Search

S. cerevisae tRNA introns interrupt the gene at a constant position in the anticodon loop. Pre-tRNAs are matured by an endonuclease and a ligase. The endonuclease alone can accurately release the intron from the pre-tRNA. Here, we investigate the mechanism of splice site selection by the endonuclease. We propose that it initially recognizes features in the mature domain common to all tRNAs. Once positioned on the enzyme, the splice sites are recognizable because they are a fixed distance from the mature domain. To test this hypothesis, we developed a system for synthesizing pre-tRNA by bacteriophage T7 RNA polymerase. To search for recognition sites, we made several mutations. Mutations of C56 and U8 strongly affect endonuclease recognition of pre-tRNA. With insertion and deletion mutations, we show that the anticodon stem determines splicing specificity. The sequence and structure of the intron are not strong determinants of splice site selection.

In this study we report the isolation of temperature-sensitive mutants that affect pre-mRNA splicing. A bank of approximately 1000 temperature-sensitive Saccharomyces cerevisiae strains was generated and screened on RNA gel blots by hybridization with an actin intron probe. We isolated 16 mutants defining 11 new complementation groups prp(rna)17-prp(rna)27 with four phenotypic classes of mutants and 21 mutants in the prp2-prp11 complementation groups (formerly rna2-rna11). The majority of the complementation groups share a phenotype of pre-mRNA accumulation, seen in all of the prp(rna)2-prp(rna)11 mutants. Three novel classes of mutants were isolated in this study. One class, consisting of two complementation groups, exhibits an accumulation of the lariat intermediate of splicing, with no change in the levels of pre-mRNA. The second class, also represented by two complementation groups, shows an accumulation of the intron released after splicing. The third novel class, comprising one complementation group, accumulates both pre-mRNA and the released intron. All mutants isolated were recessive for the splicing phenotype. Only 2 of the 11 complementation groups, although recessive, were not temperature sensitive. This study, together with previous isolation of the prp(rna)2-prp(rna)11 groups and the spliceosomal snRNAs, puts at least 26 gene products involved directly or indirectly in pre-mRNA splicing.

Yeast tRNA ligase is an enzyme required for tRNA splicing. A study by indirect immune fluorescence shows that this enzyme is localized in the cell nucleus. At higher resolution, studies using indirect immune electron microscopy show this nuclear location to be primarily at the inner membrane of the nuclear envelope, most likely at the nuclear pore. There is a more diffuse, secondary location of ligase in a region of the nucleoplasm within 300 nm of the nuclear envelope. When the amount of ligase in the cell is increased, nuclear staining increases but staining of the nuclear envelope remains constant. This experiment indicates that there are a limited number of ligase sites at the nuclear envelope. Since the other tRNA splicing component, the endonuclease, has the characteristics of an integral membrane protein, we hypothesize that it constitutes the site for the interaction of ligase with the nuclear envelope.

The nucleotide sequence of a T4 tRNA with an anticodon for glycine has been determined using (32)P-labeled material from T4-infected cultures of Escherichiacoli. The sequence is: pGCGGAUAUCGUAUAAUGmGDAUUACCUCAGACUUCCAApsiCUGAUGAUGUGAGTpsiCGAUUCUCAUUAUCCGCUCCA-OH. The 74 nucleotide sequence can be arranged in the classic cloverleaf pattern for tRNAs. The anticodon of T4 tRNA(Gly) is UCC with a possible modification of the U. The tRNA molecule would thus be expected to recognize the glycine codons GGG and GGA. Comparative analysis of tRNAs(Gly) from T2 and T6 indicate that their sequences are identical with that from T4.

Transcription of a tRNAArg-tRNAAsp gene pair from Saccharomyces cerevisiae by an homologous yeast extract results in a dimeric percursor molecule which is processed to mature-sized tRNAArg and tRNAAsp molecules. We have transcribed linear DNA fragments cleaved within the gene sequences to show that precursor synthesis is not dependent on the internal promoter of the second gene (tRNAAsp). Furthermore, the second gene does not support independent transcription when the normal upstream initiation site is removed.

Splicing of nuclear precursor messenger RNA (pre-mRNA) occurs on a large ribonucleoprotein complex, the spliceosome. Several small nuclear ribonucleoproteins (snRNP's) are subunits of this complex that assembles on the pre-mRNA. Although the U1 snRNP is known to recognize the 5' splice site, its roles in spliceosome formation and splice site alignment have been unclear. A new affinity purification method for the spliceosome is described which has provided insight into the very early stages of spliceosome formation in a yeast in vitro splicing system. Surprisingly, the U1 snRNP initially recognizes sequences at or near both splice junctions in the intron. This interaction must occur before the other snRNP's (U2, U4, U5, and U6) can join the complex. The results suggest that interaction of the two splice site regions occurs at an early stage of spliceosome formation and is probably mediated by U1 snRNP and perhaps other factors.

We report here the DNA sequence of the entire coding region of the Saccharomyces cerevisiae tRNA ligase gene. tRNA ligase is one of two enzymes required for tRNA splicing in yeast, and the enzyme is likely a single polypeptide with multiple activities. We find that tRNA ligase is a basic protein of 827 amino acids corresponding to a molecular weight of approximately 95,400. The inferred amino acid sequence for tRNA ligase is not significantly homologous to that of other known proteins of similar activity. In addition to the tRNA ligase reading frame and several other unidentified open reading frames, we have found two open reading frames, ORF1 and ORF2, near the 5'-end of the ligase structural gene. One of these, ORF2, produces a divergent transcript which initiates only 125 nucleotides upstream of the tRNA ligase transcript, and is present in approximately the same relative abundance as the transcript for tRNA ligase.

The yeast Saccharomyces cerevisiae is known to contain the highly conserved and unbiquitous protein actin. We have used cloned actin sequences from Dictyostelium discoideum to identify and clone the actin gene in yeast. Hybridization to genomic fragments of yeast DNA suggest that there is a single actin gene in yeast. We have determined the nucleotide sequence of that gene and its flanking regions. The sequence of the gene reveals an intervening sequence of 309 base pairs in the coding sequences at the 5' end of the gene. The existence and location of the intervening sequence was verified by using the dideoxy chain termination technique to determine the sequence at the 5' terminus of the actin mRNA. The similarity of the splice junction sequences in this gene to those found in higher eukaryotes suggests that yeast must possess a similar splicing enzyme.

We have characterized the mechanism of action of a wheat germ RNA ligase which has been partially purified on the basis of its ability to participate in in vitro splicing of yeast tRNA precursors (Gegenheimer, P., Gabius, H-J., Peebles, C.L., and Abelson, J. (1983) J. Biol. Chem. 258, 8365-8373). The preparation catalyzes the ligation of oligoribonucleotide substrates forming a 2'-phosphomonoester, 3',5'-phosphodiester linkage. The 5' terminus of an RNA substrate can have either a 5'-hydroxyl or a 5'-phosphate. The 5'-phosphate, which for a 5'-hydroxyl substrate can be introduced by a polynucleotide kinase activity in the preparation, is incorporated into the ligated junction. The 3' terminus can have either a 2',3'-cyclic phosphate or a 2'-phosphate. 2',3'-Cyclic phosphates can be converted into 2'-phosphates by a 2',3'-cyclic phosphate, 3'-phosphodiesterase activity in the preparation. The 2'-phosphate of the ligated product is derived from the phosphate at the 3' terminus of the substrate. Ligation proceeds with the adenylylation of the 5'-phosphorylated terminus to form an intermediate with a 5',5'-phosphoanhydride bond.

The yeast rna mutations (rna2 through rna10/11) are a set of temperature-sensitive mutations that result in the accumulation of pre-mRNAs at the nonpermissive temperature. Most of the yeast RNA gene products are involved in and essential for mRNA splicing in vitro, suggesting that they code for components of the splicing machinery. We tested this proposal by using an in vitro-synthesized RNA11 protein to complement the temperature-sensitive defect of the rna11 extract. During the in vitro complementation, the input RNA11 protein was associated with the 40S spliceosome and a 30S complex, suggesting that the RNA11 protein is indeed a component of the spliceosome. The formation of the RNA11-associated 30S complex did not require any exogenous RNA substrate, suggesting that this 30S particle is likely to be a preassembled complex involved in splicing. The RNA11-specific antibody inhibited the mRNA splicing in vitro, confirming the essential role of the RNA11 protein in mRNA splicing. Finally, using the anti-RNA11 antibody, we localized the RNA11 protein to the periphery of the yeast nucleus.

A gene for Saccharomyces cerevisiae tRNATrp has been sequenced which contains an intervening sequence of 34 bp (H. S. Kang and J. Abelson, unpublished results). The mutant yeast strain ts-136 accumulates a precursor to tRNATrp which contains mature ends and is colinear with the tRNATrp gene. A nuclear extract from Xenopus oocytes is capable of supporting transcription of the tRNATrp gene contained on plasmid pBR313. The products are precursor tRNAs which contain the intervening RNA sequence. The Xenopus extract accurately splices the precursor transcript to mature-sized tRNATrp.

Many eukaryotic genes contain intevening sequences, segments of DNA that interrupt the continuity of the gene. They are removed from RNA transcripts of the gene by a process known as splicing. The intervening sequence in a yeast tyrosine transfer RNA (tRNA Tyr) suppressor gene was deleted in order to test its role in the expression of the gene. The altered gene and its parent were introduced into yeast by transformation. Both genes exhibited suppressor function, showing that the intervening sequence is not absolutely essential for the expression of this gene.

A subcellular extract from Saccharomyces cerevisiae has been used to transcribe cloned yeast tRNA genes in vitro and to process the primary transcripts at the 5' and 3' termini. Chromatographic fractionation of the extract has separated the transcription components from two distinct nucleolytic activities: an endonuclease that cleaves the precursors to produce mature 5' termini; and a 3'-5' exonuclease. These fractions have been used to elaborate a processing pathway for the dimeric primary transcript of the yeast tRNAArg-tRNAAsp gene pair. Under optimal conditions in vitro this gene is expressed at a rate of 200 transcripts/gene/hour, initiating at position -10 with respect to the mature 5' terminus of tRNAArg and terminating near position +160. The primary transcripts are cleaved by an endonuclease to give tRNAAsp with a mature 5' terminus, and a pre-tRNAArg monomer with a 5' leader and 3' trailer sequences. A second endonuclease cleavage of pre-tRNAArg generates the mature 5' terminus of tRNAArg. The endonuclease cleavages are not ordered. Exonuclease activity(ies) remove the spacer sequences from the 5' mature tRNAArg, and trim the 3' trailer portion from tRNAAsp. Exonucleolytic removal of the 3' trailer does not require prior endonuclease action, but removal of the spacer sequences from pre-tRNAArg is incomplete without prior removal of the 5' leader sequences.

A leucine transfer RNA has been transformed into a serine transfer RNA by changing 12 nucleotides. This result indicates that a limited set of residues determine tRNA identity.

The nucleotide sequence of the lac promoter-operator region has been determined. The 122 base pairs comprising this region include the recognition sites for RNA polymerase, the positive regulatory protein, CAP, and the negative regulatory protein, the repressor. Identification of mutant variants of the sequence combined with the in vitro biochemical studies of others has allowed us to tentatively identify the recognition site for each of these proteins, and to suggest how CAP might act at a distance to affect the interaction of RNA polymerase with the promoter.

The nucleotide sequence of a phage T4-coded low molecular weight RNA, previously designated polyacrylamide gel band epsilon, has been determined. This RNA can be arranged in the cloverleaf configuration common to tRNAs, with an anticodon sequence, U-C-U, which corresponds to the arginine-specific codons A-G-A and A-G-G; it is therefore assumed to be an arginine tRNA. The complete nucleotide sequence of this RNA species is: pG-U-C-C-C-G-C-U-G-G-U-G-U-A-A-U-Gm2'-G-A-D-A-G-C-A-U-A-C-G-A-U-C-C-U-U-C-U-A-A-G-psi-U-U-G-C-G-G-U-C-C-U-G-G-T-psi-C-G-A-U-C-C-C-A-G-G-G-C-G-G-G-A-U-A-C-C-AOH. The nucleotide sequence was determined by analysis of RNA, uniformly labeled in vivo, according to the conventional techniques. In addition, RNA synthesized in vitro in the presence of alpha-32P-labeled nucleoside triphosphates was analyzed through the use of nearest neighbor sequencing techniques. Although a unique sequence could not be determined by this latter analysis, restrictions on the sequence imposed by nearest neighbor data and secondary structure common to tRNA molecules allowed prediction of the correct nucleotide sequence.

Four thousand Escherichia coli clones containing yeast DNA inserted into the plasmid pBR313 have been isolated. Of these, 175 clones were identified as carrying yeast transfer RNA genes. The initial analysis of the inserted transfer RNA genes via the colony hybridization technique with individual radioactive transfer RNA species is reported. The data indicate that yeast transfer RNA genes are not highly clustered, although some clustering exists. In addition, it was observed that the reiteration number of different transfer RNA genes may vary extensively.

Soluble extracts of S. cerevisiae splice tRNA precursors which contain intervening sequences. The reaction goes to completion and requires ATP for the production of mature sequence tRNA. In the absence of ATP, half-tRNA molecules accumulate. Similar half-tRNA molecules appear as kinetic intermediates and accumulate if splicing is inhibited with pure, mature tRNA. Half-tRNA molecules have been purified. These half-tRNAs are efficiently ligated in an ATP-dependent reaction that is inhibited by added mature tRNA. The product of ligation is the expected mature sequence tRNA. The excised intervening sequence has also been identified. These results suggest an enzymatic mechanism for splicing which involves two independent steps.

Amber suppressor genes corresponding to Escherichia coli tRNAPhe and tRNACys have been constructed for use in amino acid substitution studies as well as protein engineering. The genes for either tRNAPheGAA or tRNACysGCA both with the anticodon 5' CTA 3' were assembled from four to six oligonucleotides, which were annealed and ligated into a vector. The suppressor genes are expressed constitutively from a synthetic promoter, derived from the promoter sequence of the E. coli lipoprotein gene. The tRNAPhe suppressor (tRNAPheCUA) is 54-100% efficient in vivo, while the tRNACys suppressor (tRNACysCUA) is 17-50% efficient. To verify that the suppressors insert the predicted amino acids, both genes were used to suppress an amber mutation in a protein coding sequence. NH2-terminal sequence analysis of the resultant proteins revealed that tRNAPheCUA and tRNACysCUA insert phenylalanine and cysteine, respectively. To demonstrate the potential of these suppressors, tRNAPheCUA and tRNACysCUA have been used to effect amino acid substitutions at specific sites in the E. coli lac repressor.

Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

We have sequenced the endogenous RNA polymerase product produced by disrupted purified virions of vesicular stomatitis virus defective interfering particles by using the newer one-dimensional rapid gel sequencing techniques and confirming this with a modified two-dimensional gel vectoring technique. The sequence of this 46-nucleotide RNA is: 5'(pp)pACGAAGACCACAAAACCA-GAUAAAAAAUAAAAACCACAAGAGGG(U)COH3'. We infer that this sequence is identical to the sequence at the 5' end of infectious vesicular stomatitis virus RNA and is complementary to the sequence of the 3'-OH terminus of this defective interfering particle genome RNA.

We have partially purified the yeast spliceosome by differential sedimentation in glycerol gradients. By electron microscopy we have identified a particle in these fractions that is the spliceosome. In 100 mM KCl buffer, the yeast spliceosome is an ovoid disc with the dimensions of 20 x 23.5 nm with a central indentation. To verify that these ovoid particles were spliceosomes, specific labels were used to tag them. These tagged spliceosomes were then identified in the electron microscope. The salt dependent shift of sedimentation rate for the spliceosome can be explained by a change in size of the particle.

Many eukaryotic genes contain intervening sequences (IVS), but the rationale for their existence remains a mystery. Previous studies done in our laboratory demonstrated that the intron in a yeast tRNATyr gene, SUP6, does have a function. We used the same approach to determine the role of introns in nuclear genes encoding messenger RNAs. A single actin gene with one intron exists in Saccharomyces cerevisiae. The level of actin in yeast appears to be crucial to viability: either too much or too little actin inhibits growth. Therefore, small effects on synthesis of actin protein resulting from the removal of the actin gene intron would be expected to cause measurable changes in cell growth. In the present study, an intron-deleted actin gene was constructed in vitro and was used to replace the single resident actin gene in a haploid strain. Analysis of the cells carrying the intron-deleted actin gene shows that the intervening sequence is not essential for actin gene expression.

Among the mischarging mutants isolated from strains with Su+2 glutamine tRNA, two double-mutants, A37A29 and A37C38, have been suggested to insert tryptophan at the UAG amber mutation site as determined by the suppression patterns of a set of tester mutants of bacteria and phages (Yamao et al., 1988). In this paper, we screened temperature sensitive mutants of E. coli in which the mischarging suppression was abolished even at the permissive temperature. Four such mutants were obtained and they were identified as the mutants of a structural gene for tryptophanyl-tRNA synthetase (trpS). Authentic trpS mutations, such as trpS5 or trpS18, also restricted the mischarging suppression. These results strongly support the previous prediction that the mutant tRNAs of Su+2, A37A29 and A37C38, are capable of interacting with tryptophanyl-tRNA synthetase and being misaminoacylated with tryptophan in vivo. However, in an assay to determine the specificity of the mutant glutamin tRNAs, we detected predominantly glutamine, but not any other amino acid, being inserted at an amber codon in vivo to any significant degree. We conclude that the mutant tRNAs still accept mostly glutamine, but can accept tryptophan in an extent for mischarging suppression. Since the amber suppressors of Su+7 tryptophan tRNA and the mischarging mutants of Su+3 tyrosine tRNA are charged with glutamine, structural similarity among the tRNAs for glutamine, tryptophan and tyrosine is discussed.

We have previously shown that extracts prepared from most of the yeast temperature-sensitive rna mutants are heat sensitive for pre-mRNA splicing in vitro, and that the products of the corresponding RNA genes are essential for the early stages of the splicing region. In this report, we demonstrate that most heat-inactivated mutant extracts do not form the spliceosome, suggesting that their gene products are likely to be involved in spliceosome formation. Heat-inactivated rna2 extracts, on the other hand, do form a splicing-dependent 40S complex containing uncleaved pre-mRNA exclusively. The pre-mRNA in the 40S complex can be converted to the splicing products in the presence of ATP and complementing extracts. These results demonstrate that: (1) the 40S complex formed in heat-inactivated rna2 extracts is a spliceosome (termed the rna2 delta spliceosome), (2) the spliceosome is a functional intermediate in the splicing pathway, and (3) the splicing process can be dissected into two steps, spliceosome formation and cleavage-ligation reactions. Additional results indicate that at least two extrinsic factors, as well as the RNA2 gene product, are required for complementation of the rna2 delta spliceosome. A three-step mechanism for nuclear pre-mRNA splicing in yeast is proposed.

The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species alpha) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACA G. The nucleotide sequence was determined primarily by nearest-neighbor analysis of RNA synthesized in vitro using [alpha-32P]nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labeled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbor data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules.

The tRNA ligase protein of Saccharomyces cerevisiae is one of the components required for splicing of yeast tRNA precursors in vitro. We have purified this protein to near homogeneity using an affinity elution chromatographic step. Purified tRNA ligase is a 90-kDa protein that, in addition to catalyzing the ligation of tRNA half-molecules in the coupled splicing reaction, will also ligate an artificial substrate. Using this artificial substrate, we provide evidence for the existence of a previously predicted activated intermediate in the ligation reaction. The amino acid sequence of the amino-terminal end of the protein was determined, and we have used this information to isolate the structural gene from a library of yeast DNA. We prove that this DNA encodes the tRNA ligase protein by DNA sequencing and by demonstrating overproduction of the protein.

Yeast introns contain three highly conserved sequences which are known to be required for splicing of pre-mRNA. Using in vitro mutagenesis, we have synthesized seven point mutations at five different sites in these signals in the yeast actin intron. The mutant introns were then inserted into each of three constructs, which allowed us to assess the consequences both in vivo and in vitro. In virtually every case, we found the efficiency of splicing to be significantly depressed; mature mRNA levels in vivo ranged from 0 to 47% of wild-type. Surprisingly, the tightest mutations were not necessarily at the sites of nucleolytic cleavage and branch formation; these nucleotides are thus highly preferred, but are not absolutely necessary. Moreover, while particular nucleotides are specifically required for the final step in splicing, i.e. 3' cleavage and exon ligation, the predominant consequence of mutation within the conserved signals appears to be the inhibition of assembly of the splicing complex.

The yeast SUP53 gene encodes a leucine-inserting amber suppressor tRNA. We have introduced specific base substitutions into both 5' and 3' elements of the intragenic promoter of this tRNA gene. The influence of these sequence changes on promoter function has been investigated by transcription of the mutant genes in a homologous cell-free system. Our results do not support the idea that tertiary intragenic structure is important in tRNA gene transcription. For one of the SUP53 mutants we are able to suggest a plausible molecular basis for defective transcription: a single base substitution in the 3' element of the intragenic promoter prevents the interaction of this element with a putative transcription factor.

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.

The tRNA(3) (Leu) gene from yeast contains an intervening sequence of 32 nucleotides not present in mature tRNA. This sequence is transcribed and subsequently removed during the maturation of the RNA. To probe the involvement of this region of the gene in transcription and processing of the pre-tRNA(3) (Leu), the yeast DNA was cloned in plasmid pBR322 and a 21-base-pair DNA fragment corresponding to the lac operator was inserted into the intervening sequence. Insertion was done at a cleavage site for the restriction endonuclease Hpa I that occurs 19/20 base pairs from the 5' end of the intervening sequence. The parent and modified plasmids were then transcribed in a Xenopus germinal vesicle extract. RNA-fingerprint analysis of the transcription products revealed that both the tRNA(3) (Leu) gene and its modified counterpart were accurately transcribed. Transcription products corresponding to mature tRNA(3) (Leu) and pre-RNA(3) (Leu) with the normal and lac-containing intervening sequence were identified. Precursors extended at their 5' and 3' ends were also present. Both parent and modified genes were transcribed efficiently, and the various products accumulated in similar amounts, indicating that no deleterious effects on transcriptional competence, stability of the transcripts, or processing result from insertion of the 21-base-pair lac operator DNA. Incubation of pre-tRNA molecules that contained intervening sequences but were 5' and 3' mature with a yeast ribosomal wash fraction resulted in excision of the intervening sequence and, in the presence of ATP, ligation of the resulting half-tRNA molecules. The presence of RNA complementary to lac operator DNA neither inhibited the excision and splicing activities nor altered the site of the junction.

Genes from Beneckea harveyi, a luminescent marine bacterium, were cloned in Escherichia coli. This was done by producing randomly sheared fragments of Beneckea DNA and inserting them into the EcoRI site of plasmid pMB9 by the adenine-thymine joining procedure. The hybrid plasmids were used to transform E. coli C600 SF8. Among the transformants selected for tetracycline resistance, one clone that appeared to complement a leucine tb mutation was identified. The transformants were screened for the presence of Beneckea 5S genes. Four of these clones were analyzed in detail by hybridization with 16S, 23S, and 4S Beneckea RNA. The observations suggest that the ribosomal genes in Beneckea are linked, but are present in a different order than those in E. coli.

The yeast rna mutations (rna2-rna11) are a set of temperature-sensitive mutations that result in the accumulation of intron-containing mRNA precursors at the restrictive temperature. We have used the yeast in vitro splicing system to investigate the role of products of the RNA genes in mRNA splicing. We have tested the heat lability of the in vitro mRNA splicing reaction in extracts isolated from mutant and wild-type cells. Extracts isolated from seven of the nine rna mutants demonstrated heat lability in this assay, while most wild-type extracts were stable under the conditions utilized. We have also demonstrated that heat inactivation usually results in the specific loss of an exchangeable component by showing that most combinations of heat-inactivated extracts from different mutants complement one another. In three cases (rna2, rna5, and rna11), the linkage of the in vitro defect to the rna mutations was ascertained by a combination of reversion, tetrad, and in vitro complementation analyses. Furthermore, each heat-inactivated extract was capable of complementation by at least one fraction of the wild-type splicing system. Thus many of the RNA genes are likely to code for products directly involved in and essential for mRNA splicing.

It is proposed that the biotin anabolic operon in Escherichia coli is transcribed divergently from two partially overlapping face-to-face promoters. A mutation that increases transcription in vivo creates an additional promoter in vitro. The putative operator contains an imperfect palindromic sequence that partially overlaps the promoters. The regulatory and genetic implications of these findings are discussed.

Transfer RNA half-molecules are intermediates in the splicing of tRNA precursors containing intervening sequences. We have utilized yeast tRNA half-molecules to identify and partially purify an ATP-dependent RNA ligase activity from extracts of wheat germ. This activity can complement a yeast tRNA endonuclease in vitro to efficiently splice 10 different yeast tRNA precursors. The products of in vitro splicing are a covalently joined tRNA and a circular intervening sequence RNA. The internucleotide bond formed at the splice junction is a 2'-phosphomonoester, 3',5'-phosphodiester structure. The 2'-phosphate originates from the 2',3'-cyclic phosphate at the 3' terminus of the 5' half-tRNA. The phosphodiester phosphate is derived from the gamma-phosphate of ATP.

Synthetic actin and CYH2 pre-mRNAs containing a single intron are accurately spliced in a soluble whole cell extract of yeast. Splicing in vitro requires ATP. The excised intron is released as a lariat in which an RNA branch connects the 5' end of the molecule to the last A in the "intron conserved sequence" UACUAAC. Two other discrete RNA species produced during splicing in vitro may represent reaction intermediates: free, linear exon 1 and a form of the intron lariat extending beyond the 3' splice site to include exon 2. Both lariat forms correspond to molecules previously shown to be produced during yeast pre-mRNA splicing in vivo.

The nucleotide sequences of species I RNA coded for by bacteriophages T2 and T6 have been analyzed using 32-P-labeled material from T2 and T6-infected cultures of Escherichia coli. The T1 and pancreatic ribonuclease digestion products were partially analyzed and the results were compared with nucleotide sequences from T4 species I RNA to obtain a minimum estimate of the number of nucleotide sequence differences among the three species I RNAs. Analysis of fragments obtained by digestion with epsilon-carboxymethyl-lysine-41-pancreatic ribonuclease and with E. coli Q13 S30 crude extract was also performed to provide some additional confirmation for the nucleotide sequences that were derived for the T2 and T6 species I RNAs. T2 species I RNA was found to be different at three positions in the nucleotide sequence, and unlike T4 species I RNA, contained in addition the modified nucleotide, psi, in a region where the proposed secondary structure is identical to the TpsiC-loop of a tRNA. T6 species I RNA was found to contain nucleotide differences from the T4 species I RNA sequence at four positions. The U at position 119 in the sequence appears to be modified to psi only to a small extent. While a biological function for species I RNA is unknown, the fact that there is over 97% homology in the sequences suggests strong evolutionary pressures to retain the nucleotide sequence in the T-even genomes.