Search

Abstract Background Runt-related transcription factor 1 (RUNX1) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters and can accelerate apoptosis in various tumors. However, the regulatory mechanisms underlying RUNX1 expression in neuroblastoma (NB), a highly malignant tumor in childhood, remain largely unclear. In this study, we aimed to assess the role of RUNX1 in NB and to reveal the underlying mechanisms that may contribute to finding a potential therapeutics strategy against NB. Methods Growth, invasion, metastasis and angiogenesis were assessed using Cell Counting Kit-8 (CCK-8) immunocytochemistry, and studies involving soft agar, cell invasion, tube formation and whole animals. The levels of expression were measured using real-time quantitative PCR for RNA, Western blot and immunostaining analyses for proteins. Luciferase reporter and chromatin immunoprecipitation assays indicated that RUNX1 directly binds within the BIRC5, CSF2RB and NFKBIA promoter regions to facilitate transcription. The level of apoptosis was assessed by determining mitochondrial membrane potential and flow cytometry. Results RUNX1 was highly expressed in ganglioneuroma (GN) and well-differentiated (WD) tissues relative to the poorly differentiated (PD) and undifferentiated (UD) ones. Moreover, RUNX1 effectively reduced cell viability, invasion, metastasis, angiogenesis, and promoted apoptosis in vitro and in vivo. RUNX1 reduced BIRC5 transcription and increased CSF2RB and NFKBIA transcription by directly binding BIRC5, CSF2RB and NFKBIA promoters. In addition, cytotoxic drugs, especially cisplatin, significantly increased RUNX1 expression in NB cells and promoted apoptosis. Conclusions These data show that RUNX1 is an independent surrogate marker for the progression of NB and it can be used for monitoring NB prognosis during therapy.

Abstract Background Various guidelines recommend that all adults diagnosed with type 1 diabetes (T1D) should be offered an evidence based, structured education programme (SEP) to optimize self-management care. China has a 13,000 annual increase in newly diagnosed T1D cases, of which 65% are adults. However, there is yet no validated SEP targeted to T1D patients in China. The purpose of this study is to establish a structured T1D self-management education programme—‘Type 1 Diabetes Education in Lifestyle and Self Adjustment’ (TELSA) that is adapted to medical and cultural practices in China. Methods TELSA programme was developed based on the ADDIE model, following three steps: i) Semi-structured interviews were administered to 10 healthcare professionals (HCPs) and 13 T1D patients. Different topic guides, focusing on 4 dimensions including goals, contents, format of delivery, and quality assurance, were designed for either HCPs or patients. The interviews were recorded and analysed with thematic analysis. ii) Extracted themes were modified according to Delphi consultation. iii) Preliminary courses were conducted as pilot study to evaluate the effects of TELSA and optimization of the curriculum was finalized accordingly. Results A total of 18 themes in 4 dimensions of the programme design were identified in the final version: i) goals: ‘behaviour modification’ and ‘outcome improvement’; ii) contents: ‘living with T1D’, ‘self-monitoring of blood glucose’, ‘knowing insulin’, ‘insulin dose adjustment’, ‘carbohydrates and carbohydrate counting’, ‘hypoglycaemia’, ‘complications of diabetes’, ‘managing psychological issues’, ‘physical activity’, and ‘question-and-answer’; iii) format: ‘multidisciplinary team combined with peer support’, ‘face-to-face education followed by remote learning’, and ‘2-day programme held on weekends’; and iv) quality assurance: ‘after-class quiz’, ‘patients’ feedback’, and ‘long-term evaluation on effectiveness’. Conclusions A type 1 diabetes structured education programme in China was set up and shown to be applicable under local medical, social, and cultural environment. Trial registration NCT03610984. Date of registration: August 2, 2018.

Abstract Background The loss of functional ability of patients after stroke is mostly caused by dysfunction of the upper limbs, especially the hands. Hand functional exercise is the premise of alleviating hand dysfunction, and the relief of hand spasm is the basis of timely and effective hand functional exercise. Previous clinical observation have shown that fascial-point needling can effectively alleviate hand spasm immediately after stroke, but further evidence from large-sample studies is needed. The overall objective of this trial is to further evaluate the clinical efficacy of fascial-point acupuncture on hand spasm after stroke. Methods/design This multicenter randomized controlled trial will compare the efficacy of fascial-point acupuncture versus sham acupuncture and routine rehabilitation therapy in stroke patients with hand spasm. Patients will be randomized to undergo either the fascial-point acupuncture, the sham acupuncture or the control (routine rehabilitation therapy). We will recruit 210 stroke inpatients who meet the trial criteria and observe the remission of hand spasm and improvement of limb function after 4 weeks of intervention. The first evaluation indices are the remission of hand spasm and the duration of spasm remission. The second evaluation indices are the hand function of the affected limbs and the activities of daily living. When the accumulative total number of cases included reaches 120, a mid-term analysis will be conducted to determine any evidence that experimental intervention does have an advantage. Discussion Our aim is to evaluate the efficacy of fascial-point acupuncture in relieving hand spasm after stroke. The results should provide more evidence for the clinical application of this therapy in the future. Trial registration Chinese Clinical Trial Registry (ChiCTR), ID: ChiCTR1900022379. Registered on 9 April 2019

This paper proposes a novel hybrid secure method based on improved deoxyribonucleic acid (DNA) encoding encryption and spiral scrambling in chaotic OFDM-PON for enhancing the physical-layer security. In the improved DNA encoding encryption, the odd-even cross-bit DNA encoding, base scrambling and base-level substitution are determined by chaotic sequences. For each binary and base, the selected encoding rules and base scrambling methods are dynamically changing, which enhances the robustness against malicious attacks by attackers. In the spiral scrambling process, the QAM symbol matrix is divided into several blocks, and these blocks are scrambled. In the scrambling of the plural matrix, the position where the spiral starts and the orientation and direction of the traversal are also controlled by the chaotic sequences. By employing DNA encoding encryption and spiral scrambling, a key space of ~10135 can be achieved in the multi-fold encryption of the proposed scheme, which can improve the physical-layer security. The encrypted 16-QAM OFDM data are successfully transmitted over a 60-km SSMF in OFDM-PON. The simulation results demonstrate that it has better BER performance at the BER of 10-3 than other schemes. The proposed encryption method can effectively protect data from attacks by eavesdroppers or illegal users.

Grid cells are important neurons related to spatial cognition and navigation in the animal brain and can respond to both external information and self-motion information. The existing models simulated these two types of responses separately, but how to simultaneously develop the two types of connection to respond to the different information has not been simulated. In this paper, first, we develop the connections from place cells to grid cells through improved nonnegative principal component analysis. Then, we construct a continuous attractor network model and an autoencoder network model of grid cell module and convert the parameter learning in the continuous attractor network into weight learning in the autoencoder network. Through parameter learning, the continuous attractor network model can spontaneously generate a hexagonal firing pattern. Ultimately, the grid cell firing fields driven by place cell inputs and self-motion information have the same spacing and direction, which means that the grid cell module can respond the same to these two types of information. This model can provide a reference for the construction of an unmanned agent brain-inspired navigation system.

The nonlinear Lane-Emden type equation can be used to describe many physical phenomena. To solve this type of equation, a method based on deep neural network is proposed. The output layer of this network has two layers, the last one of which scaling the outputs of their neighbors with an aim at coping with issues where the values of function to be approximated are much less or larger than the order of 1. The Lane-Emden equation and its initial conditions are employed to construct the loss function, and the problem of solving Lane-Emden equation is transformed into an optimization problem. A hybrid method combined Adam and L-BFGS-B methods is used to solve the optimization problem and consequently the Lane-Emden type equation is solved. To increase the accuracy, an adaptive strategy is incorporated into the training data sampling method. Especially, a strategy in coping with the issue about solving white-dwarf problem is proposed. Numerical experiments are conducted in which reference solutions including analytical solutions and numerical solutions given by Runge-Kutta method are used to verify the effectiveness of our proposed method. More importantly, the solutions over large domains are calculated by the use of the proposed method. The results show that the results given by our method are in good agreement with the reference solutions, and in cases where existent neural-network-based method fails, our method is able to produce convincible results.

For the multi-motor traction finite-time control (FTC) system with input saturation constraints, considering parameter simplification of “adding a power integrator” (AAPI) and anti-windup (AW), a total-amount coordinated tracking control (TACTC) strategy based on nonsingular terminal sliding mode (NTSM) is proposed to ensure the global finite-time stability and effectively reduce energy consumption. First, a traction model of multiple permanent magnet synchronous motors (PMSMs) with uncertain parameter perturbations and external disturbances was established. Next, a finite-time auxiliary AW system was designed and the auxiliary state was fed back to TACTC. Then, the strong constraint of parameters of AAPI was relaxed, the setting rules of the corresponding parameters were given and the proof of finite-time Lyapunov stability was completed. Finally, the excellent performance of parameter simplification of AAPI and the controller was verified by the Matlab/Simuink simulation and RT-Lab semi-physical experiment of the multi-motor traction system, which shows that the control strategy can suppress the input saturation effect in the multi-motor traction system effectively.

Objective: The aim of this study was to investigate the overall distribution of pregnancy outcomes in women with elevated second-trimester maternal serum alpha-fetoprotein (MS-AFP), and to determine the risk of adverse pregnancy outcomes (APOs) by MS-AFP level. Materials and methods: We retrospectively analyzed the clinical data of 429 women with elevated MS-AFP (≥2.5 multiple of the median (MOM)) and 1555 women with normal MS-AFP (0.5–2.49MOM) from a total of 46,741 prenatally screened singleton pregnant women. The overall distribution of APOs of the two groups, the risk of APOs by MS-AFP level, and the predictive value of elevated MS-AFP to APOs were analyzed. Results: The incidence rate of APOs in elevated MS-AFP group was significantly higher than that in normal MS-AFP group (42.89 vs. 8.23%). In elevated MS-AFP group, the top three APOs, in term of incidence rate, were structural fetal abnormalities (7.93%), spontaneous abortion (7.46%) and preterm birth (7.23%); regarding to the risk, the top three APOs were stillbirth, spontaneous abortion and early-onset preeclampsia (odds ratio 35.98, 20.81 and 8.58 respectively). For structural fetal abnormalities, MS-AFP had predictive values for fetal open neural tube defects (ONTDs), gastroschisis and multiple malformations. Conclusion: Elevated MS-AFP is associated with increased risks of APOs. ONTDs complicate merely a small proportion of pregnancies with elevated MS-AFP, and the rest of them have high risks of obstetric complications. MS-AFP can help to identify these women at high risk of APOs in earlier second-trimester. Keywords: Alpha-fetoproteins, Neural tube defects, Pre-eclampsia, Premature birth, Spontaneous abortion, Stillbirth

In this study, a reduced graphene oxide (rGO)@sodium lignosulfonate (NaLS) composite material was fabtricated using a one-step method and then mixed with natural polysaccharide calcium alginate (CaAlg) to prepare the rGO@NaLS/CaAlg pervaporation membrane. The appearance and physical properties of the rGO@NaLS/CaAlg membrane were characterized by scanning electron microscopy and water contact angle. The swelling performance of the membrane and its dehydration performance to organic solvents were evaluated. The results indicate that the addition of rGO@NaLS can increase the hydrophilicity of the rGO@NaLS/CaAlg membrane and reduce its degree of swelling in the ethanol solution. The membrane incorporated with 6 wt% rGO@NaLS exhibits the best pervaporation performance, and ethanol can be purified to 99.8%.

Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase expressed at early stages of normal development and in various cancers including ALK-positive anaplastic large cell lymphoma (ALK+ ALCL), in which it is the main therapeutic target. ALK tyrosine kinase inhibitors (ALK TKIs) have greatly improved the prognosis of ALK+ALCL patients, but the emergence of drug resistance is inevitable and limits the applicability of these drugs. Although various mechanisms of resistance have been elucidated, the problem persists and there have been relatively few relevant clinical studies. This review describes research progress on ALK+ ALCL including the application and development of new therapies, especially in relation to drug resistance. We also propose potential treatment strategies based on current knowledge to inform the design of future clinical trials.

Recent breakthroughs in deep learning-based protein structure prediction show that it is possible to obtain highly accurate models for a wide range of difficult protein targets for which only the amino acid sequence is known. The availability of accurately predicted models from sequences can potentially revolutionise many modelling approaches in structural biology, including the interpretation of cryo-EM density maps. Although atomic structures can be readily solved from cryo-EM maps of better than 4 Å resolution, it is still challenging to determine accurate models from lower-resolution density maps. Here, we report on the benefits of models predicted by AlphaFold2 (the best-performing structure prediction method at CASP14) on cryo-EM refinement using the Phenix refinement suite for AlphaFold2 models. To study the robustness of model refinement at a lower resolution of interest, we introduced hybrid maps (i.e. experimental cryo-EM maps) filtered to lower resolutions by real-space convolution. The AlphaFold2 models were refined to attain good accuracies above 0.8 TM scores for 9 of the 13 cryo-EM maps. TM scores improved for AlphaFold2 models refined against all 13 cryo-EM maps of better than 4.5 Å resolution, 8 hybrid maps of 6 Å resolution, and 3 hybrid maps of 8 Å resolution. The results show that it is possible (at least with the Phenix protocol) to extend the refinement success below 4.5 Å resolution. We even found isolated cases in which resolution lowering was slightly beneficial for refinement, suggesting that high-resolution cryo-EM maps might sometimes trap AlphaFold2 models in local optima.

Hyperoside is a natural flavonol glycoside, which has antioxidation, antitumor, and anticancer activities together with other healthy effects like improving cardiovascular function, protecting the liver, and regulating the immune system. It is a popular compound used in the traditional Chinese medicine and different studies on hyperoside are present in the literature. However, studies on the metabolism of hyperoside in vivo were not comprehensive. In this study, UPLC-Q-Exactive Orbitrap MS technology was used to establish a rapid and comprehensive analysis strategy to explore the metabolites and metabolic process of hyperoside in rats. The metabolites of hyperoside were systematically identified in rat plasma, urine, and feces. According to the hyperoside standard substance and relevant works of literature, a total of 33 metabolites were identified, including 16 in plasma, 31 in urine, and 14 in feces. Among them, the metabolites quercetin and dihydroquercetin were unambiguously confirmed by comparison with standard substances. In addition, 13 metabolites had not been reported in hyperoside metabolism-related articles at present. The metabolic reactions of hyperoside in vivo were further explored, including phase I metabolism (hydroxylation, dehydroxylation, glycoside hydrolysis, hydrogenation, and hydration) and phase II metabolism (methylation, acetylation, sulfation, and glucuronide conjugation). The fragment ions of hyperoside and its metabolites were usually produced by glucoside bond hydrolysis, the neutral loss of (CO + OH), COH, CO, O, and Retro-Diels Alder (RDA) cleavage. In conclusion, this study comprehensively characterized the metabolism of hyperoside in rats, providing a basis for exploring its various biological activities.

Mechanical ventilation is an effective treatment for acute respiratory distress syndrome (ARDS), which can improve the prognosis of ARDS to a certain extent. However, it may further aggravate lung tissue injury, which is defined as ventilator-induced lung injury (VILI). Intermedin (IMD) belongs to the calcitonin gene-related peptide (CPRP) superfamily. Our previous studies have found that IMD reduces the expression proinflammatory cytokines, down-regulates nuclear translocation and improves the integrity of endothelial barrier in ARDS. However, the effect of IMD on VILI has not been clarified. Oxidative stress imbalance and apoptosis are the main pathophysiological characteristics of VILI. In the current study, we used C57B6/J mice and human pulmonary microvascular endothelial cells (HPMECs) to establish a VILI model to analyze the effects of IMD on VILI and explore its potential mechanism. We found that IMD alleviated lung injury and inflammatory response in VILI, mainly in reducing ROS levels, upregulating SOD content, downregulating MDA content, reducing the expression of Bax and caspase-3, and increasing the expression of Bcl-2. In addition, we also found that IMD played its anti-oxidative stress and anti-apoptotic effects via JAK2/STAT3 signaling. Our study may provide some help for the prevention and treatment of VILI.

The Yolov4 detection algorithm does not sufficiently extract local semantic and location information. This study aims to solve this problem by proposing a Yolov4-based multiscale feature fusion detection system for high-speed train wheel tread defects. First, multiscale feature maps are obtained from a feature extraction backbone network. The proposed multiscale feature fusion network then fuses the underlying features of the original three scales. These fused features contain more defect semantic information and location details. Based on the fused features, a path aggregation network is used to fuse feature maps at different resolutions, with an improved loss function that speeds up the convergence of the network. Experimental results show that the proposed method is effective at detecting defects in the wheel treads of high-speed trains.

Due to the large noise and many discrete points of the image in the traditional image reconstruction process, the reconstruction quality of the image deviates greatly from the actual target. In this study, the virtual reality reconstruction algorithm is applied to multimedia vision, the virtual reality image is corrected by using the binocular offset positioning method, the denoising process is performed in the image reconstruction process, and the high-pass filter matrix is used to improve the image reproduction. At the same time, the three-dimensional reconstruction algorithm is used to perform correlation retrieval, the ensemble point set and the discrete point set are obtained, the maximum and minimum reconstruction degree areas are clarified, and the deviation reconstruction and peak relocation can be performed. Finally, the experimental test results show that the algorithm in this study can enhance the authenticity of image reconstruction, improve the accuracy of image corner detection, and effectively reduce the noise interference in the process of reconstructing the image.

Poverty is a primary obstacle to achieving sustainable development. Therefore, exploring the spatiotemporal dynamics and causes of poverty is of great significance to the sustainable poverty reduction of the “post poverty alleviation era” in China. This paper used the multisource big data of 2022 counties in China from 2000 to 2015 to establish a comprehensive evaluation framework to explore the multidimensional poverty situation in China. The results showed the following findings: There is an obvious spatiotemporal heterogeneity of multidimensional poverty, showing a typical stair-like gradient from high in the west to low in the east, with the poverty level in state-designated poverty counties higher and intensifying over time. The spatial differentiation of multidimensional poverty is contributed to by multiple factors, in which the geographical condition has a stronger impact on state-designated poverty counties, while natural endowment and human resources have a stronger effect on non-state-designated poverty counties. These things considered, the regional poverty causes were relatively stable before 2015, but the poverty spatial agglomeration of some regions in the Northwest, Northeast, and Yangtze River Economic Belt has undergone significant changes after 2015. These findings can help policymakers better target plans to eliminate various types of poverty in different regions.

Three-dimensional (3D) geological models are currently needed and used independently for urban development. The main difficulty in constructing a 3D geological model of a shallow subsurface is to determine the stratigraphic distribution. Highly variable properties and geometries of geological units beneath lead to difficulty. It is key to find a practicable and efficient way to construct a model in practical work. This study takes Tongzhou District (Beijing) as a case; 476 boreholes (40 newly drilled and 436 existing engineering boreholes) were utilized combined with the cross-section method to construct an integrated 3D geological model. The framework and analyses contributed to the following applications: (1) High-quality information from new boreholes and existing engineering boreholes were used to define stratigraphy and build cross-sections. (2) The resulting geological model (up to 50 m beneath Tongzhou area) shows many details of the shallow subsurface. This includes 10 major layers which were grouped into three cyclothems representing cyclic sequences of clay, interbedded silt, sand, and gravel with variable quantities of lenses. (3) The new model was used as a tool to visualize the depth and geometry variations below ground and to characterize a large variety of properties (for example, the compression modulus analyzed in this paper) that each unit contains, and then to evaluate the underground geological conditions. (4) An analysis of a dynamic monitoring model based on the resulting 3D model indicated that the geological units (sand and silty clay) at depths between 30 m and 40 m, with an average vertical deformation of 0.97 mm, from July 2019 to September 2020, are suitable for underground construction, from the perspective of vertical stability in the study area. Monitoring models that take time into consideration based on a 3D framework will be further explored.

A series of novel chromophores A, B, C, and D, based on the julolidinyl donor and the tricyanofuran (TCF) and CF3-tricyanofuran (CF3-Ph-TCF) acceptors, have been synthesized and systematically investigated. The 3,5-bis(trifluoromethyl)benzene derivative isolation group was introduced into the bridge in the chromophores C and D. These nonlinear optical chromophores showed good thermal stability, and their decomposition temperatures were all above 220 °C. Density functional theory (DFT) was used to calculate the energy gaps and first-order hyperpolarizability (β). The macroscopic electro-optic (EO) activity was measured using a simple reflection method. The highest EO coefficient of poled films containing 35 wt% of chromophore D doped in amorphous polycarbonate afforded values of 54 pm/V at 1310 nm. The results indicate that the 3,5-bis(trifluoromethyl)benzene isolation group can suppress the dipole–dipole interaction of chromophores. The moderate r33 value, good thermal stability, and good yield of chromophores suggest their potential use in the nonlinear optical area.

Traffic flows (e.g., the traffic of vehicles, passengers, and bikes) aim to reveal traffic flow phenomena generated by traffic participants in traffic activities. Various studies of traffic flows rely heavily on high-quality traffic data. The taxi GPS trajectory data are location data that include latitude, longitude, and time. These data are critical for traffic flow analysis, planning, infrastructure layout, and recommendations for urban residents. A city map can be divided into multiple grids according to the latitude and longitude coordinates, and traffic passenger flows data derived from taxi trajectory data can be extracted. However, random missing data occur due to weather and equipment failure. Therefore, the effective imputation of missing traffic flow data is a hot topic. This study proposes the spatio-temporal generative adversarial imputation net (ST-GAIN) model to solve the traffic passenger flows imputation. An adversarial game with multiple generators and one discriminator is established. The generator observes some components of the time-domain and regional traffic data vector extracted from the grid. It effectively imputes the missing values of the spatio-temporal traffic passenger flow data. The experimental data are accurate Kunming taxi trajectory data, and experimental results show that the proposed method outperforms five baseline methods regarding the imputation accuracy. It is significant and suggests the possibility of effectively applying the model to predict the passenger flows in some areas where traffic data cannot be collected for some reason or traffic data are randomly missing.

Diabetic retinopathy (DR) is one of the most common diabetic complications and remains the leading cause of vision loss among adults. C1q/TNF-related protein 3 (CTRP3) is a member of CTRP family that has been found to be involved in the progression of diabetes mellitus and diabetic complications. However, the role of CTRP3 in DR has not been fully understood. In the present study, the results showed that CTRP3 expression was significantly decreased in DR patients compared with controls. In vitro investigations proved that overexpression of CTRP3 improved cell viability of ARPE-19 cells in response to high glucose (HG) stimulation. CTRP3 also attenuated HG-induced oxidative stress in ARPE-19 cells with decreased levels of reactive oxygen species (ROS) and malondialdehyde (MDA), and increased superoxide dismutase (SOD) activity. Apoptotic rate was significantly decreased in CTRP3 overexpressing ARPE-19 cells. Besides, bcl-2 expression was increased, while bax expression was decreased by CTRP3 overexpression. Moreover, overexpression of CTRP3 enhanced the activation of nuclear factor erythroid 2-related factor 2 (Nrf2)/hemeoxygenase-1 (HO-1) pathway in HG-stimulated ARPE-19 cells, and Nrf2 knockdown reversed CTRP3-mediated oxidative stress and apoptosis. These findings suggested that CTRP3 attenuated HG-stimulated oxidative stress and apoptosis in ARPE-19 cells, which were mediated by activation of Nrf2/HO-1 pathway.

Ammonia nitrogen is a common toxic substance in the aquatic system, which seriously threatens the survival and growth of clams. However, less is known about the ammonia metabolism and detoxification strategy in razor clam. In this study, the polymorphism of the Glutamine synthetase gene from Sinonovacula constricta (Sc-GS) was found to be related to ammonia tolerance. By comparing the coding sequence (CDS) region of Sc-GS from two geographical populations, a total of 14 and 12 single nucleotide polymorphisms (SNPs) were identified, respectively, of which 10 loci were shared between the two populations. Among them, the locus c.1133T > G exhibited an extremely significant and strong association with ammonia tolerance in both populations (P < 0.01), and it was missense mutation, which led to the amino acid change from leucine (Leu) to arginine (Arg). Furthermore, the results about H&E staining and immunohistochemistry of Sc-GS protein in gills and hepatopancreas revealed that it was specifically localized in the lateral cilia of gill filaments and the endothelial cells of hepatocytes. After inhibiting the Sc-GS expression by RNA interference (RNAi) technology, the transcript levels of Sc-GS were extremely significantly downregulated at 24, 48, 72, and 96 h (P < 0.01) in the hepatopancreas. Taken together, these results indicated that the Sc-GS gene may participate in ammonia metabolism. In addition, these results will help to demonstrate the role of Sc-GS in ammonia nitrogen metabolism and provide markers related to ammonia nitrogen tolerance for molecular marker-assisted selection (MAS) of the razor clam.

Neuroblastoma is a primary malignancy mainly occurring in children. We have reported that polymorphisms of several N6-methyladenosine (m6A) RNA modification-related genes contributed to neuroblastoma risk in previous studies. YTHDF2, a “reader” of RNA m6A modification, is involved in cancer progression. Here, we estimated the association between a YTHDF2 gene rs3738067 A>G polymorphism and neuroblastoma susceptibility in 898 neuroblastoma patients and 1,734 healthy individuals from China. We found that the rs3738067 A>G could decrease neuroblastoma risk [AG vs. AA: adjusted odds ratio (OR) = 0.76, 95% confidence interval (CI) = 0.64–0.90, P = 0.002; AG/GG vs. AA: adjusted OR = 0.81, 95% CI = 0.69–0.95, P = 0.011). Besides, the rs3738067 AG/GG genotype was related to reduced neuroblastoma risk in the following subgroups: children aged 18 months and under, boys, patients with tumors originating from retroperitoneal, patients at clinical stage IV, and cases at clinical stages III plus IV. Importantly, false-positive report probability analysis proved our significant results worthy of close attention of. The expression quantitative trait locus analysis results revealed that the rs3738067 was associated with the expression of YTHDF2.

Abstract Background Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α‐thalassemia and two novel cases of β‐thalassemia caused by five different mutations in the globin gene. Methods Next‐generation sequencing (NGS) was used to identify novel α‐ and β‐thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. Results NGS revealed five novel cases of α‐ and β‐thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α‐globin mRNA were analyzed. Conclusion Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.

Poly(I:C) is a kind of chemosynthetic double-stranded RNA (dsRNA) analogue which could act as TLR3 agonist and induce IFN production. It is widely applied in anti-virus treatment and immunoregulation, as well as vaccine adjuvant in farmed animals. However, whether poly(I:C) could activate innate immune response to defense against bacterial infection remains unclear. In this study, we established a feeding trial model with different dose of poly(I:C) in turbot larvae, then challenged with Edwardsiella piscicida after 3–7 weeks resting period. The results show that feeding turbot with poly(I:C) exhibited a stronger inflammatory response and antioxidant stress ability, and significantly elevated the survival rate within the decreased bacterial loads. Importantly, the bacterial infection-induced white feces in hindgut of turbot were significantly alleviated after poly(I:C) feeding, and this administration induced protection could last for about 7 weeks. Taken together, these findings indicate that feeding turbot with poly(I:C) could enhance a long-term intestinal mucosal immunity in response to bacterial infection, suggesting that poly(I:C) might be a promising immunostimulant in aquaculture.

Purpose: This study aims to explore the effects of entrepreneurship education by examining the influences of the curriculum system, teaching team, design of practical programs, and the institutional systems on universities’ entrepreneurial education performance.Design/Methodology/Approach: This paper employs a case-based approach—Qualitative Comparative Analysis (QCA). Data were collected from 12 universities that were typical cases in the implementation of entrepreneurial education. The four dimensions of entrepreneurship education are applied as conditional indicators. fsQCA3.0 software is used to analyze the necessary conditions and condition combination of the truth table.Findings: There are three sets of condition combinations of the intermediate solution that results in a high level of entrepreneurial education performance: (1) when the credit ratio of entrepreneurship courses is higher and there are more practical platform platforms, even if the entrepreneurship education system and mechanism is less mature, the level of entrepreneurial education performance is high; (2) with a higher credit ratio of entrepreneurship courses, higher quality of teaching teams, and higher standard of practical platforms, the level of entrepreneurial education performance is high; (3) with a higher level of credit ratio of entrepreneurship courses and more practical platforms, as well as mature entrepreneurship education system and mechanism, even if the quality of the teaching team is lower, the level of entrepreneurial education performance is satisfied.Research Limitations/Implications: The dimensions of entrepreneurship education can be expanded; additionally, given that there are many other factors affecting entrepreneurial performance, it is necessary to identify and integrate other possible factors on an ongoing basis.Practical Implications: This study offers practical implications for universities and policy makers that can promote the transformation of theoretical knowledge into practice in the field of entrepreneurship in colleges and universities.Social Implications: This study is one of the first to empirically examine the effect of institutional-driven entrepreneurship education in developing countries. The enhancement of entrepreneurship education can benefit the development of individuals and schools, and even has a potential impact on the progress of the country and society as a whole.Originality/Value: This study emphasizes the significance of viewing the entrepreneurial education as a multi-dimensional concept by targeting different kinds of players. Furthermore, it employs a case-based approach to identify configurations of the antecedent attributes of the curriculum system, teaching team, design of practical programs, and the institutional systems, and their influence on universities’ entrepreneurial education performance.

Objective: The etiology of sudden sensorineural hearing loss (SSNHL) is still unknown. It has been demonstrated that normal endolymph metabolism is essential for inner ear function and that epithelial sodium channels (ENaC) may play an important role in the regulation of endolymphatic Na+. This study aimed to explore the potential association between αENaC p. Ala663Thr gene polymorphism and SSNHL.Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to examine the genotype and allele frequency of the αENaC p. Ala663Thr polymorphism in 20 cases of low-frequency SSNHL (LF-SSNHL), 19 cases of high-frequency SSNHL (HF-SSNHL), 31 cases of all frequency SSNHL (AF-SSNHL), 42 cases of profound deafness SSNHL (PD-SSNHL), and 115 normal controls.Results: The T663 allele was found to be significantly associated with an increased risk of LF-SSNHL (p = 0.046, OR = 2.16, 95% CI = 1.01–4.62). The TT genotype and T663 allele, on the other hand, conferred a protective effect for PD-SSNHL (AA vs. TT: p = 0.012, OR = 0.25, 95% CI = 0.08–0.74; A vs. T: p = 0.001, OR = 0.36, 95% CI = 0.21–0.61). However, there was no statistically significant difference in genotype or allele frequency between the two groups (HF-SSNHL and AF-SSNHL) and the control group.Conclusion: The αENaC p. Ala663Thr gene polymorphism plays different roles in different types of SSNHL.

Although cryo-electron microscopy (cryo-EM) has been successfully used to derive atomic structures for many proteins, it is still challenging to derive atomic structures when the resolution of cryo-EM density maps is in the medium resolution range, such as 5–10 Å. Detection of protein secondary structures, such as helices and β-sheets, from cryo-EM density maps provides constraints for deriving atomic structures from such maps. As more deep learning methodologies are being developed for solving various molecular problems, effective tools are needed for users to access them. We have developed an effective software bundle, DeepSSETracer, for the detection of protein secondary structure from cryo-EM component maps in medium resolution. The bundle contains the network architecture and a U-Net model trained with a curriculum and gradient of episodic memory (GEM). The bundle integrates the deep neural network with the visualization capacity provided in ChimeraX. Using a Linux server that is remotely accessed by Windows users, it takes about 6 s on one CPU and one GPU for the trained deep neural network to detect secondary structures in a cryo-EM component map containing 446 amino acids. A test using 28 chain components of cryo-EM maps shows overall residue-level F1 scores of 0.72 and 0.65 to detect helices and β-sheets, respectively. Although deep learning applications are built on software frameworks, such as PyTorch and Tensorflow, our pioneer work here shows that integration of deep learning applications with ChimeraX is a promising and effective approach. Our experiments show that the F1 score measured at the residue level is an effective evaluation of secondary structure detection for individual classes. The test using 28 cryo-EM component maps shows that DeepSSETracer detects β-sheets more accurately than Emap2sec+, with a weighted average residue-level F1 score of 0.65 and 0.42, respectively. It also shows that Emap2sec+ detects helices more accurately than DeepSSETracer with a weighted average residue-level F1 score of 0.77 and 0.72 respectively.

Objective: To observe the efficacy of bilateral subthalamic nucleus deep brain stimulation on Pisa syndrome in patients with Parkinson's disease.Methods: A total of 52 patients with Parkinson's disease who underwent deep brain stimulation in Beijing Hospital from July 1, 2016 to July 1, 2020 were reviewed. The clinical data were collected for the patients who met the diagnostic criteria of Pisa syndrome on “Medication-Off” state pre-operatively.Results: Two patients met the diagnostic criteria of Pisa syndrome before operation, with a Pisa angle of 10 and 14°, respectively. The lateral trunk flexion of the two patients improved after operation. In stimulation-on/medication-off state, the Pisa angle decreased from 10 to 2° and from 14 to 6°, respectively.Conclusion: Bilateral subthalamic nucleus deep brain stimulation might have beneficial effects on lateral trunk flexion in PD patients, but the predictors of curative effect are not clear.

Background: Paraneoplastic stiff-limb syndrome (SLS) is a rare manifestation of underlying malignancy and could have distinctive features different from the classic stiff-person syndrome (SPS).Case Description: We present a case of anti-amphiphysin antibody (Ab)-associated paraneoplastic SLS, in an 83-year-old woman with invasive ductal carcinoma of the breast. She presented with stiffness, painful spasms of the distal legs, and asymmetrical fixed posturing of the foot. There are coexisting long-tract disturbance and lower-extremity weakness. Treatment with diazepam provided symptomatic relief while plasma exchange (PLEX) did not lead to significant clinical improvement. The patient was bedridden within 3 months and passed away within 6 months from symptom onset.Conclusion: This case highlights the importance of recognition of uncommon presentation of SPS and its oncological significance. This entity requires a high degree of suspicion for initiation of the proper workup. The rapid identification and treatment of the underlying tumor might offer the best chance for recovery.

Autoimmune diseases are often treated by glucocorticoids and immunosuppressive drugs that could increase the risk for infection, which in turn deteriorate disease and cause mortality. Low-dose IL-2 (Ld-IL2) therapy emerges as a new treatment for a wide range of autoimmune diseases. To examine its influence on infection, we retrospectively studied 665 patients with systemic lupus erythematosus (SLE) including about one third receiving Ld-IL2 therapy, where Ld-IL2 therapy was found beneficial in reducing the incidence of infections. In line with this clinical observation, IL-2 treatment accelerated viral clearance in mice infected with influenza A virus or lymphocytic choriomeningitis virus (LCMV). Noticeably, despite enhancing anti-viral immunity in LCMV infection, IL-2 treatment exacerbated CD8+ T cell-mediated immunopathology. In summary, Ld-IL2 therapy reduced the risk of infections in SLE patients and enhanced the control of viral infection, but caution should be taken to avoid potential CD8+ T cell-mediated immunopathology.

Background: Adeno-associated virus (AAV)-mediated gene therapies are rapidly advancing to the clinic, and AAV engineering has resulted in vectors with increased ability to deliver therapeutic genes. Although the choice of vector is critical, quantitative comparison of AAVs, especially in large animals, remains challenging. Methods: Here, we developed an efficient single-cell AAV engineering pipeline (scAAVengr) to simultaneously quantify and rank efficiency of competing AAV vectors across all cell types in the same animal. Results: To demonstrate proof-of-concept for the scAAVengr workflow, we quantified – with cell-type resolution – the abilities of naturally occurring and newly engineered AAVs to mediate gene expression in primate retina following intravitreal injection. A top performing variant identified using this pipeline, K912, was used to deliver SaCas9 and edit the rhodopsin gene in macaque retina, resulting in editing efficiency similar to infection rates detected by the scAAVengr workflow. scAAVengr was then used to identify top-performing AAV variants in mouse brain, heart, and liver following systemic injection. Conclusions: These results validate scAAVengr as a powerful method for development of AAV vectors. Funding: This work was supported by funding from the Ford Foundation, NEI/NIH, Research to Prevent Blindness, Foundation Fighting Blindness, UPMC Immune Transplant and Therapy Center, and the Van Sloun fund for canine genetic research.

Objectives The aim was to elucidate the relationship between liver function and idiopathic pulmonary arterial hypertension (IPAH).Design and setting Retrospective, longitudinal study in urban tertiary care centre in Shanghai, China.Participants 407 IPAH consecutive incident patients age 18–65 years were retrospectively enrolled from January 2008 to December 2018.Outcome measurements The primary endpoint was all-cause mortality. The cut-off value was determined by receiver operating characteristic curve (ROC), which was validated by Cox proportional hazard model was internally validated by bootstrap analysis and used for survival analysis. The Cox model was (internally) validated and cross-validated areas under the curve (AUC) should be reported.Results The prevalence of abnormal liver function tests (LFTs) at baseline was 77.6%. Hyperbilirubinaemia is the most common abnormal biochemical liver test: abnormal total bilirubin (TBIL in 51.6% patients). During the follow-up, 160 patients died. Patients with mixed liver dysfunction have worse prognosis than those with normal LFTs or isolated abnormal bilirubin metabolism. Comparing with patients with hepatocellular injury, the survival of patients with abnormal bilirubin metabolism is lower. Multivariable Cox models revealed a positive association between TBIL, γ-glutamyltransferase (GGT) and mortality showing that each Ig increment in TBIL and GGT was associated with a higher all-cause mortality (TBIL: HR 4. 29 (95% CI 1. 21 to 15. 27), p=0. 02; GGT: HR 2. 76 (95% CI 1. 18 to 6. 45), p=0. 02). A novel formula named Liver Function Predict Index (LFPI) was constructed (LFPI=−0.002*6MWD+1.014*lg GGT+1.458*lg TBIL) to predict prognosis. ROC curve analysis did further identify 2.729 as the best cut-off value for LFPI (AUC 0.75, p

Meiosis initiation and progression are regulated by both germ cells and gonadal somatic cells. However, little is known about what genes or proteins connecting somatic and germ cells are required for this regulation. Our results show that deficiency for adhesion molecule IGSF11, which is expressed in both Sertoli cells and germ cells, leads to male infertility in mice. Combining a new meiotic fluorescent reporter system with testicular cell transplantation, we demonstrated that IGSF11 is required in both somatic cells and spermatogenic cells for primary spermatocyte development. In the absence of IGSF11, spermatocytes proceed through pachytene, but the pericentric heterochromatin of nonhomologous chromosomes remains inappropriately clustered from late pachytene onward, resulting in undissolved interchromosomal interactions. Hi-C analysis reveals elevated levels of interchromosomal interactions occurring mostly at the chromosome ends. Collectively, our data elucidates that IGSF11 in somatic cells and germ cells is required for pericentric heterochromatin dissociation during diplotene in mouse primary spermatocytes.

The gut microbiome exerts important functions on host health maintenance, whereas excessive antibiotic use may cause gut flora dysfunction resulting in serious disease and dysbiosis. Colistin is a broad-spectrum antibiotic with serious resistance phenomena. However, it is unclear whether colistin alters the gastrointestinal tract microbiome in piglets. In this study, 16s rDNA-based metagenome analyses were used to assess the effects of colistin on the modification of the piglet microbiome in the stomach, duodenum, jejunum, cecum, and feces. Both α- and β-diversity indices showed that colistin modified microbiome composition in these gastrointestinal areas. In addition, colistin influenced microbiome composition at the phylum and genus levels. At the species level, colistin upregulated Mycoplasma hyorhinis, Chlamydia trachomatis, Lactobacillus agilis, Weissella paramesenteroides, and Lactobacillus salivarius abundance, but downregulated Actinobacillus indolicus, Campylobacter fetus, Glaesserella parasuis, Moraxella pluranimalium, Veillonella caviae, Neisseria dentiae, and Prevotella disiens abundance in stomachs. Colistin-fed piglets showed an increased abundance of Lactobacillus mucosae, Megasphaera elsdenii DSM 20460, Fibrobacter intestinalis, and Unidentified rumen bacterium 12-7, but Megamonas funiformis, Uncultured Enterobacteriaceae bacterium, Actinobacillus porcinus, Uncultured Bacteroidales bacterium, and Uncultured Clostridiaceae bacterium abundance was decreased in the cecum. In feces, colistin promoted Mucispirillum schaedleri, Treponema berlinense, Veillonella magna, Veillonella caviae, and Actinobacillus porcinus abundance when compared with controls. Taken together, colistin modified the microbiome composition of gastrointestinal areas in piglets. This study provides new clinical rationalization strategies for colistin on the maintenance of animal gut balance and human public health.

Fusarium solani is the most significant pathogen that causes root rot in wolfberry, which has led to serious economic losses in terms of production. As an important enzyme in organisms, NADPH oxidase produces ROS. However, the mechanism of ROS mediated by NADPH oxidase in the growth of F. solani has not been studied. In this study, F. solani colonies were treated with 40 µmol/L DPI and 0.0012% H2O2. The growth rate in terms of colonies, number of spores, key gene expression levels, activity of key enzymes and the content of key products of ROS metabolic pathways were determined. The results showed that the growth rate of colonies treated by DPI decreased by 19.43%, the number of macroconidia increased by 231.03%, the IOD/area values of O2− and H2O2 decreased by 34.88% and 16.97%, respectively, the expression levels in terms of NCF2, SOD1, CTA1 and PXMP4 significantly decreased and the activities of SOD, CAT and POD decreased significantly, while the MDA content increased significantly. Additionally, in the case of the colonies treated with exogenous H2O2, the MDA content decreased significantly while the other indicators increased. Taken together, the NCF2 gene is involved in regulating the activity of NADPH oxidase and regulates the products of O2− and ROS metabolism enzyme genes and their activities to affect colony growth in the F. solani growth process.

Bactrian camel (Camelus bactrianus) meat, as a product of national geographical indication, is mainly produced in the northwest regions of China. This study systematically evaluated the edible quality, nutritional quality, and carcinogenic substances of Bactrian camel meat using different heating times in four thermal processing methods (steaming, boiling, frying, and microwaving). Compared with the control group (uncooked), the thermal processing of meat demonstrated lower redness and moisture content; higher shear force values and protein, fat, and ash contents; and sharply increased the levels of amino acids and fatty acids. The moisture content of the fried and microwave-treated meat was significantly lower than that of the steamed and boiled meat (p < 0.05). Steamed meat was higher in protein but had a lower fat content than the other three processing methods (p < 0.05). Compared with frying and microwaving, meat from steaming and boiling showed higher levels of essential amino acids and lower shear force values. However, the smoke generated during frying led to the formation of large amounts of polycyclic aromatic hydrocarbons (PAHs) and nitrites, and the levels of these substances increased with heating time. In addition, with the extension of the heating time, the shear force of the meat also increased gradually (p < 0.05). In summary, steaming and boiling were proven to be suitable processing methods for preserving better nutritional values while delivering less carcinogenic risk. With our results, we have established a nutritional database for Bactrian camel meat, providing a reference for selecting a suitable thermal processing method.

Silicon carbide (SiC) has good chemical resistance, excellent mechanical properties, thermal conductivity, especially in extreme conditions of application, and has proved to be a very promising electromagnetic absorption material. However, single silicon carbide cannot meet the increasing demand for high performance of absorbing materials. It has become an important research direction to combine it with other absorbing materials to improve its absorbing performance. In this study, a composite absorber material was prepared by 50 wt.% micron-sized beta-silicon carbide (β-sic) powder, mixed with a 0.2 wt.% multiwalled carbon nanotubes (MWCNTs) and 50 wt.% polyurethane (PU) substrate. The mixture was stirred and deaerated to form a slurry, and sprayed onto synthetic fabric. The results showed that the composite material was flexible, with a thickness of less than 2 mm and favorable adhesion. The results obtained by reflection graph of the radar waves, indicated that the return loss within the X-band range (8–12 GHz) was less than −40 dB, indicating favorable radar wave absorption. Therefore, composite materials could thus be used successfully as radar wave absorbers, and was suitable for stealth materials in “asymmetric warfare”.

The temporal variability and abrupt change analysis of temperature and precipitation in Turpan was investigated and examined based on a monthly data set of temperature, precipitation and drought indices (1960–2019) from three meteorological stations over the study area. The Yamamoto method, Mann–Kendall test, Standardized Precipitation Index (SPI), Standardized Precipitation Evaporation Index (SPEI), and Reconnaissance Drought Index (RDI) were applied to reveal temperature, precipitation and drought indices trends in their annual volumes. The conclusions were as follows: (1) in the past 60 years, the annual average temperature in the Turpan region has increased at a rate of 0.33 °C·(10a)−1. Whereas the temperature has accelerated since the 1980s, the annual average minimum temperature has increased more than the annual average maximum temperature, and the temperature difference between winter and summer has increased since the 1990s. (2) The inter-annual, inter-decadal and normal value changes in precipitation in the Turpan region and its three meteorological stations indicated a decreasing trend during 1960–2019. Though the normal value of summer and autumn precipitation decreased and increased as a whole, the normal values of spring, summer, winter and annual precipitation in the Turpan region displayed downward trends. (3) Abrupt changes in temperature were observed in the mid-1990s, and abrupt changes in precipitation were not obvious. (4) The SPI and RDI responded quickly to precipitation and temperature, and the overall characteristics of dry and wet trend changes were consistent. When the SPEI considered the combined effect of temperature and precipitation, the SPI and SPEI are better correlated, and the SPI and RDI are better correlated than the SPEI and RDI. On the whole, the occurrence of drought has obvious regional and seasonal characteristics. These conclusions not only provide scientific data for sustainable development in Turpan but also offer scientific information to further understand the trends and periodicity of climate change and drought conditions in hyper-arid regions around the world.

In the present study, the complete chloroplast genome of Lonicera tangutica is presented and characterized for the first time. The complete chloroplast genome was 156,121 bp in length, including 23,899 bp inverted repeat (IR) regions, an 89,466 bp large single-copy (LSC) region, and an 18,851 bp small single-copy (SSC) region. A total of 129 genes, including 37 tRNA genes, eight rRNA genes, and 84 protein-coding genes, were annotated, and the overall GC content of the chloroplast genome was 38.35%. Two introns in the ycf3 gene and a single intron in another gene were detected. Maximum-likelihood phylogenetic analysis indicated that L. tangutica has a very close evolutionary relationship with Lonicera praeflorens, Lonicera hispida, Lonicera fragrantissima, and Lonicera stephanocarpa. These results are valuable for studying the evolution and genetic diversity of L. tangutica.

BackgroundPrevious studies have confirmed an association between C-peptide levels with the risk of cardiometabolic diseases. However, whether circulating C-peptide was related to subclinical myocardial injury (SC-MI) remains unknown.MethodsA total of 3,752 participants without a history of cardiovascular diseases were included in our study from National Health and Nutrition Examination Survey III (NHANES III). Multivariable linear regression was performed to explore the correlation between C-peptide and cardiac injury score (CIIS). Multivariate logistic regression was used to examine the association between C-peptide quartile and SC-MI.ResultsCirculating C-peptide was significantly associated with CIIS (β:0.09, 95% confidence interval [CI]: 0.00–0.17; p = 0.041). Compared with the lowest quartile, the highest quartile of circulating C-peptide increased a 1.48-fold risk of SC-MI (Odds ratio = 1.66, 95% CI: 1.18–1.87; p = 0.001).ConclusionsThe level of C-peptide was independently associated with CIIS and SC-MI, which could serve as a new risk factor of SC-MI.

Background: Postpartum hemorrhage (PPH) is a leading cause of maternal morbidity and mortality worldwide but the incidence and its risk factors in China is limited. The objective of this study is to investigate the incidence and the risk factors of PPH in Chinese women.Methods: A multi-center retrospective study of pregnant women at ≥28 weeks of gestation was conducted. Logistic regression was used to identify potential risk factors of PPH and receiver operating characteristic curve was used to evaluate the predictive performance of the identified risk factors. Subgroup analysis focusing on the number of fetus and the mode of delivery was conducted.Results: A total of 99,253 pregnant women were enrolled and 804 (0.81%) experienced PPH. The subgroup analysis revealed that the incidence of PPH was 0.75, 2.65, 1.40, and 0.31% in singletons, twin pregnancies, cesarean sections, and vaginal deliveries, respectively. Placenta previa and placenta accreta were the predominant risk factors of PPH in the overall population and all subgroups. A twin pregnancy was a risk factor for PPH regardless of the mode of delivery. Obesity, and multiparity were risk factors for PPH in both singletons and cesarean section cases, but the latter predicted a reduced probability of PPH in vaginal deliveries. Macrosomia was associated with increased risk of PPH in singletons or vaginal deliveries. In women who delivered vaginally, preeclampsia was associated with a higher risk of PPH. The areas under the curve for the overall cohort, singletons, twin pregnancies, cesarean section cases, and vaginal deliveries were 0.832 (95% confidence interval [CI] 0.813–0.851), 0.824 (95% CI 0.803–0.845), 0.686 (95% CI 0.617–0.755), 0.854 (95% CI 0.834–0.874), and 0.690 (95% CI 0.646–0.735), respectively.Conclusions: The risk factors of PPH varied slightly based on the number of fetuses and the mode of delivery, while placenta previa and placenta accreta were the two major risk factors. A combination of the identified risk factors yielded a satisfactory predictive performance in determining PPH in the overall cohort, singletons pregnancies, and women who delivered by cesarean section, whereas the performance was moderate in twin pregnancies and in women delivering vaginally.

ABSTRACT Human gut microbes exhibit a spectrum of cooperative and antagonistic interactions with their host and also with other microbes. The major Bacteroides host-targeting virulence factor, Bacteroides fragilis toxin (BFT), is produced as an inactive protoxin by enterotoxigenic B. fragilis strains. BFT is processed by the conserved bacterial cysteine protease fragipain (Fpn), which is also encoded in B. fragilis strains that lack BFT. In this report, we identify a secreted antibacterial protein (fragipain-activated bacteriocin 1 [Fab1]) and its cognate immunity protein (resistance to fragipain-activated bacteriocin 1 [RFab1]) in enterotoxigenic and nontoxigenic strains of B. fragilis. Although BFT and Fab1 share no sequence identity, Fpn also activates the Fab1 protoxin, resulting in its secretion and antibacterial activity. These findings highlight commonalities between host- and bacterium-targeting toxins in intestinal bacteria and suggest that antibacterial antagonism may promote the conservation of pathways that activate host-targeting virulence factors. IMPORTANCE The human intestine harbors a highly complex microbial community; interpersonal variation in this community can impact pathogen susceptibility, metabolism, and other aspects of health. Here, we identified and characterized a commensal-targeting antibacterial protein encoded in the gut microbiome. Notably, a shared pathway activates this antibacterial toxin and a host-targeting toxin. These findings highlight unexpected commonalities between host- and bacterium-targeting toxins in intestinal bacteria.

The gut microbiome plays important roles in maintaining host health, and inappropriate use of antibiotics can cause imbalance, which may contribute to serious disease. However, despite its promise, using metagenomic sequencing to explore the effects of colistin on gut microbiome composition in pig has not been reported. Herein, we evaluated the roles of colistin in gut microbiome modulation in pigs. Metagenomic analysis demonstrated that overall microbial diversity was higher in the colistin group compared with the control group. Antibiotic Resistance Genes Database analysis demonstrated that following colistin treatment, expression levels of tsnr, ant6ia, tetq, oleb, norm, ant3ia, and mexh were significantly upregulated, indicating that colistin may induce transformation of antibiotic resistance genes. Colistin also affected the microbiome distribution patterns at both genus and phylum levels. In addition, at the species level, colistin significantly reduced the abundance of Prevotella copri, Phascolarctobacterium succinatutens, and Prevotella stercorea and enhanced the abundance of Treponema succinifaciens and Acidaminococcus fermentans compared to the control group. Gene Ontology analysis demonstrated that following treatment with colistin, metabolic process, cellular process, and single-organism process were the dominant affected terms. Kyoto Encyclopedia of Genes and Genomes analysis showed that oxidative phosphorylation, protein processing in endoplasmic reticulum, various types of N-glycan biosynthesis, protein processing in endoplasmic reticulum, pathogenic Escherichia coli infection, and mitogen-activated protein kinase signaling pathway–yeast were the dominant signaling pathways in the colistin group. Overall, our results suggested that colistin affects microbial diversity and may modulate gut microbiome composition in pig, potentially providing novel strategy or antibiotic rationalization pertinent to human and animal health.

To identify the factors predicting intrauterine balloon tamponade (IUBT) failure for severe postpartum hemorrhage (PPH) after delivery, we conducted a retrospective cohort study of women who underwent IUBT for severe PPH after delivery from October 1, 2016 until September 30, 2017. The failure of IUBT was defined as the need of additional surgical procedures or uterine embolization. A total of 99,650 deliveries occurred during the study period. Among the patients, 106 cases of severe PPH were managed with IUBT, and the global success rate was 70.8% (75/106). Least absolute shrinkage and selection operator (LASSO) regression was performed to select the potential risk factors predicting IUBT failure. The associated risk factors—obesity, multiple gestation, cesarean delivery, estimated blood loss (EBL), and placenta accreta spectrum (PAS)—were included in multivariate logistic models. Ultimately, these models identified multiple gestation, EBL, and PAS as independent risk factors for IUBT failure. In conclusion, IUBT is an effective method for severe PPH. The presence of factors affecting IUBT failure should be recognized early, and other modalities of management should be anticipated.

The limited penetration of photons in biological tissue restricts the deep-tissue detection and imaging application. The micro-scale spatially offset Raman spectroscopy (micro-SORS) with an optical fiber probe, colleting photons from deeper regions by offsetting the position of laser excitation from the collection optics in a range of hundreds of microns, shows great potential to be integrated with endoscopy for inside-body noninvasive detection by circumventing this restriction, particularly with the combination of surface-enhanced Raman spectroscopy (SERS). However, a detailed tissue penetration study of micro-SORS in combination with SERS is still lacking. Herein, we compared the signal decay of enhanced Raman nanotags through the tissue phantom of agarose gel and the biological tissue of porcine muscle in the near-infrared (NIR) region using a portable Raman spectrometer with a micro-SORS probe (2.1mm in diameter) and a conventional hand-held probe (9.7mm in diameter). Two kinds of Raman nanotags were prepared from gold nanorods decorated with the nonresonant (4-nitrobenzenethiol) or resonant Raman reporter molecules (IR-780 iodide). The SERS measurements show that the penetration depths of two Raman nanotags are both over 2cm in agarose gel and 3mm in porcine muscle. The depth could be improved to over 4cm in agarose gel and 5mm in porcine tissue when using the micro-SORS system. This demonstrates the superiority of optical-fiber micro-SORS system over the conventional Raman detection for the detection of nanotags in deeper layers in the turbid medium and biological tissue, offering the possibility of combining the micro-SORS technique with SERS for noninvasive in vivo endoscopy-integrated clinical application.

Background: Patients with chronic thromboembolic pulmonary hypertension (CTEPH) still experience reduced exercise capacity despite pulmonary endarterectomy (PEA). Exercise training improves the exercise capacity and quality of life (QoL) in patients with PH, but data on the effects of exercise training on these patients are scarce. The aim of this meta-analysis and systematic review was to evaluate the effectiveness and safety of exercise training in CTEPH after PEA.Methods: We searched the relevant literature published before January 2020 for the systematic review and meta-analysis using the PubMed, EMBASE, and Cochrane Library databases. The primary outcome was a change in the 6-min walking distance (6 MWD). We also assessed the effect of exercise on the peak oxygen uptake (VO2) or peak VO2/kg, oxygen uptake anaerobic threshold, workload, oxygen pulse, hemodynamics, arterial blood gases, oxygen saturation, N-terminal pro-brain-type natriuretic peptide (NT-proBNP), quality of life (QoL) and pulmonary function tests.Results: We included 4 studies with 208 exercise-training participants. In the pooled analysis, short-term exercise training can improve the 6 MWD of 58.89 m (95% CI: 46.26–71.52 m, P < 0.0001). There was a significant increase in the peak VO2/kg or peak VO2 after exercise training (3.15 ml/min/kg, 95% CI: 0.82–5.48, P = 0.008; 292.69 ml/min, 95% CI: 24.62–560.75, P = 0.032, respectively). After exercise training, the maximal workload and O2 pulse significantly improved. Three months of exercise training increased the right ventricular ejection fraction by 3.53% (95% CI: 6.31–11.94, P < 0.00001, I2 = 0) independently of PEA surgery. In addition, NT-proBNP plasma levels significantly improved with exercise training after PEA [weighted mean difference (WMD): −524.79 ng/L, 95% CI: 705.16 to −344.42, P < 0.0001, I2 = 0]. The partial pressure of oxygen and pH improved progressively over 12 weeks of exercise training (WMD: 4 mmHg, 95% CI: 1.01–8.33, P = 0.01; WMD: 0.03, 95% CI: 0.02–0.04, P < 0.0001, respectively). Subscales of the QoL measured by the SF-36 questionnaire had also improved. In addition, exercise training was well-tolerated with a low dropout rate, and no major adverse events occurred during exercise training.Conclusion: Exercise training may be associated with a significant improvement in the exercise capacity and QoL among CTEPH patients after PEA and was proven to be safe. However, more large-scale multicentre studies are needed to confirm the effectiveness and safety of exercise training in CTEPH patients after PEA.PROSPERO registration number:CRD42021235275.

Objective: The study aims to investigate the association of total bilirubin with all-cause and cause-specific mortality in the general population.Methods: A total of 37,234 adults from the United States National Health and Nutrition Examination Survey 1999–2014 were enrolled. Baseline levels of total bilirubin associated with risk of mortality were evaluated on a continuous scale (restricted cubic splines) and by quartile categories with Cox regression models.Results: Higher levels of total bilirubin was positively associated with an increased risk of all-cause mortality [hazard ratio (HR) 1.59, 95% confidence interval (CI) 1.46–1.72; p < 0.001]. Compared with individuals with the lowest quartile of bilirubin, the multivariable adjusted hazard ratio for all-cause mortality was 1.25 (1.14–1.37) for individuals in the highest quartile. Restricted cubic splines indicated that the association was non-linear in cardiovascular mortality and cancer mortality while linear in all-cause mortality.Conclusions: Total bilirubin was associated with all-cause and cause-specific mortality in the general population.

BackgroundWe aimed to investigate the clinical utility of human epididymis protein 4, a tumor biomarker being widely utilized in clinical practice in the diagnosis of ovarian cancer, in primary Sjögren’s Syndrome (pSS).MethodsA total of 109 pSS patients and 113 healthy controls (HCs) were included in the study. HE4 were determined by Roche Cobas E601 electrochemical luminescence analyzer. Clinical and laboratory findings were reviewed, and the relationships between HE4 and clinical parameters were determined by Spearman’s correlation test. The European league against rheumatism Sjögren’s syndrome disease activity index (ESSDAI) was utilized to evaluate disease activity.FindingsThe levels of HE4 were significantly elevated in patients with pSS compared to HCs (103.65 pmol/L vs. 46.52 pmol/L, p

Platelet distribution width has been recognized as risk predictors of idiopathic pulmonary arterial hypertension. This study aims to investigate whether in-hospital platelet distribution width would be useful to predict all-cause death in patients with severe pulmonary hypertension due to chronic lung diseases (CLD-PH). Early in-hospital platelet distribution width was measured in 67 severe CLD-PH patients who were confirmed by right heart catheterization and followed up. Event-free survival was estimated using the Kaplan–Meier method and analyzed with the log-rank test. Cox proportional hazards models were performed to determine the association between the platelet distribution width level and all-cause death. During median of 2.4 (2.5, 3.7) years of follow-up, 44 patients died. A significant association was noted between in-hospital platelet distribution width level and the adjusted risk of all-cause mortality (hazard ratio: 1.245; 95% confidence interval: 1.117–1.386, P