype pattern, which has not been observed in any of the RKN species described thus far, was observed in M. haplanaria. The outcome of molecular analysis of M. haplanaria aligned with morphological measurement and characteristics as well as perineal pattern originally described for M. haplanaria. [ABSTRACT FROM AUTHOR]

Trunk diseases have become among the most important grapevine diseases worldwide. They are caused by fungal pathogens that attack the permanent woody structure of the vines and cause various symptoms in woody and annual organs. This study examined modifications of plant responses in green stem, cordon, and trunk of grapevines expressing Esca proper (E) or apoplexy (A) event, which are the most frequent grapevine trunk disease symptoms observed in Europe. Transcript expression of a set of plant defense- and stress-related genes was monitored by quantitative reverse-transcription polymerase chain reaction while plant phytoalexins and fungal metabolites were quantified by high-performance liquid chromatographymass spectrometry in order to characterize the interaction between the grapevine and trunk disease agents. Expression of genes encoding enzymes of the phenylpropanoid pathway and trans-resveratrol content were altered in the three organs of diseased plants, especially in the young tissues of A plants. Pathogenesis-related proteins and the antioxidant system were severely modulated in A plants, which indicates a drastic stress effect. In the meantime, fungal polyketides 6-MSA, (R)-mellein, and (3R,4R)-4-hydroxymellein, were accumulated in A plants, which suggests their potential effect on plant metabolism during the appearance of foliar symptoms. [ABSTRACT FROM AUTHOR]

Septoria nodorum blotch (SNB), caused by Parastagonospora nodorum, is a severe foliar and glume disease on durum and common wheat. Pathogen-produced necrotrophic effectors (NEs) are the major determinants for SNB on leaves. One such NE is SnTox3, which evokes programmed cell death and leads to disease when recognized by the wheat Snn3- B1 gene. Here, we developed saturated genetic linkage maps of the Snn3- B1 region using two F populations derived from the SnTox3-sensitive line Sumai 3 crossed with different SnTox3-insensitive lines. Markers were identified and/or developed from various resources including previously mapped simple sequence repeats, bin-mapped expressed sequence tags, single nucleotide polymorphisms, and whole genome survey sequences. Subsequent high-resolution mapping of the Snn3- B1 locus in 5600 gametes delineated the gene to a 1.5 cM interval. Analysis of micro-colinearity of the Snn3- B1 region indicated that it was highly disrupted compared to rice and Brachypodium distachyon. The screening of a collection of durum and common wheat cultivars with tightly linked markers indicated they are not diagnostic for the presence of Snn3- B1, but can be useful for marker-assisted selection if the SnTox3 reactions of lines are first determined. Finally, we developed an ethyl methanesulfonate-induced mutant population of Sumai 3 where the screening of 408 M families led to the identification of 17 SnTox3-insensitive mutants. These mutants along with the markers and high-resolution map developed in this research provide a strong foundation for the map-based cloning of Snn3- B1, which will broaden our understanding of the wheat- P. nodorum system and plant-necrotrophic pathogen interactions in general. [ABSTRACT FROM AUTHOR]

Plant disease resistance ( R ) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence ( Avr ) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9 , a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9 , was demonstrated. Expression of the Cf-9 gene was 10.8–54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. [ABSTRACT FROM AUTHOR]

Background: The identification of factors involved in the host range definition and evolution is a pivotal challenge in the goal to predict and prevent the emergence of plant bacterial disease. To trace the evolution and find molecular differences between three pathotypes of Xanthomonas citri pv. citri that may explain their distinctive host ranges, 42 strains of X. citri pv. citri and one outgroup strain, Xanthomonas citri pv. bilvae were sequenced and compared. Results: The strains from each pathotype form monophyletic clades, with a short branch shared by the Aw and A pathotypes. Pathotype-specific recombination was detected in seven regions of the alignment. Using Ancestral Character Estimation, 426 SNPs were mapped to the four branches at the base of the A, A*, Aw and A/Aw clades. Several genes containing pathotype-specific nonsynonymous mutations have functions related to pathogenicity. The A pathotype is enriched for SNP-containing genes involved in defense mechanisms, while A* is significantly depleted for genes that are involved in transcription. The pathotypes differ by four gene islands that largely coincide with regions of recombination and include genes with a role in virulence. Both A* and Aw are missing genes involved in defense mechanisms. In contrast to a recent study, we find that there are an extremely small number of pathotype-specific gene presences and absences. Conclusions: The three pathotypes of X. citri pv. citri that differ in their host ranges largely show genomic differences related to recombination, horizontal gene transfer and single nucleotide polymorphism. We detail the phylogenetic relationship of the pathotypes and provide a set of candidate genes involved in pathotype-specific evolutionary events that could explain to the differences in host range and pathogenicity between them. [ABSTRACT FROM AUTHOR]

The complete nucleotide sequence of isolate YN of the putative sobemovirus Cymbidium chlorotic mosaic virus (CyCMV) from Cymbidium tortisepalum plants showing chlorotic and necrotic spots in Yunnan province (southwest China) was determined by deep sequencing. Dips from symptomatic leaves showed that this virus has icosahedral particles ca. 30 nm in diameter. The viral genome is a positive-strand RNA molecule 4,081 nt in size (Gen-Bank accession No. KR996515) encoding four open reading frames with an organization similar to that described for sobemoviruses. The complete sequence of CyCMV-YN shares 89.5% identity at the nucleotide level with that of CyCMV-JP isolated from Cymbidium goeringii in Japan. This is the first report of a sobemovirus infecting orchid in China. [ABSTRACT FROM AUTHOR]

Citrus leprosis complex is an emerging disease in the Americas, associated with two unrelated taxa of viruses distributed in South, Central, and North America. The cytoplasmic viruses are Citrus leprosis virus C (CiLV-C), Citrus leprosis virus C2 (CiLV-C2), and Hibiscus green spot virus 2, and the nuclear viruses are Citrus leprosis virus N (CiLV-N) and Citrus necrotic spot virus. These viruses cause local lesion infections in all known hosts, with no natural systemic host identified to date. All leprosis viruses were believed to be transmitted by one species of mite, Brevipalpus phoenicis. However, mites collected from CiLV-C and CiLV-N infected citrus groves in Mexico were identified as B. yothersi and B. californicus sensu lato, respectively, and only B. yothersi was detected from CiLV-C2 and CiLV-N mixed infections in the Orinoco regions of Colombia. Phylogenetic analysis of the helicase, RNA- dependent RNA polymerase 2 domains and p24 gene amino acid sequences of cytoplasmic leprosis viruses showed a close relationship with recently deposited mosquito-borne negevirus sequences. Here, we present evidence that both cytoplasmic and nuclear viruses seem to replicate in viruliferous Brevipalpus species. The possible replication in the mite vector and the close relationship with mosquito borne negeviruses are consistent with the concept that members of the genus Cilevirus and Higrevirus originated in mites and citrus may play the role of mite virus vector. [ABSTRACT FROM AUTHOR]

Sudden oak death caused by the oomycete Phytophthora ramorum was first discovered in California toward the end of the 20th century and subsequently emerged on tanoak forests in Oregon before its first detection in 2001 by aerial surveys. The Oregon Department of Forestry has since monitored the epidemic and sampled symptomatic tanoak trees from 2001 to the present. Populations sampled over this period were genotyped using microsatellites and studied to infer the population genetic history. To date, only the NA1 clonal lineage is established in this region, although three lineages exist on the North American west coast. The original introduction into the Joe Hall area eventually spread to several regions: mostly north but also east and southwest. A new introduction into Hunter Creek appears to correspond to a second introduction not clustering with the early introduction. Our data are best explained by both introductions originating from nursery populations in California or Oregon and resulting from two distinct introduction events. Continued vigilance and eradication of nursery populations of P. ramorum are important to avoid further emergence and potential introduction of other clonal lineages. [ABSTRACT FROM AUTHOR]

The downy mildew pathogen, Pseudoperonospora cubensis, which infects plant species in the family Cucurbitaceae, has undergone major changes during the last decade. Disease severity and epidemics are far more destructive than previously reported, and new genotypes, races, pathotypes, and mating types of the pathogen have been discovered in populations from around the globe as a result of the resurgence of the disease. Consequently, disease control through host plant resistance and fungicide applications has become more complex. This resurgence of P. cubensis offers challenges to scientists in many research areas including pathogen biology, epidemiology and dispersal, population structure and population genetics, host preference, host-pathogen interactions and gene expression, genetic host plant resistance, inheritance of host and fungicide resistance, and chemical disease control. This review serves to summarize the current status of this major pathogen and to guide future management and research efforts within this pathosystem. [ABSTRACT FROM AUTHOR]

In sub-Saharan Africa, maize is a staple food and key determinant of food security for smallholder farming communities. Pest and disease outbreaks are key constraints to maize productivity. In September 2011, a serious disease outbreak, later diagnosed as maize lethal necrosis (MLN), was reported on maize in Kenya. The disease has since been confirmed in Rwanda and the Democratic Republic of Congo, and similar symptoms have been reported in Tanzania, Uganda, South Sudan, and Ethiopia. In 2012, yield losses of up to 90% resulted in an estimated grain loss of 126,000 metric tons valued at $52 million in Kenya alone. In eastern Africa, MLN was found to result from coinfection of maize with Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV), although MCMV alone appears to cause significant crop losses. We summarize here the results of collaborative research undertaken to understand the biology and epidemiology of MLN in East Africa and to develop disease management strategies, including identification of MLN-tolerant maize germplasm. We discuss recent progress, identify major issues requiring further research, and discuss the possible next steps for effective management of MLN. [ABSTRACT FROM AUTHOR]

Phomopsis stem canker causes yield reductions on sunflower (Helianthus annuus L.) on several continents, including Australia, Europe, and North America. In the United States, Phomopsis stem canker incidence has increased 16-fold in the Northern Great Plains between 2001 and 2012. Although Diaporthe helianthi was assumed to be the sole causal agent in the United States, a newly described species, D. gulyae, was found to be the primary cause of Phomopsis stem canker in Australia. To determine the identity of Diaporthe spp. causing Phomopsis stem canker in the Northern Great Plains, 275 infected stems were collected between 2010 and 2012. Phylogenetic analyses of sequences of the ribosomal DNA internal transcribed spacer region, elongation factor subunit 1-α, and actin gene regions of representative isolates, in comparison with those of type specimens, confirmed two species (D. helianthi and D. gulyae) in the United States. Differences in aggressiveness between the two species were determined using the stem-wound method in the greenhouse; overall, D. helianthi and D. gulyae did not vary significantly (P ≤ 0.05) in their aggressiveness at 10 and 14 days after inoculation. These findings indicate that both Diaporthe spp. have emerged as sunflower pathogens in the United States, and have implications on the management of this disease. [ABSTRACT FROM AUTHOR]

'Candidatus Liberibacter solanacearum' contains two solanaceous crop-infecting haplotypes, A and B. Two haplotype A draft genomes were assembled and compared with ZC1 (haplotype B), revealing inversion and relocation genomic rearrangements, numerous single-nucleotide polymorphisms, and differences in phage-related regions. Differences in prophage location and sequence were seen both within and between haplotype comparisons. OrthoMCL and BLAST analyses identified 46 putative coding sequences present in haplotype A that were not present in haplotype B. Thirty-eight of these loci were not found in sequences from other Liberibacter spp. Quantitative polymerase chain reaction (qPCR) assays designed to amplify sequences from 15 of these loci were screened against a panel of 'Ca. L. solanacearum'-positive samples to investigate genetic diversity. Seven of the assays demonstrated within-haplotype diversity; five failed to amplify loci in at least one haplotype A sample while three assays produced amplicons from some haplotype B samples. Eight of the loci assays showed consistent A-B differentiation. Differences in genome arrangements, prophage, and qPCR results suggesting locus diversity within the haplotypes provide more evidence for genetic complexity in this emerging bacterial species. [ABSTRACT FROM AUTHOR]

Race Ug99 (TTKSK) of Puccinia gmminis f. sp. tritici, detected in Uganda in 1998, has been recognized as a serious threat to food security because it possesses combined virulence to a large number of resistance genes found in current widely grown wheat (Triticum aestivum) varieties and germplasm, leading to its potential for rapid spread and evolution. Since its initial detection, variants of the Ug99 lineage of stem rust have been discovered in Eastern and Southern African countries, Yemen, Iran, and Egypt. To date, eight races belonging to the Ug99 lineage are known. Increased pathogen monitoring activities have led to the identification of other races in Africa and Asia with additional virulence to commercially important resistance genes. This has led to localized but severe stem rust epidemics becoming common once again in East Africa due to the breakdown of race-specific resistance gene SrTmp, which was deployed recently in the 'Digalu' and 'Robin' varieties in Ethiopia and Kenya, respectively. Enhanced research in the last decade under the umbrella of the Borlaug Global Rust Initiative has identified various race-specific resistance genes that can be utilized, preferably in combinations, to develop resistant varieties. Research and development of improved wheat germplasm with complex adult plant resistance (APR) based on multiple slow-rusting genes has also progressed. Once only the Sr2 gene was known to confer slow rusting APR; now, four more genes--Sr55, Sr56, Sr57, and Sr58--have been characterized and additional quantitative trait loci identified. Cloning of some rust resistance genes opens new perspectives on rust control in the future through the development of multiple resistance gene cassettes. However, at present, disease-surveillance-based chemical control, large- scale deployment of new varieties with multiple race-specific genes or adequate levels of APR, and reducing the cultivation of susceptible varieties in rust hot-spot areas remains the best stem rust management strategy. [ABSTRACT FROM AUTHOR]

Zebra chip (ZC) of potato is putatively caused by the fastidious, phloem-limited bacterium 'Candidatus Liberibacter solanacearum' (Lso), which is transmitted by the potato psyllid (Bactericera cockerelli). The disease, which significantly impacts both crop yield and quality, was first identified in the United States from south Texas in 2000. It reached epidemic levels in north Texas and certain production areas in Colorado. Nebraska, and New Mexico from 2004 to 2007 and it caused severe losses in fields in Oregon, Washington, and Idaho in 2011. The potato plant is susceptible to infection at all developmental stages, but disease management programs have focused on vector control through early and repeated insecticide applications, in an effort to minimize early to midseason infections which are most damaging. Growers often terminate spray programs 2 to 3 weeks prior to crop harvest due to lack of visible treatment effects on crop yield or quality. However, recent studies on vector transmission and host-pathogen interactions have revealed that late-season infections pose a significant, previously unrecognized, threat to crop quality. The pathogen can move from an infected leaf to tubers within 2 days; however, tubers infected less than 1 week before harvest will remain asymptomatic and the pathogen will be undetectable. When these tubers are placed into storage they are assumed to be disease free. However, Lso can continue to multiply in respiring tubers during storage, resulting in reduced tuber quality. Likewise, if plants become infected a few days before vines are killed, ZC can continue to develop in infected tubers before they are harvested. Perspectives on the significance of late- season infections and some of the more important issues associated with those infections are discussed. [ABSTRACT FROM AUTHOR]

A severe stem rust epidemic occurred in southern Ethiopia during November 2013 to January 2014, with yield losses close to 100% on the most widely grown wheat cultivar, 'Digalu'. Sixty-four stem rust samples collected from the regions were analyzed. A meteorological model for airborne spore dispersal was used to identify which regions were most likely to have been infected from postulated sites of initial infection. Based on the analyses of 106 single-pustule isolates derived from these samples, four races of Puccinia graminis f. sp. tritici were identified: TKTTF, TTKSK, RRTTF, and JRCQC. Race TKTTF was found to be the primary cause of the epidemic in the southeastern zones of Bale and Arsi. Isolates of race TKTTF were first identified in samples collected in early October 2013 from West Arsi. It was the sole or predominant race in 31 samples collected from Bale and Arsi zones after the stem rust epidemic was established. Race TTKSK was recovered from 15 samples from Bale and Arsi zones at low frequencies. Genotyping indicated that isolates of race TKTTF belongs to a genetic lineage that is different from the Ug99 race group and is composed of two distinct genetic types. Results from evaluation of selected germplasm indicated that some cultivars and breeding lines resistant to the Ug99 race group are susceptible to race TKTTF. Appearance of race TKTTF and the ensuing epidemic underlines the continuing threats and challenges posed by stem rust not only in East Africa but also to wider-scale wheat production. [ABSTRACT FROM AUTHOR]

The pathogen causing soybean rust, Phakopsora pachyrhizi, was first described in Japan in 1902. The disease was important in the Eastern Hemisphere for many decades before the fungus was reported in Hawaii in 1994, which was followed by reports from countries in Africa and South America. In 2004, P. pachyrhizi was confirmed in Louisiana, making it the first report in the continental United States. Based on yield losses from countries in Asia, Africa, and South America, it was clear that this pathogen could have a major economic impact on the yield of 30 million ha of soybean in the United States. The response by agencies within the United States Department of Agriculture, industry, soybean check-off boards, and universities was immediate and complex. The impacts of some of these activities are detailed in this review. The net result has been that the once dreaded disease, which caused substantial losses in other parts of the world, is now better understood and effectively managed in the United States. The disease continues to be monitored yearly for changes in spatial and temporal distribution so that soybean growers can continue to benefit by knowing where soybean rust is occurring during the growing season. [ABSTRACT FROM AUTHOR]

Ramularia collo-cygni is the biotic factor responsible for the disease Ramularia leaf spot (RLS) of barley (Hordeum vulgare). Despite having been described over 100 years ago and being considered a minor disease in some countries, the fungus is attracting interest in the scientific community as a result of the increasing number of recorded economically damaging disease epidemics. New reports of disease spread and fungal identification using molecular diagnostics have helped redefine RLS as a global disease. This review describes recent developments in our understanding of the biology and epidemiology of the fungus, outlines advances made in the field of the genetics of both the fungus and host, and summarizes the control strategies currently available. [ABSTRACT FROM AUTHOR]

The article focuses on the use of computational prediction of fungal effector proteins in fungal plant diseases. Topics discussed include the relationship of fungal pathogens with plant cells, the absence of unifying sequence features or protein structural folds in fungal effector, and effectors with similar folds and secretion signals. The use of criteria of small and cysteine-rich in applying predicted secretomes for apoplastic effectors.

Lathyrus sativus (grass pea) is a temperate grain legume crop with a great potential for expansion in dry areas or zones that are becoming more drought-prone. It is also recognized as a potential source of resistance to several important diseases in legumes, such as ascochyta blight. Nevertheless, the lack of detailed genomic and/or transcriptomic information hampers further exploitation of grass pea resistance-related genes in precision breeding. To elucidate the pathways differentially regulated during ascochyta-grass pea interaction and to identify resistance candidate genes, we compared the early response of the leaf gene expression profile of a resistant L. sativus genotype to Ascochyta lathyri infection with a non-inoculated control sample from the same genotype employing deepSuperSAGE. This analysis generated 14.387 UniTags of which 95.7% mapped to a reference grass pea/rust interaction transcriptome. From the total mapped UniTags, 738 were significantly differentially expressed between control and inoculated leaves. The results indicate that several gene classes acting in different phases of the plant/pathogen interaction are involved in the L. sativus response to A. lathyri infection. Most notably a clear up-regulation of defense-related genes involved in and/or regulated by the ethylene pathway was observed. There was also evidence of alterations in cell wall metabolism indicated by overexpression of cellulose synthase and lignin biosynthesis genes. This first genome-wide overview of the gene expression profile of the L. sativus response to ascochyta infection delivered a valuable set of candidate resistance genes for future use in precision breeding. [ABSTRACT FROM AUTHOR]

Crop losses caused by insects, pests, andpathogens remain one of the major problems in sustainable agriculture. Environmental and health concerns regarding the overuse of pesticides, and the impacts of climate change on epidemics are immediate pressing issues. In addition, the breakdown of plant resistance by pathogen populations brings limitations to the genetic control of diseases. Biologics can be effective in all types of agricultural systems including organic, sustainable, and conventional. Beneficial microorganisms including Bacillus and Trichoderma species have been employed as environmentally safe biopesticides. Molecular and proteomic studies on biopesticides have revealed the nature of antibiotics, secreted enzymes, and inhibitory compounds. This review focuses on the current knowledge regarding biological agents and their metabolites including quorum-sensing molecules and volatile compounds, and how they can be used in pest and disease management programs. [ABSTRACT FROM AUTHOR]

Proper utilization of plant disease resistance genes requires a good understanding of their short- and long-term evolution. Here we present a comprehensive study of the long-term evolutionary history of nucleotide-binding site (NBS)-leucine-rich repeat (LRR) genes within and beyond the legume family. The small group of NBS-LRR genes with an amino-terminal RESISTANCE TO POWDERY MILDEW8 (RPW8)-like domain (referred to as RNL) was first revealed as a basal clade sister to both coiled-coil-NBS-LRR (CNL) and Toll/Interleukin1 receptor-NBS-LRR (TNL) clades. Using Arabidopsis (Arabidopsis thaliana) as an outgroup, this study explicitly recovered 31 ancestral NBS lineages (two RNL, 21 CNL, and eight TNL) that had existed in the rosid common ancestor and 119 ancestral lineages (nine RNL, 55 CNL, and 55 TNL) that had diverged in the legume common ancestor. It was shown that, during their evolution in the past 54 million years, approximately 94% (112 of 119) of the ancestral legume NBS lineages experienced deletions or significant expansions, while seven original lineages were maintained in a conservative manner. The NBS gene duplication pattern was further examined. The local tandem duplications dominated NBS gene gains in the total number of genes (more than 75%), which was not surprising. However, it was interesting from our study that ectopic duplications had created many novel NBS gene loci in individual legume genomes, which occurred at a significant frequency of 8% to 20% in different legume lineages. Finally, by surveying the legume microRNAs that can potentially regulate NBS genes, we found that the microRNA-NBS gene interaction also exhibited a gain-and-loss pattern during the legume evolution. [ABSTRACT FROM AUTHOR]

Background The white mold fungus Sclerotinia sclerotiorum is a devastating necrotrophic plant pathogen with a remarkably broad host range. The interaction of necrotrophs with their hosts is more complex than initially thought, and still poorly understood. Results We combined bioinformatics approaches to determine the repertoire of S. sclerotiorum effector candidates and conducted detailed sequence and expression analyses on selected candidates. We identified 486 S. sclerotiorum secreted protein genes expressed in planta, many of which have no predicted enzymatic activity and may be involved in the interaction between the fungus and its hosts. We focused on those showing (i) protein domains and motifs found in known fungal effectors, (ii) signatures of positive selection, (iii) recent gene duplication, or (iv) being S. sclerotiorum-specific. We identified 78 effector candidates based on these properties. We analyzed the expression pattern of 16 representative effector candidate genes on four host plants and revealed diverse expression patterns. Conclusions These results reveal diverse predicted functions and expression patterns in the repertoire of S. sclerotiorum effector candidates. They will facilitate the functional analysis of fungal pathogenicity determinants and should prove useful in the search for plant quantitative disease resistance components active against the white mold. [ABSTRACT FROM AUTHOR]

The article deals with the use of molecular genetics and genomics in studying ancient plant pathogens and diseases. Topics discuss include DNA retrieved from historic and prehistoric sources, genetic information derived from aDNA sequences, the application of aDNA sequence to the study of the 19th century potato blight pandemic and the virulence of the Phytophthora infestans HERB-1. The potential of using archaeogenomics to solve quesitons in history and evolution is considered.

The recent report of a differential response of wheat lines containing the Pch2 gene to infection with the eyespot pathogens Oculimacula yallundae and O. acuformis has prompted this re-examination of the response to these fungi by the recombinant lines used to map Pch2. Homozygous recombinant substitution lines ( RSL) derived from the hybridization of Chinese Spring ( CS) and the CS chromosome substitution line Cappelle Desprez 7A ( CS/ CD7A), previously evaluated for response to glucuronidase ( GUS)-transformed O. yallundae, were evaluated for response to infection with GUS-transformed O. acuformis. Based on visual scores and on GUS expression level, which reflects fungal colonization of seedling plants, evidence of a quantitative trait locus ( QTL) conferring resistance to O. acuformis was found in two separate growth chamber experiments (logarithm of the odds, LOD, = 2·7 and 6·7 at 305 and 289 cM, respectively) that was equivalent in location to that for resistance to O. yallundae ( LOD = 13·2 and 11·4 at 289 and 304 cM, respectively). These results confirm that Pch2 confers some degree of resistance against both O. yallundae and O. acuformis under these conditions. [ABSTRACT FROM AUTHOR]

Bacterial soft rot of banana was first noticed in 2009 in Guangzhou city, China. The disease also was observed on various banana cultivars of different genotypes in several other cities. Symptoms of the disease included leaf wilting, collapse of pseudostems, and unusual odor. Five isolated strains that fulfilled Koch's postulates were used for biochemical testing. The five strains were most similar to Dickeya dadantii or D. zeae, but were much less similar to D. paradisiaca when using several phenotype characteristics. Sequence analysis of 16S rDNA, dnaX, gryB, and recA of a reference strain revealed a similarity of 99% with the sequences of D. zeae, rather than D. paradisiaca. Phylogenic anal-ysis of concatenated sequences of dnaX, gryB, and recA indicated that the banana strain constituted a distinguishable clade with several D. zeae strains involving rice pathogens D. zeae EC1 and ZJU1202 from Guangdong province, but the banana pathogen had several characteristics that distinguished it from the rice pathogens. Therefore, the banana pathogen was determined to be D. zeae. This is the first report of ba-nana soft rot caused by D. zeae in China; however, the pathogen can infect other important crops. [ABSTRACT FROM AUTHOR]

Citrus black spot (CBS) is an emerging citrus disease in Florida. The causal agent is Guignardia citricarpa, but non-pathogenic Guignardia mangiferae is often isolated from the same lesions. A hypothesis on CBS emergence in Florida was formulated: a change in environment, such as increased copper applications could have favored growth and infection by G. citricarpa, causing it to outcompete G. mangiferae, facilitating the emergence of CBS. Moreover, differential temperature optima could favor one of the two species. Four agar media were compared for isolation of both species from citrus tissues. The obtained isolates were subjected to sequence comparison in the ITS region with that of Guignardia species worldwide, to pathogenicity tests, growth tests at different temperatures and competition assays at different copper concentrations. There were no significant differences between the media for isolation of both Guignardia species. Comparison of the ITS region of the isolates to those in international databases confirmed the identity of both species, and revealed higher diversity among the G. mangiferae than G. citricarpa isolates. The G. citricarpa isolates had similar temperature response curves (optima at 26°C), whereas the G. mangiferae isolates were more diverse in their response to temperatures (optima at 25-30°C). Growth of G. citricarpa was increasingly suppressed at higher copper concentrations, while a slight increase or no change in growth rate was observed for G. mangiferae. Therefore, our initial hypothesis was rejected. The differential response to copper and temperature by G. citricarpa and G. mangiferae will serve as a basis for modeling and predicting the spread of CBS in Florida. [ABSTRACT FROM AUTHOR]

About 20 species of viruses belonging to five genera, Benyvirus, Furovirus, Pecluvirus, Pomovirus and Bymovirus, are known to be transmitted by plasmodiophorids. These viruses have all positive-sense, single-stranded RNA genomes that consist of two to five RNA components. Three species of plasmodiophorids are recognized as vectors: Polymyxa graminis, P. betae, and Spongospora subterranea. The viruses can survive in soil within the long-lived resting spores of the vector. There are biological and genetic variations in both virus and vector species. Many of the viruses are causal agents of important diseases in major crops such as rice, wheat, barley, rye, sugar beet, potato, and groundnut. Control is dependent on the development of resistant cultivars. During the last half century, several virus diseases have rapidly spread worldwide. For six major virus diseases, we address their geographical distribution, diversity, and genetic resistance. [ABSTRACT FROM AUTHOR]

Plants have developed RNA silencing as an antiviral defense mechanism. To escape from the plant host's defenses, viruses have countered their host's antiviral silencing by producing RNA silencing suppressor proteins (RSSs). Although the mode of action of the majority of viral RSSs has been found to be through double-stranded RNA-binding, viruses have different strategies to counteract the host's antiviral silencing pathways. The 2b protein of Cucumber mosaic virus, which is one of the most extensively studied viral RSSs, is reviewed here to provide insights on the molecular arms race between viruses and their host plants. [ABSTRACT FROM AUTHOR]

An overview is provided for the aspects of history, biology, genomics, genetics, and epidemiology of zebra chip (ZC), a destructive disease of potato (Solanum tuberosum) that represents a major threat to the potato industries in the United States as well as other potato-production regions in the world. The disease is associated with a gram-negative, phloem-limited, insect-vectored, unculturable prokaryote, 'Candidatus Liberibacter solanacearum', that belongs to the Rhizobiaceae family of α-Proteobacteria. The closest cultivated relatives of 'Ca. L. solanacearum' are members of the group of bacteria known as the α-2 subgroup. In spite of the fact that Koch's postulates sensu stricto have not been fulfilled, a great deal of progress has been made in understanding the ZC disease complex since discovery of the disease. Nevertheless, more research is needed to better understand vector biology, disease mechanisms, host response, and epidemiology in the context of vector-pathogen-plant interactions. Current ZC management strategies focus primarily on psyllid control. The ultimate control of ZC likely relies on host resistance. Unfortunately, all commercial potato cultivars are susceptible to ZC. Elucidation of the 'Ca. L. solanacearum' genome sequence has provided insights into the genetic basis of virulence and physiological and metabolic capability of this organism. Finally, the most effective, sustainable management of ZC is likely to be based on integrated strategies, including removal or reduction of vectors or inocula, improvement of host resistance to the presumptive pathogen and psyllid vectors, and novel gene-based therapeutic treatment. [ABSTRACT FROM AUTHOR]

Characterization and evaluation of lentil germplasm (Lens culinaris Medikus) collected from indigenous and exotic sources for flowering (61-123days), maturity (108-147days), plant height (18-70.80cm), pods per plant (9-158), primary branches/plant (2-6), root-knot nematode, fungal and viral diseases revealed considerable variation for different agro-morphological traits and level of tolerance against biotic stress of both macrosperma and microsperma types. Besides exhibiting a wide range of variation in important agro-morphological traits by all the wild species, Lens nigricans and Lens ervoides emerged as valuable sources of resistance to several biotic stresses namely, Ascochyta blight, rust and powdery mildew diseases. A new germplasm line (ILL-4605) identified earlier than Precoz in flowering (55-62 days) and may prove very useful in the lentil improvement programmes for the development of varieties with bolder seeds (> 3.5 g /100g) and earlier maturity (110 days) as well. Such germplasm lines, which mature 20-25 days earlier than the landraces of North India will be useful and can be adopted for different cropping systems. Adoption of identified short duration, early maturing and bold seeded germplasm may help in heat and drought escape which otherwise would have resulted in abortion of flower buds and subsequently low crop yield. A range of trait specific germplasm identified for different agro-morphological characters are, early flowering (IC- 560333, IC-559639, IC-560111 and IC-560148), high biomass (IC-559744, IC-559608, IC-559767 and IC-560040), high yielding (IC-398094, IC-560212, IC-560332 and IC-560206) and high number of primary branches (IC-559870, IC-318881, IC-398688 and IC-560182) might be good option under unpredictable environmental situations. Occurrence of symptoms resembling to those of virus diseases were noticed in many germplasm accessions. [ABSTRACT FROM AUTHOR]

In the plant Arabidopsis thaliana, multiple quantitative trait loci (QTLs), including RFO2, account for the strong resistance of accession Columbia-0 (Col-0) and relative susceptibility of Taynuilt-0 (Ty-0) to the vascular wilt fungus Fusarium oxysporum forma specialis matthioli. We find that RFO2 corresponds to diversity in receptor-like protein (RLP) genes. In Col-0, there is a tandem pair of RLP genes: RFO2/At1g17250 confers resistance while RLP2 does not. In Ty-0, the highly diverged RFO2 locus has one RLP gene conferring weaker resistance. While the endogenous RFO2 makes a modest contribution to resistance, transgenic RFO2 provides strong pathogen-specific resistance. The extracellular leucine-rich repeats (eLRRs) in RFO2 and RLP2 are interchangeable for resistance and remarkably similar to eLRRs in the receptor-like kinase PSY1R, which perceives tyrosine-sulfated peptide PSY1. Reduced infection in psy1r and mutants of related phytosulfokine (PSK) receptor genes PSKR1 and PSKR2 shows that tyrosine-sulfated peptide signaling promotes susceptibility. The related eLRRs in RFO2 and PSY1R are not interchangeable; and expression of the RLP nPcR, in which eLRRs in RFO2 are replaced with eLRRs in PSY1R, results in constitutive resistance. Counterintuitively, PSY1 signaling suppresses nPcR because psy1r nPcR is lethal. The fact that PSK signaling does not similarly affect nPcR argues that PSY1 signaling directly downregulates the expression of nPcR. Our results support a speculative but intriguing model to explain RFO2's role in resistance. We propose that F. oxysporum produces an effector that inhibits the normal negative feedback regulation of PSY1R, which stabilizes PSY1 signaling and induces susceptibility. However, RFO2, acting as a decoy receptor for PSY1R, is also stabilized by the effector and instead induces host immunity. Overall, the quantitative resistance of RFO2 is reminiscent of the better-studied monogenic resistance traits. [ABSTRACT FROM AUTHOR]

Cell-cell communication, or quorum sensing, is a widespread phenomenon in bacteria that is used to coordinate gene expression among local populations. Its use by bacterial pathogens to regulate genes that promote invasion, defense, and spread has been particularly well documented. With the ongoing emergence of antibiotic-resistant pathogens, there is a current need for development of alternative therapeutic strategies. An antivirulence approach by which quorum sensing is impeded has caught on as a viable means to manipulate bacterial processes, especially pathogenic traits that are harmful to human and animal health and agricultural productivity. The identification and development of chemical compounds and enzymes that facilitate quorum-sensing inhibition (QSI) by targeting signaling molecules, signal biogenesis, or signal detection are reviewed here. Overall, the evidence suggests that QSI therapy may be efficacious against some, but not necessarily all, bacterial pathogens, and several failures and ongoing concerns that may steer future studies in productive directions are discussed. Nevertheless, various QSI successes have rightfully perpetuated excitement surrounding new potential therapies, and this review highlights promising QSI leads in disrupting pathogenesis in both plants and animals. [ABSTRACT FROM AUTHOR]

A total of 358 recent European winter wheat varieties plus 14 spring wheat varieties were evaluated for resistance to Fusarium head blight (FHB) caused by Fusarium graminearum and Fusarium culmorum in four separate environments. The FHB scores based on FHB incidence (Type I resistance)×FHB severity (Type II resistance) indicated a wide phenotypic variation of the varieties with BLUE (best linear unbiased estimation) values ranging from 0.07 to 33.67. Genotyping with 732 microsatellite markers resulted in 782 loci of which 620 were placed on the ITMI map. The resulting average marker distance of 6.8 cM allowed genome wide association mapping employing a mixed model. Though no clear population structure was discovered, a kinship matrix was used for stratification. A total of 794 significant (−log10(p)-value≥3.0) associations between SSR-loci and environment-specific FHB scores or BLUE values were detected, which included 323 SSR alleles. For FHB incidence and FHB severity a total of 861 and 877 individual marker-trait associations (MTA) were detected, respectively. Associations for both traits co-located with FHB score in most cases. Consistent associations detected in three or more environments were found on all chromosomes except chromosome 6B, and with the highest number of MTA on chromosome 5B. The dependence of the number of favourable and unfavourable alleles within a variety to the respective FHB scores indicated an additive effect of favourable and unfavourable alleles, i.e. genotypes with more favourable or less unfavourable alleles tended to show greater resistance to FHB. Assessment of a marker specific for the dwarfing gene Rht-D1 resulted in strong effects. The results provide a prerequisite for designing genome wide breeding strategies for FHB resistance. [ABSTRACT FROM AUTHOR]

Partial resistance is a quantitative type of resistance that, by definition of Parlevliet, is not based on hypersensitivity. It is largely pathotype nonspecific, although some minor isolate-specific responses have been reported. In order to elucidate the isolate specificity of individual genes for partial resistance, three barley recombinant inbred line mapping populations were analyzed for resistance to the leaf rust fungus Puccinia hordei. The mapping populations were inoculated with one isolate avirulent and two isolates virulent to resistance gene Rph7g. Six significant quantitative trait loci (QTLs) were detected. Of these, two (Rphq3 and Rphq11) were detected with only the avirulent isolate (1.2.1.) and one (Rphq18) only with both virulent isolates (CO-04 and 28.1). The effectiveness of these QTLs was tested with 14 isolates, using a tester set of genotypes containing alleles for resistance or susceptibility for these QTLs. QTL Rphq18 was effective to only two isolates, CO-04 and 28.1, whereas Rphq3 and Rphq11 were ineffective to CO-04 and 28.1 but effective to all other isolates, except one. This resulted in a significant Person's differential interaction, which is a hallmark of a gene-for-gene interaction. The minor gene-for-minor gene interaction is not based on hypersensitivity and there is no evidence that the resistance is based on genes belonging to the nucleotide-binding leucine-rich repeat class. [ABSTRACT FROM AUTHOR]

In order to critically test the hypothesis that virulence variation in the Ascochyta rabiei/chickpea pathosystem is a discrete character under simple genetic control, a genetic cross was made between a highly virulent isolate of A. rabiei from Syria and a less virulent isolate from the USA. Two independent virulence assays conducted by inoculating susceptible and resistant chickpea cultivars under controlled conditions with 77 independent progeny isolates from this cross revealed a continuous distribution of disease phenotypes. Bimodality, as would be predicted for the segregation of virulence under simple genetic control, was not supported by statistical tests of the progeny phenotype distribution. anova revealed highly significant pathogen-genotype × host-genotype interactions demonstrating the segregation of genes controlling specialization on the two cultivars tested. These interactions could be localized to two isolates that changed virulence rank on the cultivars. It was concluded that variation in virulence to these two cultivars is under quantitative genetic control. If this conclusion applies to other cultivars, it can be speculated that the discrete categories of virulence variation identified in previous studies were probably the result of incomplete sampling of host resistance or pathogen virulence variation and/or of selection for increased virulence in contemporary A. rabiei populations. [ABSTRACT FROM AUTHOR]

Background: Dufulin is a new antiviral agent that is highly effective against plant viruses and acts by activating systemic acquired resistance (SAR) in plants. In recent years, it has been used widely to prevent and control tobacco and rice viral diseases in China. However, its targets and mechanism of action are still poorly understood. Methodology/Principal Findings: Here, differential in-gel electrophoresis (DIGE) and classical two-dimensional electrophoresis (2-DE) techniques were combined with mass spectrometry (MS) to identify the target of Dufulin. More than 40 proteins were found to be differentially expressed (⩾1.5 fold or ⩽1.5 fold) upon Dufulin treatment in Nicotiana tabacum K326. Based on annotations in the Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, these proteins were found to be related to disease resistance. Directed acyclic graph (DAG) analysis of the various pathways demonstrated harpin binding protein-1 (HrBP1) as the target of action of Dufulin. Additionally, western blotting, semi-quantitative reverse transcription polymerase chain reaction (RT-PCR), and real time PCR analyses were also conducted to identify the specific mechanism of action of Dufulin. Our results show that activation of HrBP1 triggers the salicylic acid (SA) signaling pathway and thereby produces antiviral responses in the plant host. A protective assay based on lesion counting further confirmed the antiviral activity of Dufulin. Conclusion: This study identified HrBP1 as a target protein of Dufulin and that Dufulin can activate the SA signaling pathway to induce host plants to generate antiviral responses. [ABSTRACT FROM AUTHOR]