Search

In the present study, a diverse panel of 96 accessions of lentil germplasm was used to study flowering time over environments and to identify simple sequence repeat markers associated with flowering time through association mapping. The study showed high broad sense heritability estimate (h2bs=0.93) for flowering time in lentil. Screening of 534 SSR markers resulted in an identification of 75 SSR polymorphic markers (13.9%) across studied genotypes. These markers amplified 266 loci and generated 697 alleles ranging from two to 16 alleles per locus. Model-based cluster analysis used for the determination of population structure resulted in the identification of two distinct subpopulations. Distribution of flowering time was ranged from 40 to 70 days in subpopulation I and from 54 to 69 days in subpopulation II and did not skew either late or early flowering time within a subpopulation. No admixture was observed within the subpopulations. Use of the most accepted maximum likelihood model (P3D mixed linear model with optimum compression) of MTA analysis showed significant association of 26 SSR markers with flowering time at <0.05 probability. The percent of phenotypic explained by each associated marker with flowering time ranged from 2.1 to 21.8% and identified QTLs for flowering time explaining high phenotypic variation across the environments (10.7-21.8%) or in a particular environment (10.2-21.4%). In the present study, 13 EST-SSR showed significant association with flowering time and explained large phenotypic variation (2.3-21.8%) compared to genomic SSR markers (2.1-10.2%). Hence, these markers can be used as functional markers in the lentil breeding program to develop short duration cultivars. [ABSTRACT FROM AUTHOR]

Clusterbean (Cyamopsis tetragonoloba L. Taub), is an important industrial, vegetable and forage crop. This crop owes its commercial importance to the presence of guar gum (galactomannans) in its endosperm which is used as a lubricant in a range of industries. Despite its relevance to agriculture and industry, genomic resources available in this crop are limited. Therefore, the present study was undertaken to generate RNA-Seq based transcriptome from leaf, shoot, and flower tissues. A total of 145 million high quality Illumina reads were assembled using Trinity into 127,706 transcripts and 48,007 non-redundant high quality (HQ) unigenes. We annotated 79% unigenes against Plant Genes from the National Center for Biotechnology Information (NCBI), Swiss-Prot, Pfam, gene ontology (GO) and KEGG databases. Among the annotated unigenes, 30,020 were assigned with 116,964 GO terms, 9984 with EC and 6111 with 137 KEGG pathways. At different fragments per kilobase of transcript per millions fragments sequenced (FPKM) levels, genes were found expressed higher in flower tissue followed by shoot and leaf. Additionally, we identified 8687 potential simple sequence repeats (SSRs) with an average frequency of one SSR per 8.75 kb. A total of 28 amplified SSRs in 21 clusterbean genotypes resulted in polymorphism in 13 markers with average polymorphic information content (PIC) of 0.21. We also constructed a database named 'ClustergeneDB' for easy retrieval of unigenes and the microsatellite markers. The tissue specific genes identified and the molecular marker resources developed in this study is expected to aid in genetic improvement of clusterbean for its end use. [ABSTRACT FROM AUTHOR]

Abstract An environment friendly and sustainable approach is being emerged in the area of nanotechnology for accelerated growth and development of culturable aquatic animals hence green chemistry is gaining momentum in recent years. The present study has been carried out to delineate the effects of selenium nanoparticles (Se-NPs) on growth performance, antioxidative status and immunity of fish reared under lead (Pb) and high temperature (34 °C). Three hundred and fifteen fish were equally distributed in seven treatments in triplicates. Three isocaloric and isonitrogenous experimental diets viz. control (Se-NPs-0 mg/kg), Se-NPs at 1 mg/kg and Se-NPs at 2 mg/kg were formulated. The fish were reared under lead (Pb, 1/21st of LC 50 (4 ppm)) and high temperature (34 °C) stress and fed with or without dietary Se-NPs. The effects of dietary Se-NPs were studied in terms of growth performance (Weight gain %, feed conversion ratio, protein efficiency ratio and specific growth rate), antioxidative status (catalase, superoxide dismutase, glutathione-S-transferase and glutathione peroxidase), neurotransmitter enzymes (AChE), stress biomarkers (heat shock protein 70, serum cortisol, blood glucose, vitamin C), immunological status (total protein, A/G ratio and respiratory burst activity) in Pangasinodon hypophthalmus post challenge with Aeromonas veronii biovar sobria. Results of the investigation demonstrated significant improvement of growth performance, antioxidative status, neurotransmitter enzyme activity, stress markers and more importantly enhanced immunity of the fish with dietary incorporation of Se-NPs at 1 mg/kg. In addition, post bacterial infection, the relative % survival increased and cumulative mortality % decreased in the group fed with Se-NPs at 1 mg/kg diet. Pb and high temperature treated and fed with control diet group showed devastating impact on the growth performance, antioxidative status, stress markers and immunity of the fish. Similarly, application of Se-NPs at 2 mg/kg showed poor growth performance and elevated level of oxidative stress and other stress biomarkers including other biochemical attributes. Inclusive results indicated that, Se-NPs at 1 mg/kg has capability to enhance overall performance and alleviate multiple stresses in P. hypophthalmus. Hence, Se-NPs at optimum level have ability to develop green chemistry in feed industry for better growth performance of the fish. Highlights • Dietary Se-NPs enhanced growth performance and antioxidative status of Pangasinodon hypophthalmus reared under Pb and high temperature. • Dietary Se-NPs protect neurotransmitter enzymes (AChE) of P. hypophthalmus reared under Pb and high temperature. • Dietary Se-NPs enhanced Immunomodulation of P. hypophthalmus reared under Pb and high temperature. • Dietary Se-NPs enhanced survival of P. hypophthalmus after infection with Aeromonas veronii biovar sobria. [ABSTRACT FROM AUTHOR]

There is strong relation between nutrition and thermal tolerance of fish in terms of improved critical temperature minima (CTmin), lethal temperature minima (LTmin), critical temperature maxima (CTmax), and lethal temperature maxima (LTmax). Fishes act as quantifying indicators of the climate change due to their critical thermal limits in nature and ability to adjust thermal sensitivity to maintain their homeostasis. In the present study, biologically synthesised selenium nanoparticles (Se-NPs) from fisheries waste (fish gill) were used to evaluate its efficacy for enhancement of thermal tolerance of Pangasius hypophthalmus reared under lead (Pb) and high temperature (34 °C) for 72 days. At the end of the experimental period, CTmin, LTmin, and CTmax, LTmax and cellular metabolic stress were evaluated. The CTmin, LTmin were noticeably (p < 0.01) reduced and CTmax, LTmax were enhanced in treatment groups fed with dietary Se-NPs. It was also observed that CTmax and LTmax were increased with acclimation temperature. The positive correlation was perceived between CTmin, LTmin (Y = −0.45 + 11.05x, R 2 , 0.768) and CTmax, LTmax (Y = −0.78 + 8.17x, R 2 , 0.858) fed with Se-NPs supplemented diet and exposed to Pb and high temperature. Significant improvements in the oxidative and metabolic enzymes were noticed post thermal tolerance experiment. Overall results indicated that incorporation of Se-NPs @ 1 mg/ kg in diet can confer protection against Pb and thermal stress in P. hypophthalmus . [ABSTRACT FROM AUTHOR]

A preliminary study was conducted to delineate the ameliorating effect of dietary zinc nanoparticles (Zn-NPs) against thermal stress in Pangasius hypophthalmus reared under concurrent exposure to lead (Pb) and elevated temperature (34 °C). Three diets were formulated such as control (no Zn-NPs), Zn-NPs 10 and 20 mg/kg diet. Two hundred and thirty four fish were randomly distributed in to six treatments groups in triplicates; such as control group (no Zn-NPs in diet and unexposed to Pb and temperature, Ctr/Ctr), control diet with concurrent exposure to Pb and temperature (Pb-T/Ctr), Zn-NPs 10 and 20 mg/kg without stressors (Zn-NPs 10 mg/kg, Zn-NPs 20 mg/kg), Zn-NPs 10 and 20 mg/kg diet with concurrent exposure to Pb and temperature (Pb-T/Zn-NPs 10 mg/kg, Pb-T/Zn-NPs 20 mg/kg). The Pb in treated water was maintained at the level of 1/21th of LC 50 (4 ppm) at 34 °C temperature in stressors groups. Post 60 days feeding trial, critical thermal minimum (CTmin), lethal thermal minimum (LTmin), and critical thermal maximum (CTmax), lethal thermal maximum (LTmax) and biochemical attributes on P. hypophthalmus were evaluated. The results indicated that, dietary supplementation of Zn-NPs increased the CTmin, LTmin and CTmax, LTmax in P. hypophthalmus . Positive correlations were observed between CTmin LTmin (Y = − 0.495 + 10.08x, R 2 , 0.896) and CTmax LTmax (Y = − 0.872 + 4.43x, R 2 , 0.940). At the end of the thermal tolerance study, oxidative stress and lipid peroxidation (LPO) were significantly reduced and neurotransmitter enzyme was significantly increased in the groups fed with Zn-NPs @ 10 mg and 20 mg/kg diet. Overall results indicated that dietary Zn-NPs can confer protection against thermal stress in P. hypophthalmus . [ABSTRACT FROM AUTHOR]

Stress is the result of an organism's interaction with environmental challenges. Regulations of gene expression including translation modulations are critical for adaptation and survival under stress. Untranslated regions (UTRs) of the transcripts play significant roles in translation regulation and continue to raise many intriguing questions in our understanding of cellular stress physiology. IRES (Internal ribosome entry site) and uORF (upstream open reading frame) mediated alternative translation initiations are emerging as unique mechanisms. Recent studies have revealed novel means of mRNAs stabilization in stress granules and their reversible modifications. Differential regulation of select transcripts is possible by the interplay between the adenine/uridine-rich elements (AREs) in 3’UTR with their binding proteins (AUBP) and by microRNA-mediated effects. Coordination of these various mechanisms control translation and thereby enables appropriate responses to environmental stress. In this review, we focus on the role of sequence signatures both at 5’ and 3’UTRs in translation reprogramming during cellular stress responses. [ABSTRACT FROM AUTHOR]

Drought or soil moisture stressremains one of the most important abiotic stresses; limiting chickpea yield worldwide. In order to identify drought tolerant chickpea genotype, 34 genotypes (13 desi and 21 kabuli including 4 checks) were evaluated under irrigated and moisture stressed condition in randomized complete block design(RBD) with three replications during 2013-14. Six drought tolerance indices viz, mean productivity (MP), geometric mean productivity (GMP), yield index (YI), tolerance index (TOL), stress susceptibility index (SSI), and superiority measures (SM) were implicated on the basis of grain yield in moisture stress (Ys) and well irrigated (Yp) conditions. Genotypes viz. FLIP03-100, FLIP05-123C, FLIP03-98C, IPC2009-102 and IPC2009-186 were found to be superiorgenotypes based on MP and GMP drought tolerant indices under moisture stress condition. High significant positive correlations were recorded between MP and GMP (0.944**), MP and YI (0.984**), TOL and SSI (0.877**) and GMP and YI (0.984**) indices. Principal component analysis lowered the six indices into two components first and second component justifying 97.9% of the variations (84.63 and 13.34% for PC1 and PC2, respectively). Further, the genotypes were grouped into 4 groups by two ways cluster analysis (using Ward's method) based on Yp, Ys and drought tolerance indices. Importantly, the results of correlation, 3D graphs, bi-plot and cluster analysis reveals that the most suitable indices to screen chickpea genotypes in drought stress conditions were MP, GMP and YI. Therefore, these indices may be useful for selection of drought tolerant chickpea genotypes. [ABSTRACT FROM AUTHOR]

• Mango plant can maintain its canopy coolness during desiccation period by its ability to with draw water during water limiting conditions. • Mango plant can maintain its carboxylation capacity during hotter period of the day. • Crucial components of photosynthesis, PSII efficiency is maintained during desiccation period, thereby preventing the plants from desiccation damage and providing tolerance mechanisms. • Mango plant can maintain its structural attributes (mainly by maintaining turgidity due to water retention capacity) such as convex hull area, which also supports desiccation tolerance mechanisms. Capacity of mango tree to withstand drought (absence of soil moisture) can be attributed to stress resilient physiological processes inside the cell and also at whole plant level. To test this hypothesis, photosynthetic traits were recorded over the period of time. Further, desiccation tolerance of photosystem II (PSII) in excised mango leaves were measured by employing chlorophyll fluorescence imaging system. Beside this, the capacity of mango tree to keep its canopy cool was monitored in every 10 min interval throughout the day during dry and rainy season in the field by employing thermal imaging system. Finally, phenomics platform was used to monitor depletion of tissue moisture level as well as changes in structural attributes during desiccation in excised shoots of the tree. It was inferred that mango tree can maintain its carboxylation efficiency over the period of time. IR studies confirmed that mango tree maintained its canopy coolness during dry season. In addition, the chlorophyll fluorescence experiments revealed that mango leaves retained 50% of initial PSII efficiency for as many as 4 days after desiccation and chlorophyll fluorogram also depicted the observations. Phenomics studies concluded that mango twig retained tissue water content even up to the 164 h of desiccation with gradual decrease in canopy area. Hence, it is interpreted that these physiological resilience are amongst the various reasons for evergreen feature of mango tree which has tendency to survive severe soil moisture deficit particularly during the summer in tropical and subtropical regions, which has been revealed for first time using phenomics platform. [ABSTRACT FROM AUTHOR]

• This study identified urdbean (Vigna mungo L. Hepper) genotypes for high concentration of Fe and Zn. • Genotype, environment and their interactions influenced micronutrients composition. • PU 31 and IPU 99−43 genotypes had stable high Fe concentration. • BGP 28 and HPU 120, were highly stable for high concentration of Zn. • This study enriched our knowledge for breeding biofortified urdbean cultivars. Urdbean is an important pulse crop in South Asia and has the potential to be a global food legume due to its rich nutrient profile. Therefore, identification of sources with high concentration of iron and zinc is important for overcoming the problem of micronutrient malnutrition. In the present study, 83 urdbean genotypes of diverse origin were tested for iron and zinc concentrations over two locations. Analysis of variance showed that genotype effects were significant for both traits over both locations. Iron concentration ranged from 19−235 mg/kg (mean 117 mg/kg) and 16−255 mg/kg (mean 91 mg/kg) among tested genotypes at the first and second locations, respectively. For zinc concentration it ranged from 5−134 mg/kg (mean 44 mg/kg) at first location, while at second location it was between 12−59 mg/kg (mean 29 mg/kg). Combined analysis of variance showed the 'genotype (G)', 'location (L)' and 'genotype' (G) x 'location' (L) interaction effects significant for both micronutrient concentrations. For high iron concentration, most stable urdbean genotypes (PU 31 and IPU 99−43) were identified using GGEBiplot analysis. Similarly, highly stable genotypes for high concentration of zinc were BGP 28 and HPU 120. This study has identified useful donors and enhanced our knowledge towards the development of biofortified urdbean cultivars. [ABSTRACT FROM AUTHOR]

In the present study, an experiment was carried out to delineate the lethal concentration of (LC 50) zinc nanoparticles (Zn-NPs) alone and with concurrent to high temperature (34 °C) in Pangasianodon hypophthalmus. The lethal concentration of Zn-NPs alone and with high temperature was estimated as 21.89 and 19.74 mg/L respectivey in P. hypophthalmus. The lethal concentration was decided with the help of definite concentration via 16, 18, 20, 22, 24, 26, 28 and 30 mg/L. The Zn-NPs were significantly alter the biochemical and histopathology of different fish tissues. The stress biomarkers such as oxidative stress (catalase superoxide dismutase and glutathione-s-transferase, lipid peroxidation) was studied in the liver, gill and kidney tissue, which was noticeable (p < 0.01) enhanced with higher concentration in both condition (Zn-NPs alone and Zn-NPs-T) in dose dependent manners. The carbohydrate (lactate dehydrogenase and malate dehydrogenase) and protein metabolic enzymes (alanine amino transferase and aspartate amino transferase) were also remarkable enhanced (p < 0.01) with higher concentration of Zn-NPs and Zn-NPs-T. The neurotransmitter (acetylcholine esterase) activities were significant inhibited (p < 0.01) with exposure to Zn-NPs and Zn-NPs-T and digestive enzymes such as protease and amylase were non-significant (p > 0.01) with the exposure of Zn-NPs and Zn-NPs-T, further, lipase were significantly reduced (p < 0.01) with exposure to Zn-NPs and temperature exposure group. The histopathological alteration were also observed in the liver and gill tissue. The present investigation suggested that, essential trace elements at higher concentration in acute exposure led to pronounced deleterious alteration on histopathology and cellular and metabolic activities in fish. Unlabelled Image • LC 50 of Zn-NPs alone in Pangasianodon hypophthalmus was found to be 21.89 mg/L at 96 h. • LC 50 of Zn-NPs-T was found to be 19.74 mg/L at 96 h. • Zn-NPs alone and with high temperature causes oxidative stress. • Acute exposure of Zn-NPs-T causes neuro-suppressive in Pangasianodon hypophthalmus. [ABSTRACT FROM AUTHOR]

An experiment was designed to delineate the efficacy of a dietary mixture of selenium nanoparticles (Se-NPs) and riboflavin (RF) on the thermal efficiency/tolerance of Pangasianodon hypophthalmus reared under arsenic (2.8 mg/L) and high-temperature (34 °C) stress. A green synthesis method was employed for the synthesis of Se-NPs using fish gills, which are normally discarded as by-products. Four isocaloric and iso-nitrogenous experimental diets were used, namely, a control diet (Se-NPs and RF @ 0 mg/kg diet) and diets containing RF @ 5, 10 or 15 mg/kg diet and Se-NPs @ 0.5 mg/kg diet, and feeding was performed for 95 days. At the end of the feeding trial, the thermal tolerance was evaluated by determination of the following parameters: critical thermal minimum (CTMin), lethal thermal minimum (LTMin), critical thermal maximum (CTMax), and lethal thermal maximum (LTMax). The anti-oxidative status in the form of catalase (CAT), glutathione-s-transferase (GST) and glutathione peroxidase (GPx) activities was significantly (p < 0.01) enhanced upon concurrent exposure to arsenic and high temperature at LTMin and LTMax, whereas a non-significant (p > 0.05) change in superoxide dismutase (SOD) activity was observed in the brain at LTMin and brain, gill and kidney at LTMax. Supplementation with Se-NPs @ 0.5 mg/kg diet and RF @ 5, 10 or 15 mg/kg diet significantly (p < 0.01) improved the anti-oxidative status with or without stressors. AChE activity in the brain was significantly (p < 0.01) inhibited upon concurrent exposure to arsenic and high temperature and improved in the treatment group supplemented with Se-NPs and RF. The arsenic concentration in muscle and experimental water and Se concentration in muscle and experimental feed were analysed. Overall, the results indicated that supplementation with RF @ 5 mg/kg diet and Se-NPs @ 0.5 mg/kg diet could confer protection to the fish against arsenic and thermal stress and led to enhanced thermal efficiency/tolerance of P. hypophthalmus. • Dietary Se-NPs and RF have synergistic effect on thermal tolerance of fish. • CTmin and LTmin were significantly enhanced with dietary Se-NPs and RF in fish. • CTmax and LTmax were also significantly enhanced with dietary Se-NPs and RF in fish. • Se-NPs and RF also protects against oxidative and cellular metabolic stress to fish. [ABSTRACT FROM AUTHOR]

• The lethal concentration of As in P. hypophthalamus was found to be 28.61 mg/L. • The LC 50 of As and high temperature in P. hypophthalamus was found to be 26.88 mg/L. • Acute As and high temperature exposure causes generation of ROS. • Exposure to arsenic and high temperature causes neurosuppressive of AChE. The water bodies are greatly influenced by heavy metal contamination and global increasing temperature. Arsenic (As) is one of the most dangerous widespread pollutants that pose health threats to human, animals and fishes. Considering the above, the study has been carried out to delineate 96 h median lethal concentration of arsenic alone and in combination with high temperature (As-T, 34 °C) by conducting static non-renewable bio-assay acute toxicity in Pangasianodon hypophthalmus (average weight 6.25 ± 0.69 g, length 5.32 cm). Effect of definitive doses such as 25, 26, 27, 28, 29 and 30 mg/L of As alone and in combination with high temperature (As-T) were evaluated on stress biomarkers and cellular metabolism of P. hypophthalmus. The lethal concentration (96 h LC 50) of As alone and in combination with high temperature was found to be 28.16 mg/L and 26.88 mg/L, respectively. The stress biomarkers in terms of catalase, superoxide dismutase (SOD) and glutathione-s-transferase (GST) in liver, gill, brain and kidney, blood glucose and NBT were remarkable higher (p < 0.01) in comparison to unexposed group (control group). Brain neurotransmitter enzyme, AChE, immunological status (blood glucose and NBT) and cellular metabolic enzymes (lactate dehydrogenase LDH, malate dehydrogenase MDH, aspartate aminotransferase AST, and alanine aminotransferase ALT, glucose-6-phosphate dehydrogenase G6PDH and ATPase) were noticeably (p < 0.01) altered by As and As-T exposure. The histopathological study exhibited devastating changes with exposure to As and As-T such as bile stagnation, hepatocyte with irregular nucleus, eosinophilic granules in the cytoplasm, necrosis, and nuclear hypertrophy in liver and curling of secondary lamellae, hypertrophy of lamellar epithelium, blood congestion, incomplete fusion of secondary lamellae, complete fusion of several lamellae and aneurysm in gill. Overall results clearly indicate that acute exposure of As and high temperature led to pronounced deleterious alterations on stress biomarkers and cellular and metabolic activities of P. hypophthalmus. [ABSTRACT FROM AUTHOR]

Direction selectivity is a fundamental feature in the visual system. In the retina, direction selectivity is independently computed by ON and OFF circuits. However, the advantages of extracting directional information from these two independent circuits are unclear. To gain insights, we examined the ON-OFF direction-selective ganglion cells (DSGCs), which recombine signals from both circuits. Specifically, we investigated the dendritic architecture of these neurons with the premise that asymmetries in architecture will provide insights into function. Scrutinizing the dendrites of dye-filled ON-OFF DSGCs reveals that the OFF arbors of these neurons are substantially denser. The increase in density can be primarily attributed to the higher branching seen in OFF arbors. Further, analysis of ON-OFF DSGCs in a previously published serial block-face electron microscopy dataset revealed that the denser OFF arbors packed more bipolar synapses per unit dendritic length. These asymmetries in the dendritic architecture suggest that the ON-OFF DSGC preferentially magnifies the synaptic drive of the OFF pathway, potentially allowing it to encode information distinct from the ON pathway., (© 2025 Wiley Periodicals LLC.)

Cis-regulatory changes are key drivers of adaptative evolution. However, their contribution to the metabolic adaptation of organisms is not well understood. Here, we used a unique vertebrate model, Astyanax mexicanus-different morphotypes of which survive in nutrient-rich surface and nutrient-deprived cave waters-to uncover gene regulatory networks underlying metabolic adaptation. We performed genome-wide epigenetic profiling in the liver tissues of Astyanax and found that many of the identified cis-regulatory elements (CREs) have genetically diverged and have differential chromatin features between surface and cave morphotypes, while retaining remarkably similar regulatory signatures between independently derived cave populations. One such CRE in the hpdb gene harbors a genomic deletion in cavefish that abolishes IRF2 repressor binding and derepresses enhancer activity in reporter assays. Selection of this mutation in multiple independent cave populations supports its importance in cave adaptation, and provides novel molecular insights into the evolutionary trade-off between loss of pigmentation and adaptation to food-deprived caves., (© 2022. The Author(s), under exclusive licence to Springer Nature America, Inc.)

Staphylococcus aureus is one of the most prevalent pathogens, and a causative agent of a variety of infections in humans and animals. Most studies concentrated on characterization of staphylococcus isolates and its antimicrobial resistance from various illness of veterinary importance, but there is no specific study that is available on isolates from reproductive tract of small ruminants and especially its semen. Hence, in the current study, a total of 48 semen samples were collected from healthy bucks of different breeds to investigate the occurrence of S. aureus. Antimicrobial resistance and virulence of the Staphylococcus isolates were determined to assess the adverse effects of them on buck fertility. The bacterial isolates were tentatively confirmed as Staphylococcus spp. based on the Gram's staining, growth on Mannitol salt agar and catalase test. Overall, 75% (n = 36) of the samples were positive for Staphylococcus spp. from the total 48 buck semen ejaculates from different breeds and among them 23 (63.89%) were coagulase-negative (CoNS) and 13 (36.11%) were coagulase-positive Staphylococcus (CoPS) strains. The species identified by molecular characterization are S. aureus, S. chromogenes, S. haemolyticus, S. sciuri, S. simulans, and S. epidermidis from buck semen. Further, these isolates exhibited varying degrees of multidrug resistance genotypically as well as phenotypically. The presence of antibiotic resistance and virulence genes may pose a potential threat to reproductive health of animals, the animal handlers and livestock keepers, while simultaneously highlighting the need for vigilant monitoring of these isolates at the time of semen cryopreservation., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

In the present scenario of climate change with constantly increasing CO 2 concentration, there is a risk of altered crop performance in terms of growth, yield, grain nutritional value and seed quality. Therefore, an experiment was conducted in open top chamber (OTCs) during 2017-18 and 2018-19 to assess the effect of elevated atmospheric carbondioxide (e[CO 2 ]) (600 ppm) on chickpea ( cv. JG 14) crop growth, biomass accumulation, physiological function, seed yield and its quality in terms of germination and vigour. The e[CO 2 ] treatment increased the plant height, leaf and stem biomass over ambient CO 2 (a[CO 2 ]) treatment. The e[CO 2 ] increased seed yield by 11-18% which was attributed to an increase in the number of pods (6-10%) and seeds plant -1 (8-9%) over a[CO 2 ]. However, e[CO 2 ] reduced the seed protein (7%), total phenol (13%) and thiobarbituric acid reactive substances (12%) and increased the starch (21%) and water uptake rate as compared to seeds harvested from a[CO 2 ] environment. Exposing chickpea plant to e[CO 2 ] treatment had no impact on germination and vigour of the harvested seeds. Also, the physical attributes, total soluble sugar and antioxidant enzymes activities of harvested seeds were comparable in a[CO 2 ] and e[CO 2 ] treatment. Hence, the experimental findings depict that e[CO 2 ] upto 600 ppm could add to the growth and productivity of chickpea in a sub-tropical climate with an implication on its nutritional quality of the produce., Competing Interests: Conflict of interestThe authors report no any conflict of interest., (© Prof. H.S. Srivastava Foundation for Science and Society 2021.)

Background: Chickpea (Cicer arietinum L.) is the second most widely grown pulse and drought (limiting water) is one of the major constraints leading to about 40-50% yield losses annually. Dehydration responsive element binding proteins (DREBs) are important plant transcription factors that regulate the expression of many stress-inducible genes and play a critical role in improving the abiotic stress tolerance. Transgenic chickpea lines harbouring transcription factor, Dehydration Responsive Element-Binding protein 1A from Arabidopsis thaliana (AtDREB1a gene) driven by stress inducible promoter rd29a were developed, with the intent of enhancing drought tolerance in chickpea. Performance of the progenies of one transgenic event and control were assessed based on key physiological traits imparting drought tolerance such as plant water relation characteristics, chlorophyll retention, photosynthesis, membrane stability and water use efficiency under water stressed conditions., Results: Four transgenic chickpea lines harbouring stress inducible AtDREB1a were generated with transformation efficiency of 0.1%. The integration, transmission and regulated expression were confirmed by Polymerase Chain Reaction (PCR), Southern Blot hybridization and Reverse Transcriptase polymerase chain reaction (RT-PCR), respectively. Transgenic chickpea lines exhibited higher relative water content, longer chlorophyll retention capacity and higher osmotic adjustment under severe drought stress (stress level 4), as compared to control. The enhanced drought tolerance in transgenic chickpea lines were also manifested by undeterred photosynthesis involving enhanced quantum yield of PSII, electron transport rate at saturated irradiance levels and maintaining higher relative water content in leaves under relatively severe soil water deficit. Further, lower values of carbon isotope discrimination in some transgenic chickpea lines indicated higher water use efficiency. Transgenic chickpea lines exhibiting better OA resulted in higher seed yield, with progressive increase in water stress, as compared to control., Conclusions: Based on precise phenotyping, involving non-invasive chlorophyll fluorescence imaging, carbon isotope discrimination, osmotic adjustment, higher chlorophyll retention and membrane stability index, it can be concluded that AtDREB1a transgenic chickpea lines were better adapted to water deficit by modifying important physiological traits. The selected transgenic chickpea event would be a valuable resource that can be used in pre-breeding or directly in varietal development programs for enhanced drought tolerance under parched conditions.

Oxidative stress is one of the major and continuous stresses, an organism encounters during its lifetime. Tissues such as the brain, liver and muscles are more prone to damage by oxidative stress due to their metabolic activity, differences in physiological and adaptive processes. One of the defence mechanisms against continuous oxidative stress is a set of small heat shock proteins. αB-Crystallin/HSPB5, a small heat shock protein, gets upregulated under stress and acts as a molecular chaperone. In addition to acting as a molecular chaperone, HSPB5 is shown to have a role in other cytoprotective functions such as inhibition of apoptosis, prevention of oxidative stress and stabilisation of cytoskeletal system. Such protection in vivo, at the organism level, particularly in a tissue-dependent manner, has not been investigated. We have expressed HSPB5 in fat body (liver), neurons and specifically in dopaminergic and motor neurons in Drosophila and investigated its protective effect against paraquat-induced oxidative stress. We observed that expression of HSPB5 in neurons and fat body confers protection against paraquat-induced oxidative stress. Expression in dopaminergic neurons showed a higher protective effect. Our results clearly establish the protective ability of HSPB5 in vivo; the extent of protection, however, varies depending on the tissue in which it is expressed. Interestingly, neuronal expression of HSPB5 resulted in an improvement in negative geotropic behaviour, whereas specific expression in muscle tissue did not show such a beneficial effect.

Climate change impact has disturbed the rainfall pattern worsening the problems of water availability in the aquatic ecosystem of India and other parts of the world. Arsenic pollution, mainly through excessive use of groundwater and other anthropogenic activities, is aggravating in many parts of the world, particularly in South Asia. We evaluated the efficacy of selenium nanoparticles (Se-NPs) and riboflavin (RF) to ameliorate the adverse impacts of elevated temperature and arsenic pollution on growth, anti-oxidative status and immuno-modulation in Pangasianodon hypophthalmus. Se-NPs were synthesized using fish gill employing green synthesis method. Four diets i.e., Se-NPs (0 mg kg -1 ) + RF (0 mg kg -1 ); Se-NPs (0.5 mg kg -1 ) + RF (5 mg kg -1 ); Se-NPs (0.5 mg kg -1 ) + RF (10 mg kg -1 ); and Se-NPs (0.5 mg kg -1 ) + RF (15 mg kg -1 ) were given in triplicate in a completely randomized block design. The fish were treated in arsenic (1/10th of LC 50 , 2.68 mg L -1 ) and high temperature (34 °C). Supplementation of the Se-NPs and RF in the diets significantly (p < 0.01) enhanced growth performance (weight gain, feed efficiency ratio, protein efficiency ratio, and specific growth rate), anti-oxidative status and immunity of the fish. Nitroblue tetrazolium (NBT), total immunoglobulin, myeloperoxidase and globulin enhanced (p < 0.01) with supplementation (Se-NPs + RF) whereas, albumin and albumin globulin (A:G) ratio (p < 0.01) reduced. Stress biomarkers such as lipid peroxidation in the liver, gill and kidney, blood glucose, heat shock protein 70 in gill and liver as well as serum cortisol reduced (p < 0.01) with supplementation of Se-NPs and RF, whereas, acetylcholine esterase and vitamin C level in both brain and muscle significantly enhanced (p < 0.01) in compared to control and stressors group (As + T) fed with control diet. The fish were treated with pathogenic bacteria after 90 days of experimental trial to observe cumulative mortality and relative survival for a week. The arsenic concentration in experimental water and bioaccumulation in fish tissues was also determined, which indicated that supplementation of Se-NPs and RF significantly reduced (p < 0.01) bioaccumulation. The study concluded that a combination of Se-NPs and RF has the potential to mitigate the stresses of high temperature and As pollution in P. hypophthalmus.

Symbiotic nitrogen fixation (SNF) of transgenic grain legumes might be influenced either by the site of transgene integration into the host genome or due to constitutive expression of transgenes and antibiotic-resistant marker genes. The present investigation confirmed proper nodulation of five tested Bt-chickpea events (IPCa2, IPCa4, IPCT3, IPCT10, and IPCT13) by native Mesorhizobium under field environment. Quantitative variations for nodulation traits among Bt-chickpea were determined and IPCT3 was found superior for nodule number and nodule biomass. Diversity, as well as richness indices, confirmed the changes in bacterial community structure of root and root-nodules from Bt-chickpea events IPCa2 and IPCT10. Especially, Gram-positive bacteria belonging to Firmicutes and Actinobacteria were selectively eliminated from root colonization of IPCa2. Richness indices (CHAO1 and ACE) of the root-associated bacterial community of IPCa2 was 13-14 times lesser than that of parent cv DCP92-3. Root nodule associated bacterial community of IPCT10 was unique with high diversity and richness, similar to the roots of non-Bt and Bt-chickpea. It indicated that the root nodules of IPCT10 might have lost their peculiar characteristics and recorded poor colonization of Mesorhizobium with a low relative abundance of 0.27. The impact of Bt-transgene on bacterial community structure and nodulation traits should be analyzed across the years and locations to understand and stabilize symbiotic efficiency for ecosystem sustainability.

The present study aimed to detect the marker-trait association of a selected diverse panel of 127 mungbean genotypes against mungbean yellow mosaic India virus (MYMIV). Virus-specific primers pairs viz., AC-abut/AV-abut and BC-abut/BV-abut confirmed the involvement of MYMIV in yellow mosaic disease development and the same was validated through restriction digestion analysis. 256 genome-wide microsatellite markers were screened on a test panel in which 93 polymorphic markers were used in association studies. Population structure analysis led to formation of six distinct subpopulations. 1097 alleles were detected among 127 test genotypes whereas number of alleles ranged 2-22 and PIC values ranged 0.27-0.92%, indicating ample amount of variation at genome level. 15 microsatellite markers were detected as associated with MYMIV resistance, among them three microsatellites explained 11-14% phenotypic variation. The specific regions close to CEDG293, DMB-SSR008 and DMB-SSR059 associated with MYMIV resistance were detected, located on linkage group 2, 4 and 9 and may prove useful in marker-assisted mungbean improvement programme for enhancing MYMIV resistance., Competing Interests: Conflict of interestIt is to declare that there is no conflict of interest between the co-authors., (© King Abdulaziz City for Science and Technology 2020.)

Global warming due to increasing temperature and contamination in aquatic environment has been found to be inducing cellular metabolic stress in fish. The present study focused on temperature and contamination in aquatic ecosystems and its alleviation/mitigation. Hence, this study was conducted to evaluate the role of zinc to improve growth performance, cellular metabolic stress, and digestive enzymes of the Pangasianodon hypophthalmus reared under lead (Pb) and high temperature. Two hundred and seventy-three fishes were distributed randomly into seven treatments, each with three replicates. Three isocaloric and isonitrogenous diets with graded levels of zinc at 0 mg/kg, 10 mg/kg, and 20 mg/kg were prepared. The Pb in treated water was maintained at the level of 1/21th of LC 50 (4 ppm) and maintained at a temperature of 34 °C in exposure groups. The growth performance in terms of weight gain (%), protein efficiency ratio (PER), and specific growth rate (SGR) was found to be inhibited, and the feed conversion ratio (FCR) was enhanced in the Pb and high temperature-exposed group, whereas zinc supplementation has improved weight gain (%), FCR, PER, and SGR. The liver, gill, muscle, and kidney tissues of carbohydrate metabolic enzymes (LDH and MDH), protein metabolic enzymes (ALT and AST), and liver, gill, and muscle G6PDH and ATPase as well as intestinal digestives enzymes (proteases, amylase, and lipase) and intestinal ALP were significantly affected (p < 0.01) by Pb and high temperature exposure to P. hypophthalmus. We herein report the role of zinc in mitigating cellular metabolic stress in fish exposed to Pb and high temperature.

The present study delineate the various biochemical and histopathological tool to evaluate as strong biomarker in the field condition for detection of the least and maximize level of pollution and contamination. We have collected Labeo rohita from 13 different sites from East Kolkata wetland to determine biochemical and histopathological status to analyse metal contamination in the significant biological hot spot EKW. The biochemical marker as antioxidative status, i.e., catalase, superoxide dismutase (SOD), and glutathione-S-transferase (GST) in liver and gill, were remarkably higher (p < 0.01) at some of the sampling sites, but catalase in brain, SOD in kidney, GST in brain and kidney, and neurotransmitter as acetylcholine esterase (AChE) in brain were not significant (p > 0.05) among the sampling sites. The glycolytic enzymes, such as lactate dehydrogenase (LDH) and malate dehydrogenase (MDH) in liver, gill, and muscle, and protein metabolic enzymes, such as alanine amino transferase (ALT) and aspartate amino transferase (AST) in liver, gill, muscle, and kidney, were noticeably higher (p < 0.01) at some of the sampling sites. The histopathology of the liver and gill were altered at different sampling sites, such as blood congestion, leucocyte infiltration with parenchymal vacuolisation, nucleus with blood vessels, hepatocytes granular degeneration, haemorrhage, karyorrhexis, shrink nucleus, and pyknotic nuclei in liver. In the gill, structural changes, such as complete destruction and shortening of secondary gill lamellae, blood vessel in gill arch, curling of secondary gill lamellae, aneurism in gill lamellae, and neoplasia, were observed. Most of the metals were found within the safe limit all along the 13 sampling sites, indicating that fishes are safe for the consumption. Based on our finding, we could recommend that a rational application of biochemical profiles, such as oxidative and metabolic stress parameters, including histopathology to be used as biomarkers for biomonitoring the metal contamination in the aquatic environment.

The present investigation aims to study role of dietary selenium (Se) on growth performance, oxidative stress markers (catalase, superoxide dismutase and glutathione-s-transferase), stress biomarkers [blood glucose, cortisol and heat shock protein (HSP 70) and immunological status, Nitro blue tetrazolium (NBT), total protein, albumin, globulin, A/G ratio, total immunoglobulin and vitamin C] and survival of fish after Aeromonas veronii biovar sobria challenged. Pangasianodon hypophthalmus was treated with lead (Pb, 4 ppm), and high temperature (34 °C) for 60 days. The growth performance was reduced with declined in feed intake, growth rate and feed efficiency in case of group exposed with Pb alone and concurrent exposure to Pb high temperature (34 °C). The Se has immunomodulatory properties however, supplementation of the dietary Se @ 1 and 2 mg/kg diet has been realistically improved growth performance up to 240%, elevated antioxidative status in different tissues, and immunological status were also improved significantly in the P. hypophthalmus. The bacterial challenged with A. veronii biovar sobria in the P. hypophthalmus resulting in less cumulative mortality (%) and high relative (%) survival has been observed with supplementation of dietary Se @ 1 and 2 mg/kg diet. The bioaccumulation of Pb in muscle tissue has been also drastically reduced with supplementation of dietary Se in feed. Hence, overall results indicated that, dietary Se @ 1 and 2 mg/kg have ability to enhanced overall performance and alleviated multiple stresses in P hypophthalmus., (Copyright © 2018 Elsevier Ltd. All rights reserved.)

Zinc is one of the essential micronutrients that can be obtained via water and diet in aquatic animals to meet their physiological needs. The present study was designed to understand the effect of the supplementation of zinc nanoparticles (Zn-NPs) in mitigating abiotic and biotic stress in Pangasius hypophthalmus. Two zinc nanoparticle-incorporated diets with 10 and 20 mg/kg nanoparticles and a control without zinc nanoparticles were formulated. To study the effect of formulated feeds on stress tolerance, fish were exposed to sublethal dose (4 ppm) of Pb (lead) and temperature at 34 °C. Two hundred and seventy-three fish were randomly distributed into seven treatment groups in triplicates, namely a control group (no Zn-NPs and no Pb and temperature exposure, Ctr/Ctr), control diet fed and exposed to Pb (Ctr/Pb), control diet fed and concurrently exposed to Pb and temperature (Pb-T/Ctr), and Zn-NPs 10 and 20 mg/kg diet with or without stressors (Zn-NPs 10 mg/kg, Zn-NPs 20 mg/kg, Pb-T/Zn-NPs 10 mg/kg, Pb-T/Zn-NPs 20 mg/kg). The effect of Zn-NPs on growth performance, stress biomarkers, biochemical and immunological responses, and survival of P. hypophthalmus following challenge with pathogenic bacteria were evaluated. The growth performance was noticeably (p < 0.01) enhanced, and anti-oxidative stress (catalase, superoxide dismutase, and glutathione-s-transferase) significantly reduced in the Zn-NPs supplemented groups. Similarly, immunological parameters such as total protein, albumin, globulin, and A/G ratio significantly improved, and stress biomarkers such as blood glucose, cortisol, and HSP 70 were reduced in Zn-NPs supplemented groups. Overall, the results suggest that supplementation of dietary Zn-NPs with less concentration in the diet has a definitive role in the mitigation of abiotic and biotic stress in P. hypophthalmus.

Unexpected fluctuations in weather parameters due to global climate change have been observed in all ecosystems worldwide. The aquatic ecosystem shelters a great diversity of fishes in the upper region of the ecosystem which adversely get affected due to their poikilothermic nature. The present study was designed to elucidate the impact of critical temperature minima (CTMin), lethal temperature minima (LTMin), critical temperature maxima (CTMax), and lethal temperature maxima (LTMax) on Channa striatus. Biologically synthesized silver nanoparticles (Ag-NPs) were evaluated for their potential to enhance thermal tolerance and improve the activities of biochemical enzymes of C. striatus reared under lead (Pb) and high temperature (34 °C) for 50 days. Three iso-caloric and iso-nitrogenous diets which included a basal diet and two supplemented diets with Ag-NPs @ 0.5 mg/kg, and 1 mg/kg were used in the study. Results suggested that CTMin and LTMin were significantly (p < 0.01) reduced and CTMax and LTMax were enhanced in the group fed with 0.5 mg/kg Ag-NPs supplemented feed. Pre-exposure to high temperature led to enhanced CTMax and LTMax in C. striatus. The biochemical enzymes involved in protein metabolism, carbohydrate metabolism, acetylcholine esterase and antioxidant activities were found to be normal in fish fed with 0.5 mg/kg Ag-NPs supplemented diet. Bioaccumulation of silver and Pb was determined in different fish tissues and experimental water. Overall, the incorporation of Ag-NPs at 0.5 mg/kg in diet can confer protection to fish against Pb and thermal stress and enhance thermal tolerance of C. striatus., (Copyright © 2018 Elsevier Ltd. All rights reserved.)

Deficiencies of iron (Fe) and zinc (Zn) are major problems in developing countries especially for woman and preschool children. Biofortification of staple food crops is a sustainable approach to improve human mineral intake via daily diet. Objectives of this study were to (1) determine the genetic variability for Fe and Zn content in cultivated indigenous and exotic lentil genotypes, and (2) determine the effect of genetic (G) × environmental (E) interaction on Fe and Zn content in 96 lentil genotypes grown in India over the 2 years. Significant genetic variability was observed for Fe and Zn content in lentil genotypes. Content ranged from 71.3 to 126.2 mg/kg for Fe, and 40.1 to 63.6 mg/kg for Zn. For Fe, cultivars and parental lines (71.3-126.2 mg/kg) showed slightly higher content than the breeding lines (76.8-124.3 mg/kg). For Zn, content were similar for both cultivars and breeding lines. However, year and the genotype × year interaction were significant for both Fe and Zn. Broad sense heritability estimates were found to be 45.8, 45.4 and 40.1 for Fe; 30.0, 63.0 and 69.0 for Zn content in breeding lines, cultivars/parental lines, and exotic lines, respectively. These heritability estimates indicated the potential of these lentil genotypes towards genetic improvement for increased Fe and Zn content using hybridization and selection over several generations. Significant positive correlation of Fe content and seed weight suggested a selection strategy for developing large seeded lentil for accumulation of more Fe in the seeds. No correlation was observed between Fe and Zn content. Further, recombination of Fe and Zn content is possible by developing recombination breeding. Thus present study findings would be useful in future for mapping and tagging the genes/QTL controlling Fe and Zn content and developing the improved biofortified cultivars.

Nanotechnology is a novel arena with promising applications in the field of medicine, industry, and agriculture including fisheries. Cross-disciplinary interactions and the application of this technology in biological systems have led to the innovation of novel nanoparticle antioxidants, which are the subject of our study. In context with above background, we designed an experiment on nano-silver to elucidate its role for mitigation of abiotic and biotic stress. Three diets were formulated viz. silver nanoparticles (Ag-NPs) incorporated at 0.5 and 1 mg/kg diet and control diet (Ag-NPs at 0 mg/kg). Fish were exposed to sublethal level of 1/25th of LC 50 (4 ppm) of lead (Pb) and temperature at 34 °C. The effect of Ag-NPs on productive performance (weight gain %, feed conversion ratio, protein efficiency ratio, and specific growth rate), stress biomarkers (catalase, super oxide dismutase, glutathione-s-transferase, acetylcholine esterase, cortisol, heat shock protein), biochemical and immunological response (protein and carbohydrate metabolic enzymes, phagocytic activity, serum total protein and albumin: globulin ratio), histopathology alterations in the liver and gill as well as survival of Channa striatus, following challenge with pathogenic bacteria were evaluated. Dietary Ag-NPs at 0.5-mg supplementation improved growth performance, immunity, survival, and reduced stress biomarker such as HSP 70, cortisol, and blood glucose in various fish tissues. Exposure to Pb and high temperature and group fed with Ag-NPs (1 mg/kg diet) demonstrated remarkable changes in the histo-architect of liver such as pyknotic nuclei, pyknosis, leucocyte infiltration, hemorrhage and karyokinesis, blood vessels with nucleated, lipid vacuoles in the liver tissue. Histology of gill displayed hyperplasia, aneurism, blood congestion, severe telengiectiasis, epithelial lifting, curling of secondary lamella, hyperplasia of epithelial cell of secondary lamella in the group exposed to lead and high temperature and supplemented with Ag-NPs at 1 mg/kg diet. In addition to histopathology, feeding with Ag-NPs at 1 mg/kg diet deteriorated and altered all studied parameters including reduced growth performance. Results obtained in the present study suggest that supplementation of Ag-NPs at 0.5 mg/kg diet has a definitive role to play in the mitigation of abiotic and biotic stress in C. striatus.

Recent studies have demonstrated that selenium (Se) and selenium nanoparticles (Se-NPs) exhibited toxicity at a higher concentration. The lethal concentration of Se and Se-NPs was estimated as 5.29 and 3.97 mg/L at 96 h in Pangasius hypophthalmus. However, the effect of different definite concentration of Se (4.5, 5.0, 5.5, and 6.0 mg/L) and Se-NPs (2.5, 3.0, 3.5, and 4.0 mg/L) was decided for acute experiment. Selenium and Se-NPs alter the biochemical attributes such as anti-oxidative status [catalase (CAT), superoxide dismutase (SOD), and glutathione-S-transferase (GST) activities], neurotransmitter enzyme, cellular metabolic enzymes, stress marker, and histopathology of P. hypophthalmus in a dose- and time-dependent manner. CAT, SOD, and GST were significantly elevated (p < 0.01) when exposed to Se and Se-NPs, and similarly, a neurotransmitter enzyme (acetylcholine esterase (AChE)) was significantly inhibited in a time- and dose-dependent manner. Further, aspartate aminotransferase, alanine aminotransferase, lactate dehydrogenase, and malate hydrogenase were noticeably (p < 0.01) affected by Se and Se-NPs from higher concentration to lower concentration. Stress markers such as cortisol and HSP 70 were drastically enhanced by exposure to Se and Se-NPs. All the cellular metabolic and stress marker parameters were elevated which might be due to hyperaccumulation of Se and Se-NPs in the vital organ and target tissues. The histopathology of liver and gill was also altered such as large vacuole, cloudy swelling, focal necrosis, interstitial edema, necrosis in liver, and thickening of primary lamellae epithelium and curling of secondary lamellae due to Se and Se-NP exposure. The study suggested that essential trace element in both forms (inorganic and nano) at higher concentration in acute exposure of Se and Se-NPs led to pronounced deleterious alteration on histopathology and cellular and metabolic activities of P. hypophthalmus.

In the bithorax complex of Drosophila melanogaster, the chromatin boundary elements (BE) demarcate cis-regulatory domains that regulate Hox genes along the anteroposterior body axis. These elements are closely associated with the Polycomb Response Elements (PREs) and restrict the ectopic activation of cis-regulatory domains during development. The relevance of such specific genomic arrangements of regulatory elements remains unclear. Deletions of individual BE-PRE combination result in distinct homeotic phenotypes. In this study, we show that deletion of two such BE-PRE combinations in cis leads to new genetic interactions, which manifests as dorsal closure defect phenotype in adult abdominal epithelia. We further demonstrate that dorsal closure phenotype results from enhanced and ectopic expression of Hox gene Abd-B in the larval epithelial cells. This suggests a specific role of multiple BE-PRE combinations in the larval epithelial cells for regulation of Abd-B. Using chromosome conformation capture experiments, we show that genetic interactions correlate with direct physical interactions among the BE-PRE combinations. Our results demonstrate the functional relevance of the closely associated BE and PRE combinations in regulation of Hox genes., (Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.)