Search

Climate change with altered pest-disease dynamics and rising abiotic stresses threatens resource-constrained agricultural production systems worldwide. Genomics-assisted breeding (GAB) approaches have greatly contributed to enhancing crop breeding efficiency and delivering better varieties. Fast-growing capacity and affordability of DNA sequencing has motivated large-scale germplasm sequencing projects, thus opening exciting avenues for mining haplotypes for breeding applications. This review article highlights ways to mine haplotypes and apply them for complex trait dissection and in GAB approaches including haplotype-GWAS, haplotype-based breeding, haplotype-assisted genomic selection. Improvement strategies that efficiently deploy superior haplotypes to hasten breeding progress will be key to safeguarding global food security. In this Review, Bhat et al. highlight ways to mine crop haplotypes and apply them for dissecting complex traits and genomics-assisted breeding (GAB) approaches. This Review presents new avenues to discover superior haplotypes and assemble them in targeted manner in crop breeding for faster delivery of high-yielding cultivars with better adaptation to future climates. [ABSTRACT FROM AUTHOR]

Key message: Integrating genomics technologies and breeding methods to tweak core parameters of the breeder's equation could accelerate delivery of climate-resilient and nutrient rich crops for future food security. Accelerating genetic gain in crop improvement programs with respect to climate resilience and nutrition traits, and the realization of the improved gain in farmers' fields require integration of several approaches. This article focuses on innovative approaches to address core components of the breeder's equation. A prerequisite to enhancing genetic variance (σ2g) is the identification or creation of favorable alleles/haplotypes and their deployment for improving key traits. Novel alleles for new and existing target traits need to be accessed and added to the breeding population while maintaining genetic diversity. Selection intensity (i) in the breeding program can be improved by testing a larger population size, enabled by the statistical designs with minimal replications and high-throughput phenotyping. Selection priorities and criteria to select appropriate portion of the population too assume an important role. The most important component of breeder′s equation is heritability (h2). Heritability estimates depend on several factors including the size and the type of population and the statistical methods. The present article starts with a brief discussion on the potential ways to enhance σ2g in the population. We highlight statistical methods and experimental designs that could improve trait heritability estimation. We also offer a perspective on reducing the breeding cycle time (t), which could be achieved through the selection of appropriate parents, optimizing the breeding scheme, rapid fixation of target alleles, and combining speed breeding with breeding programs to optimize trials for release. Finally, we summarize knowledge from multiple disciplines for enhancing genetic gains for climate resilience and nutritional traits. [ABSTRACT FROM AUTHOR]

Spilosoma obliqua nucleopolyhedrovirus (SpobNPV) is known as a biocontrol agent against S. obliqua a polyphagous insect. Genome of an isolate designated as SpobMNPV was sequenced and found to have 136,141 bp, 139 putative open reading frames (ORFs) on both sense (48%) and anti‐sense (52%) strands and 97.91% nucleotide similarity with Hyphantria cunea nucleopolyhedrovirus (HycuNPV). All the 38 core genes of baculoviruses were identified and validated in the SpobMNPV genome, which differed from SpobNPV–Manipur isolate in several aspects. In SpobMNPV genome, 7 h were found comprised of 2 to 16 repeated units of 67‐bp at each site with an imperfect 30‐bp palindrome near the centre in both orientations. Comparison of consensus palindrome sequences (hrcons) present in hrs with that of selected alphabaculovirus group I NPVs revealed them to be completely conserved at each side of the hrcons, that is 1‐GxTTTxC‐7 and 22‐TxGxAAAxC‐30. Based on phylogenetic analysis of 38 core genes, SpobMNPV was found closest to the HycuNPV in the group I alphabaculovirus. The complete genome of this isolate is being reported for the first time from North India. The information on genome analysis of SpobMNPV will be an addition to the available database on alphabaculoviruses and also accelerate research on SpobNPV as a component of integrated management of S. obliqua in many economically important crops. [ABSTRACT FROM AUTHOR]

Fusarium wilt (FW) and sterility mosaic diseases (SMD) are key biotic constraints to pigeonpea production. Occurrence of these two diseases in congenial conditions is reported to cause complete yield loss in susceptible pigeonpea cultivars. Various studies to elucidate genomic architecture of the two traits have revealed significant marker–trait associations for use in breeding programs. However, these DNA markers could not be used effectively in genomics-assisted breeding for developing FW and SMD resistant varieties primarily due to pathogen variability, location or background specificity, lesser phenotypic variance explained by the reported QTL and cost-inefficiency of the genotyping assays. Therefore, in the present study, a novel approach has been used to develop a diagnostic kit for identification of suitable FW and SMD resistant lines. This kit was developed with 10 markers each for FW and SMD resistance. Investigation of the diversity of these loci has shown the role of different alleles in different resistant genotypes. Two genes (C.cajan_03691 and C.cajan_18888) for FW resistance and four genes (C.cajan_07858, C.cajan_20995, C.cajan_21801 and C.cajan_17341) for SMD resistance have been identified. More importantly, we developed a customized and cost-effective Kompetitive allele-specific PCR genotyping assay for the identified genes in order to encourage their downstream applications in pigeonpea breeding programs. The diagnostic marker kit developed here will offer great strength to pigeonpea varietal development program, since the resistance against these two diseases is essentially required for nominating an improved line in varietal release pipeline. [ABSTRACT FROM AUTHOR]

Climate change threatens global food and nutritional security through negative effects on crop growth and agricultural productivity. Many countries have adopted ambitious climate change mitigation and adaptation targets that will exacerbate the problem, as they require significant changes in current agri-food systems. In this review, we provide a roadmap for improved crop production that encompasses the effective transfer of current knowledge into plant breeding and crop management strategies that will underpin sustainable agriculture intensification and climate resilience. We identify the main problem areas and highlight outstanding questions and potential solutions that can be applied to mitigate the impacts of climate change on crop growth and productivity. Although translation of scientific advances into crop production lags far behind current scientific knowledge and technology, we consider that a holistic approach, combining disciplines in collaborative efforts, can drive better connections between research, policy, and the needs of society. Benitez-Alfonso et al. provide a roadmap for improved crop production that encompasses the effective transfer of current knowledge into plant breeding and crop management strategies that will underpin sustainable agriculture intensification and climate resilience. [ABSTRACT FROM AUTHOR]

Efficiency of breeding programs of legume crops such as chickpea, pigeonpea and groundnut has been considerably improved over the past decade through deployment of modern genomic tools and technologies. For instance, next-generation sequencing technologies have facilitated availability of genome sequence assemblies, re-sequencing of several hundred lines, development of HapMaps, high-density genetic maps, a range of marker genotyping platforms and identification of markers associated with a number of agronomic traits in these legume crops. Although marker-assisted backcrossing and marker-assisted selection approaches have been used to develop superior lines in several cases, it is the need of the hour for continuous population improvement after every breeding cycle to accelerate genetic gain in the breeding programs. In this context, we propose a sequence-based breeding approach which includes use of independent or combination of parental selection, enhancing genetic diversity of breeding programs, forward breeding for early generation selection, and genomic selection using sequencing/genotyping technologies. Also, adoption of speed breeding technology by generating 4–6 generations per year will be contributing to accelerate genetic gain. While we see a huge potential of the sequence-based breeding to revolutionize crop improvement programs in these legumes, we anticipate several challenges especially associated with high-quality and precise phenotyping at affordable costs, data analysis and management related to improving breeding operation efficiency. Finally, integration of improved seed systems and better agronomic packages with the development of improved varieties by using sequence-based breeding will ensure higher genetic gains in farmers' fields. [ABSTRACT FROM AUTHOR]

Plant diseases threaten global food security by reducing the production and quality of produce. Identification of disease resistance sources and their utilization in crop improvement is of paramount significance. However, constant evolution and occurrence of new, more aggressive and highly virulent pathotypes disintegrates the resistance of cultivars and hence demanding the steady stream of disease resistance cultivars as the most sustainable way of disease management. In this context, molecular tools and technologies facilitate an efficient and rational engineering of crops to develop cultivars having resistance to multiple pathogens and pathotypes. Puccinia spp. is biotrophic fungi that interrupt crucial junctions for causing infection, thus risking nutrient access of wheat plants and their subsequent growth. Sugar is a major carbon source taken from host cells by pathogens. Sugar transporters (STPs) are key players during wheat-rust interactions that regulate the transport, exchange, and allocation of sugar at plant-pathogen interfaces. Intense competition for accessing sugars decides fate of incompatibility or compatibility between host and the pathogen. The mechanism of transport, allocation, and signaling of sugar molecules and role of STPs and their regulatory switches in determining resistance/susceptibility to rusts in wheat is poorly understood. This review discusses the molecular mechanisms involving STPs in distribution of sugar molecules for determination of rust resistance/susceptibility in wheat. We also present perspective on how detailed insights on the STP’s role in wheat-rust interaction will be helpful in devising efficient strategies for wheat rust management. [ABSTRACT FROM AUTHOR]

Climate change seriously impacts global agriculture, with rising temperatures directly affecting the yield. Vegetables are an essential part of daily human consumption and thus have importance among all agricultural crops. The human population is increasing daily, so there is a need for alternative ways which can be helpful in maximizing the harvestable yield of vegetables. The increase in temperature directly affects the plants’ biochemical and molecular processes; having a significant impact on quality and yield. Breeding for climate-resilient crops with good yields takes a long time and lots of breeding efforts. However, with the advent of new omics technologies, such as genomics, transcriptomics, proteomics, and metabolomics, the efficiency and efficacy of unearthing information on pathways associated with high-temperature stress resilience has improved in many of the vegetable crops. Besides omics, the use of genomics-assisted breeding and new breeding approaches such as gene editing and speed breeding allow creation of modern vegetable cultivars that are more resilient to high temperatures. Collectively, these approaches will shorten the time to create and release novel vegetable varieties to meet growing demands for productivity and quality. This review discusses the effects of heat stress on vegetables and highlights recent research with a focus on how omics and genome editing can produce temperature-resilient vegetables more efficiently and faster. [ABSTRACT FROM AUTHOR]

Background: Pigeonpea [Cajanus cajan (L.) Millsp.], an important grain legume crop that is predominantly cultivated in tropical and sub-tropical regions of the world (Nene and Sheila, 1990). Crop wild relatives (CWR) are valuable source of novel alleles for economic traits which when transferred to cultivated species adapt well to changing biotic stresses, farming practices, market demands and climatic conditions. Under proposed study the detailed symptomatology, cultural, morphological and pathogenic characteristics of the causal agent and molecular identification of the pathogen were identified. Methods: Of the total 79 accession of wild relatives of pigeonpea (Cjanus cajan) planted in the experimental fields of ICAR-Indian Institute of Pulses Research (IIPR), Kanpur during 2017-18, one accession (ICP-817) of Rhynchosia bracteata was found to be affected by a disease characterized by leaf and stem blight symptoms. Disease symptoms appeared in January-February, 2017 and 2018. Presence of water soaked lesions on the leaves and stem which later turned chalky in appearance, cottony white mycelium on the affected plant parts along with black coloured irregularly circular sclerotia resembled those of white mold fungus Sclerotinia sclerotiorum (Lib) de Bary were observed. Result: Pathogenicity of the fungus was proved using detached leaf/twig inoculation techniques. Morphological characters and the sequences of internal transcribed spacer (ITS) region of the fungus confirmed the causal agent of the disease to be Sclerotinia sclerotiorum (Lib) de Bary. This is the first report of the Sclerotinia sclerotiorum on Rhynchosia bracteata not only in India but also in the world. [ABSTRACT FROM AUTHOR]

This study reports genome wide characterization and development of first set of microsatellite markers through in silico analysis of eight sequenced Xanthomonas axonopodis pv. punicae strains available in the public database. SSR survey resulted in identification of ~ 4638 perfect SSRs, with mean marker frequency 901 SSRs/Mb and densitiy of 11,006 bp/Mb aross the eight genomes. Frequency distribution graphs revealed hexa-nucleotide repeats were more prominent fowllowed by tri-, tetra-, di- and penta-nucleotides in the analysed genomes. We desinged 2927 SSR primers that are specific to the strain LMG 859 and ePCR confirmed on seven other Xap genomes. This resulted in identification of 542 informative SSRs that are producing single amplicons, from which 66 primers were successfully validated through wet lab experiments on eight Xap isolates of pomegranate. Furthermore, utility of these SSRs were demostrated by analysing molecular diversity among 22 Xap isolates using 20 Xap_SSR primers. SSRs revealed moderate genetic diversity among Xap isolates (61%) and grouped 11 isolates that are repersenting six different states into one cluster. This proved the earlier evidence of wider spread of ST3 type Xap acoss India using Multi locus Sequence Typing (MLST) technique. In summary, Xap_SSR will serve as powerful genomics tools that would helps in monitoring of population dynamics, taxonomy, epidomology and quarantine aspects in bacterial blight pathogen through development of microsatellite based Multilocus Variable number of Tandem repeat analysis (MLVA) in future. [ABSTRACT FROM AUTHOR]

Key message: WRKY transcription factors are among the largest families of transcriptional regulators. In this review, their pivotal role in modulating various signal transduction pathways during biotic and abiotic stresses is discussed. Transcription factors (TFs) are important constituents of plant signaling pathways that define plant responses against biotic and abiotic stimuli besides playing a role in response to internal signals which coordinate different interacting partners during developmental processes. WRKY TFs, deriving their nomenclature from their signature DNA-binding sequence, represent one of the largest families of transcriptional regulators found exclusively in plants. By modulating different signal transduction pathways, these TFs contribute to various plant processes including nutrient deprivation, embryogenesis, seed and trichome development, senescence as well as other developmental and hormone-regulated processes. A growing body of research suggests transcriptional regulation of WRKY TFs in adapting plant to a variety of stressed environments. WRKY TFs can regulate diverse biological functions from receptors for pathogen triggered immunity, modulator of chromatin for specific interaction and signal transfer through a complicated network of genes. Latest discoveries illustrate the interaction of WRKY proteins with other TFs to form an integral part of signaling webs that regulate several seemingly disparate processes and defense-related genes, thus establishing their significant contributions to plant immune response. The present review starts with a brief description on the structural characteristics of WRKY TFs followed by the sections that present recent evidence on their roles in diverse biological processes in plants. We provide a comprehensive overview on regulatory crosstalks involving WRKY TFs during multiple stress responses in plants and future prospects of WRKY TFs as promising molecular diagnostics for enhancing crop improvement. [ABSTRACT FROM AUTHOR]

This study aimed to identify efficient Trichoderma isolate(s) for the management of Fusarium wilt in pigeonpea. In vitro and in vivo (greenhouse) experiments were conducted to evaluate 17 Trichoderma isolate(s) for their anti-pathogenic activity, induction of plant biochemical functions, disease suppression, and plant growth traits comparing with standard Trichoderma strains. Among the indigenous isolates, IIPR Th -31 (T. asperellum) and IIPR Th -33 (T. afroharzianum) had a higher mycelia growth inhibition in vitro [membrane assay (>74%), binary assay (>65%)]. Seed treatment with IIPR Th -31 and IIPR Th -33 isolates led to an increase in peroxidase (173–244%), polyphenol oxidase (48–80%), phenylalanine ammonia–lyase (147–178%) activities in pigeonpea plants over control and reduced disease incidence by 78–85%. Hence, IIPR Th -31, and IIPR Th -33 strains demonstrate excellent bio-control of Fusarium wilt in pigeonpea via induction of defense-related enzymes. These isolates have been registered (Registration No. NAIMCC-R-5, NAIMCC-R-6) and used for talc-based bio-formulations for field application. • Effectiveness of Trichoderma isolates against Fusarium udum (Butler) [ Fusarium wilt in pigeonpea] was investigated. • Isolates IIPR Th -33, IIPR Th -31, and IIPR Th -38 exhibited higher anti-pathogenic potential against the target pathogen. • Different Trichoderma isolates resulted in 35–97% reduction in disease incidence. • Plant enzymes profile indicated improved systemic disease resistance with isolates IIPR Th -33 and IIPR Th -31. [ABSTRACT FROM AUTHOR]

Contiguous genome sequence assemblies will help us to realize the full potential of crop translational genomics. Recent advances in sequencing technologies, especially long-read sequencing strategies, have made it possible to construct gapless telomere-to-telomere (T2T) assemblies, thus offering novel insights into genome organization and function. Plant genomes pose unique challenges, such as a continuum of ancient to recent polyploidy and abundant highly similar and long repetitive elements. Owing to progress in sequencing approaches, for most crop plants, chromosome-scale reference genome assemblies are available, but T2T assembly construction remains challenging. Here we describe methods for haplotype-resolved, gapless T2T assembly construction in plants, including various crop species. We outline the impact of T2T assemblies in elucidating the roles of repetitive elements in gene regulation, as well as in pangenomics, functional genomics, genome-assisted breeding and targeted genome manipulation. In conjunction with sequence-enriched germplasm repositories, T2T assemblies thus hold great promise for basic and applied plant sciences., (© 2024. Springer Nature America, Inc.)

Chickpea (Cicer arietinum L.)-an important legume crop cultivated in arid and semiarid regions-has limited genetic diversity. Efforts are being undertaken to broaden its diversity by utilizing its wild relatives, which remain largely unexplored. Here, we present the Cicer super-pangenome based on the de novo genome assemblies of eight annual Cicer wild species. We identified 24,827 gene families, including 14,748 core, 2,958 softcore, 6,212 dispensable and 909 species-specific gene families. The dispensable genome was enriched for genes related to key agronomic traits. Structural variations between cultivated and wild genomes were used to construct a graph-based genome, revealing variations in genes affecting traits such as flowering time, vernalization and disease resistance. These variations will facilitate the transfer of valuable traits from wild Cicer species into elite chickpea varieties through marker-assisted selection or gene-editing. This study offers valuable insights into the genetic diversity and potential avenues for crop improvement in chickpea., (© 2024. The Author(s), under exclusive licence to Springer Nature America, Inc.)

Temperatures below or above optimal growth conditions are among the major stressors affecting productivity, end-use quality, and distribution of key staple crops including rice (Oryza sativa), wheat (Triticum aestivum), and maize (Zea mays L.). Among temperature stresses, cold stress induces cellular changes that cause oxidative stress and slowdown metabolism, limit growth, and ultimately reduce crop productivity. Perception of cold stress by plant cells leads to the activation of cold-responsive transcription factors and downstream genes, which ultimately impart cold tolerance. The response triggered in crops to cold stress includes gene expression/suppression, the accumulation of sugars upon chilling, and signaling molecules, among others. Much of the information on the effects of cold stress on perception, signal transduction, gene expression, and plant metabolism are available in the model plant Arabidopsis but somewhat lacking in major crops. Hence, a complete understanding of the molecular mechanisms by which staple crops respond to cold stress remain largely unknown. Here, we make an effort to elaborate on the molecular mechanisms employed in response to low-temperature stress. We summarize the effects of cold stress on the growth and development of these crops, the mechanism of cold perception, and the role of various sensors and transducers in cold signaling. We discuss the progress in cold tolerance research at the genome, transcriptome, proteome, and metabolome levels and highlight how these findings provide opportunities for designing cold-tolerant crops for the future., (© 2023 The Authors. The Plant Genome published by Wiley Periodicals LLC on behalf of Crop Science Society of America.)

A better understanding of crop genomes reveals that structural variations (SVs) are crucial for genetic improvement. A graph-based pan-genome by Yan et al. uncovered 424 085 genomic SVs and provided novel insights into heat tolerance of pearl millet. We discuss how these SVs can fast-track pearl millet breeding under harsh environments., Competing Interests: Declaration of interests The authors have no conflicts of interest to declare., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Wheat (Triticum aestivum) is among the most important staple crops for safeguarding the food security of the growing world population. To bridge the gap between genebank diversity and breeding programs, we developed an advanced backcross-nested association mapping plus inter-crossed population (AB-NAMIC) by crossing three popular wheat cultivars as recurrent founders to 20 germplasm lines from a mini core collection. Selective backcrossing combined with selection against undesirable traits and extensive crossing within and between sub-populations created new opportunities to detect unknown genes and increase the frequency of beneficial alleles in the AB-NAMIC population. We performed phenotyping of 590 AB-NAMIC lines and a natural panel of 476 cultivars for six consecutive growing seasons and genotyped these 1066 lines with a 660K SNP array. Genome-wide association studies of both panels for plant development and yield traits demonstrated improved power to detect rare alleles and loci with medium genetic effects in AB-NAMIC. Notably, genome-wide association studies in AB-NAMIC detected the candidate gene TaSWEET6-7B (TraesCS7B03G1216700), which has high homology to the rice SWEET6b gene and exerts strong effects on adaptation and yield traits. The commercial release of two derived AB-NAMIC lines attests to its direct applicability in wheat improvement. Valuable information on genome-wide association study mapping, candidate genes, and their haplotypes for breeding traits are available through WheatGAB. Our research provides an excellent framework for fast-tracking exploration and accumulation of beneficial alleles stored in genebanks., (Copyright © 2023 The Author(s). Published by Elsevier Inc. All rights reserved.)

Abiotic stresses, including drought, salinity, cold, heat, and heavy metals, extensively reducing global agricultural production. Traditional breeding approaches and transgenic technology have been widely used to mitigate the risks of these environmental stresses. The discovery of engineered nucleases as genetic scissors to carry out precise manipulation in crop stress-responsive genes and associated molecular network has paved the way for sustainable management of abiotic stress conditions. In this context, the clustered regularly interspaced short palindromic repeat-Cas (CRISPR/Cas)-based gene-editing tool has revolutionized due to its simplicity, accessibility, adaptability, flexibility, and wide applicability. This system has great potential to build up crop varieties with enhanced tolerance against abiotic stresses. In this review, we summarize the latest findings on understanding the mechanism of abiotic stress response in plants and the application of CRISPR/Cas-mediated gene-editing system towards enhanced tolerance to a multitude of stresses including drought, salinity, cold, heat, and heavy metals. We provide mechanistic insights on the CRISPR/Cas9-based genome editing technology. We also discuss applications of evolving genome editing techniques such as prime editing and base editing, mutant library production, transgene free and multiplexing to rapidly deliver modern crop cultivars adapted to abiotic stress conditions., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Kumar, Prusty, Pandey, Singh, Bohra, Guo and Varshney.)

Bacterial blight (BB) is a devastating disease of rice in the tropics of Indian sub-continent, where the presence of Xoo races with varying levels of genetic diversity and virulence renders disease management extremely challenging. In this context, marker-assisted improvement of plant resistance has been proven as one of the most promising approaches for the development of sustainable rice cultivars. The present study demonstrates the marker-assisted introgression of the three BB resistant genes ( Xa21 + xa13 + xa5 ) into the background of HUR 917, a popular aromatic short grain (ASG) rice cultivar in India. The performance of the resulting improved products (near isogenic lines (NILs), HR 23-5-37-83-5, HR 23-5-37-121-10, HR 23-5-37-121-14, HR 23-65-6-191-13, HR 23-65-6-237-2, HR 23-65-6-258-10 and HR 23-65-6-258-21) establishes the utility of marker-assisted selection (MAS) approach for accelerated trait introgression in rice. The MAS-bred lines carrying three introgressed genes showed broad spectrum BB resistance (lesion length, LL of 1.06 ± 1.35 cm to 4.61 ± 0.87 cm). Besides, these improved lines showed the complete product profile of recurrent parent HUR 917 along with the enhanced level of durable BB resistance. The improved introgression lines with durable BB resistance would contribute to sustainable rice production in India, particularly in the Indo-Gangetic plane that has substantial acreage under HUR 917.

Crop wild relatives (CWRs) have provided breeders with several 'game-changing' traits or genes that have boosted crop resilience and global agricultural production. Advances in breeding and genomics have accelerated the identification of valuable CWRs for use in crop improvement. The enhanced genetic diversity of breeding pools carrying optimum combinations of favorable alleles for targeted crop-growing regions is crucial to sustain genetic gain. In parallel, growing sequence information on wild genomes in combination with precise gene-editing tools provide a fast-track route to transform CWRs into ideal future crops. Data-informed germplasm collection and management strategies together with adequate policy support will be equally important to improve access to CWRs and their sustainable use to meet food and nutrition security targets., Competing Interests: Declaration of interests No interests are declared., (Copyright © 2021 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Cytoplasmic male sterility(CMS), a maternally inherited trait, provides a promising means to harness yield gains associated with hybrid vigor. In pigeonpea [Cajanus cajan (L.) Huth], nine types of sterility-inducing cytoplasm have been reported, of which A 2 and A 4 have been successfully deployed in hybrid breeding. Unfortunately, molecular mechanism of the CMS trait is poorly understood because of limited research invested. More recently, an association between a mitochondrial gene (nad7) and A 4 -CMS has been demonstrated in pigeonpea; however, the mechanism underlying A 2 -CMS still remains obscure. The current investigation aimed to analyze the differences in A 2 -CMS line (ICPL 88039A) and its isogenic maintainer line (ICPL 88039B) at transcriptome level using next-generation sequencing. Gene expression profiling uncovered a set of 505 genes that showed altered expression in response to CMS, of which, 412 genes were upregulated while 93 were downregulated in the fertile maintainer line vs. the CMS line. Further, gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and protein-protein interaction (PPI) network analyses revealed association of CMS in pigeonpea with four major pathways: glucose and lipid metabolism, ATP production, pollen development and pollen tube growth, and reactive oxygen species (ROS) scavenging. Patterns of digital gene expression were confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) of six candidate genes. This study elucidates candidate genes and metabolic pathways having potential associations with pollen development and male sterility in pigeonpea A 2 -CMS. New insights on molecular mechanism of CMS trait in pigeonpea will be helpful to accelerate heterosis utilization for enhancing productivity gains in pigeonpea., (© 2021 The Authors. The Plant Genome published by Wiley Periodicals LLC on behalf of Crop Science Society of America.)

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Cytoplasmic male sterility (CMS) offers a unique system to understand cytoplasmic nuclear crosstalk, and is also employed for exploitation of hybrid vigor in various crops. Pigeonpea A4-CMS, a predominant source of male sterility, is being used for efficient hybrid seed production. The molecular mechanisms of CMS trait remain poorly studied in pigeonpea. We performed genome-wide transcriptome profiling of A4-CMS line ICPA 2043 and its isogenic maintainer ICPB 2043 at two different stages of floral bud development (stage S1 and stage S2). Consistent with the evidences from some other crops, we also observed significant difference in the expression levels of genes in the later stage, i.e., stage S2. Differential expression was observed for 143 and 55 genes within the two stages of ICPA 2043 and ICPB 2043, respectively. We obtained only 10 differentially expressed genes (DEGs) between the stage S1 of the two genotypes, whereas expression change was significant for 582 genes in the case of stage S2. The qRT-PCR assay of randomly selected six genes supported the differential expression of genes between ICPA 2043 and ICPB 2043. Further, GO and KEGG pathway mapping suggested a possible compromise in key bioprocesses during flower and pollen development. Besides providing novel insights into the functional genomics of CMS trait, our results were in strong agreement with the gene expression atlas of pigeonpea that implicated various candidate genes like sucrose-proton symporter 2 and an uncharacterized protein along with pectate lyase, pectinesterase inhibitors, L-ascorbate oxidase homolog, ATPase, β-galactosidase, polygalacturonase, and aldose 1-epimerase for pollen development of pigeonpea. The dataset presented here provides a rich genomic resource to improve understanding of CMS trait and its deployment in heterosis breeding in pigeonpea.

Main Conclusion: Comparative analysis of genome-wide miRNAs and their gene targets between cytoplasmic male sterile (CMS) and fertile lines of pigeonpea suggests a possible role of miRNA-regulated pathways in reproductive development. Exploitation of hybrid vigor using CMS technology has delivered nearly 50% yield gain in pigeonpea. Among various sterility-inducing cytoplasms (A 1 -A 9 ) reported so far in pigeonpea, A 2 and A 4 are the two major sources that facilitate hybrid seed production. Recent evidence suggests involvement of micro RNA in vast array of biological processes including plant reproductive development. In pigeonpea, information about the miRNAs is insufficient. In view of this, we sequenced six small RNA libraries of CMS line UPAS 120A and isogenic fertile line UPAS 120B using Illumina technology. Results revealed 316 miRNAs including 248 known and 68 novel types. A total of 637 gene targets were predicted for known miRNAs, while 324 genes were associated with novel miRNAs. Degradome analysis revealed 77 gene targets of predicted miRNAs, which included a variety of transcription factors playing key roles in plant reproduction such as F-box family proteins, apetala 2, auxin response factors, ethylene-responsive factors, homeodomain-leucine zipper proteins etc. Differential expression of both known and novel miRNAs implied roles for both conserved as well as species-specific players. We also obtained several miRNA families such as miR156, miR159, miR167 that are known to influence crucial aspects of plant fertility. Gene ontology and pathway level analyses of the target genes showed their possible implications for crucial events during male reproductive development such as tapetal degeneration, pollen wall formation, retrograde signaling etc. To the best of our knowledge, present study is first to combine deep sequencing of small RNA and degradome for elucidating the role of miRNAs in flower and male reproductive development in pigeonpea.

The present study investigates the genetic diversity and population structure among 42 diverse pomegranate genotypes using a set of twenty one class I hypervariable SSR markers (> 24 bp), which were reported earlier from the analysis of cv. Dabenzi genome. The study material comprised 16 indigenous and 13 exotic cultivars, and 13 wild accessions. A total of 66 alleles (Na) were detected with an average of 3.14 alleles per marker. The average values of polymorphic information content (PIC), observed heterozygosity ( Ho ) and Shannon's gene diversity index (I) were 0.44, 0.21 and 0.95, respectively suggesting moderate genetic diversity. The pairwise genetic distance ranged from 0.07 to 0.80 with a mean value of 0.53. Population structure analysis divided all the genotypes into four subpopulations (SP1, SP2, SP3 and SP4). Interestingly, the results of phylogenetic and principal component analyses coincided with the results of structure analysis and the grouping of genotypes followed the geographical origins. AMOVA revealed that 25% of the variation was attributed to differences among populations, whereas 75% within the subpopulations with significant F ST value 0.25 (p < 0.001), indicating a high level of genetic differentiations or low level of gene flow. Based on the F ST values, pomegranate genotypes belonging to SP4 (indigenous cultivars) followed by SP1 (exotic lines) exhibited higher gene diversity and genetic differentiations within and among populations. These genetic relationships based on SSR markers could be harnessed in future genetic improvement of pomegranate through informed hybridization programs., Competing Interests: Conflict of interestThe authors declare that they have no conflict of interests., (© Prof. H.S. Srivastava Foundation for Science and Society 2020.)

Improvement in traits of agronomic importance is the top breeding priority of crop improvement programs. Majority of these agronomic traits show complex quantitative inheritance. Identification of quantitative trait loci (QTLs) followed by fine mapping QTLs and cloning of candidate genes/QTLs is central to trait analysis. Advances in genomic technologies revolutionized our understanding of genetics of complex traits, and genomic regions associated with traits were employed in marker-assisted breeding or cloning of QTLs/genes. Next-generation sequencing (NGS) technologies have enabled genome-wide methodologies for the development of ultra-high-density genetic linkage maps in different crops, thus allowing placement of candidate loci within few kbs in genomes. In this review, we compare the marker systems used for fine mapping and QTL cloning in the pre- and post-NGS era. We then discuss how different NGS platforms in combination with advanced experimental designs have improved trait analysis and fine mapping. We opine that efficient genotyping/sequencing assays may circumvent the need for cumbersome procedures that were earlier used for fine mapping. A deeper understanding of the trait architectures of agricultural significance will be crucial to accelerate crop improvement.

Key Message: The review outlines advances in pigeonpea genomics, breeding and seed delivery systems to achieve yield gains at farmers' field. Pigeonpea is a nutritious and stress-tolerant grain legume crop of tropical and subtropical regions. Decades of breeding efforts in pigeonpea have resulted in development of a number of high-yielding cultivars. Of late, the development of CMS-based hybrid technology has allowed the exploitation of heterosis for yield enhancement in this crop. Despite these positive developments, the actual on-farm yield of pigeonpea is still well below its potential productivity. Growing needs for high and sustainable pigeonpea yields motivate scientists to improve the breeding efficiency to deliver a steady stream of cultivars that will provide yield benefits under both ideal and stressed environments. To achieve this objective in the shortest possible time, it is imperative that various crop breeding activities are integrated with appropriate new genomics technologies. In this context, the last decade has seen a remarkable rise in the generation of important genomic resources such as genome-wide markers, high-throughput genotyping assays, saturated genome maps, marker/gene-trait associations, whole-genome sequence and germplasm resequencing data. In some cases, marker/gene-trait associations are being employed in pigeonpea breeding programs to improve the valuable yield and market-preferred traits. Embracing new breeding tools like genomic selection and speed breeding is likely to improve genetic gains. Breeding high-yielding pigeonpea cultivars with key adaptation traits also calls for a renewed focus on systematic selection and utilization of targeted genetic resources. Of equal importance is to overcome the difficulties being faced by seed industry to take the new cultivars to the doorstep of farmers.

A total of 17,439 mature miRNAs (~ 21 nt) earlier generated through RNA seq in the pomegranate were used for in silico analysis. After complexity reduction, a total of 1922 representative mature miRNAs were selected and used as query sequences against pomegranate genome to retrieve 2540 homologous contigs with flanking regions (~ 800). By using pre-miRNA prediction web server, a total of 1028 true contigs harbouring pri-miRNAs encoding 1162 pre-miRNAs were identified. Survey of these sequences for SSRs yielded a total of 1358 and 238 SSRs specific to pri-miRNA and pre-miRNAs, respectively. Of these, primer pairs were designed for 897 pri-miRNA and 168 pre-miRNA SSRs. In pri-miRNA sequences, hexa-nucleotides repeats were found to be most abundant (44.18%) followed by mono- (18.41%) and di-nucleotide (17.01%), which is also observed in pre-miRNA sequences. Further, a set of 51 randomly selected pre-miRNA-SSRs was examined for marker polymorphism. The experimental validation of these markers on eight pomegranate genotypes demonstrated 92.15% polymorphism. Utility of these functional markers was confirmed via examination of genetic diversity of 18 pomegranate genotypes using 15 miRNA-SSRs. Further, potential application of miRNA-SSRs for discovery of trait specific candidate genes was showed by validating 51 mature miRNA against publically available 2047 EST sequences of pomegranate by target and network analysis. In summary, the current study offers novel functional molecular markers for pomegranate genetic improvement., (© Prof. H.S. Srivastava Foundation for Science and Society 2020.)

Key Message: Sustaining yield gains of grain legume crops under growing salt-stressed conditions demands a thorough understanding of plant salinity response and more efficient breeding techniques that effectively integrate modern omics knowledge. Grain legume crops are important to global food security being an affordable source of dietary protein and essential mineral nutrients to human population, especially in the developing countries. The global productivity of grain legume crops is severely challenged by the salinity stress particularly in the face of changing climates coupled with injudicious use of irrigation water and improper agricultural land management. Plants adapt to sustain under salinity-challenged conditions through evoking complex molecular mechanisms. Elucidating the underlying complex mechanisms remains pivotal to our knowledge about plant salinity response. Improving salinity tolerance of plants demand enriching cultivated gene pool of grain legume crops through capitalizing on 'adaptive traits' that contribute to salinity stress tolerance. Here, we review the current progress in understanding the genetic makeup of salinity tolerance and highlight the role of germplasm resources and omics advances in improving salt tolerance of grain legumes. In parallel, scope of next generation phenotyping platforms that efficiently bridge the phenotyping-genotyping gap and latest research advances including epigenetics is also discussed in context to salt stress tolerance. Breeding salt-tolerant cultivars of grain legumes will require an integrated "omics-assisted" approach enabling accelerated improvement of salt-tolerance traits in crop breeding programs.

Pigeonpea productivity is greatly constrained by poor plant ideotype of existing Indian cultivars. Enhancing pigeonpea yield demands a renewed focus on restructuring the ideal plant type by using more efficient approaches like genomic tools. Therefore, the present study aims to identify and validate a set of QTLs/gene(s) presumably associated with various plant ideotype traits in pigeonpea. A total of 133 pigeonpea germplasms were evaluated along with four checks in the augmented design for various ideotype traits i.e. initiation of flowering (IF), days to 50% flowering (DFF), days to maturity (DM), plant height (PH), primary branches (PB), seeds per pod (SP) and pod length (PL). We observed significant genetic diversity in the germplasm lines for these traits. The genetic control of IF, DFF, DM and PH renders these traits suitable for detection of marker trait associations. By using residual maximum likelihood algorithm, we obtained appropriate variance-covariance structures for modeling heterogeneity, correlation of genetic effects and non-genetic residual effects. The estimates of genetic correlations indicated a strong association among earliness traits. The best linear unbiased prediction values were calculated for individual traits, and association analysis was performed in a panel of 95 diverse genotypes with 19 genic SSRs. Out of five QTL-flanking SSRs used here for validation, only ASSR295 could show significant association with FDR and Bonferroni corrections, and accounted for 15.4% IF, 14.2% DFF and 16.2% DM of phenotypic variance (PV). Remaining SSR markers (ASSR1486, ASSR206 and ASSR408) could not qualify false discovery rate (FDR) and Bonferroni criteria, hence declared as false positives. Additionally, we identified two highly significant SSR markers, ASSR8 and ASSR390 on LG 1 and LG 2, respectively. The SSR marker ASSR8 explained up to 22 and 11% PV for earliness traits and PB respectively, whereas ASSR390 controlled up to 17% PV for earliness traits. The validation and identification of new QTLs in pigeonpea across diverse genetic backgrounds brightens the prospects for marker-assisted selection to improve yield gains in pigeonpea., Competing Interests: Compliance with ethical standardsAuthors declare that there is no conflict of interest.

Key Message: Latest outcomes assign functional role to non-coding (nc) RNA molecules in regulatory networks that confer male sterility to plants. Male sterility in plants offers great opportunity for improving crop performance through application of hybrid technology. In this respect, cytoplasmic male sterility (CMS) and sterility induced by photoperiod (PGMS)/temperature (TGMS) have greatly facilitated development of high-yielding hybrids in crops. Participation of non-coding (nc) RNA molecules in plant reproductive development is increasingly becoming evident. Recent breakthroughs in rice definitively associate ncRNAs with PGMS and TGMS. In case of CMS, the exact mechanism through which the mitochondrial ORFs exert influence on the development of male gametophyte remains obscure in several crops. High-throughput sequencing has enabled genome-wide discovery and validation of these regulatory molecules and their target genes, describing their potential roles performed in relation to CMS. Discovery of ncRNA localized in plant mtDNA with its possible implication in CMS induction is intriguing in this respect. Still, conclusive evidences linking ncRNA with CMS phenotypes are currently unavailable, demanding complementing genetic approaches like transgenics to substantiate the preliminary findings. Here, we review the recent literature on the contribution of ncRNAs in conferring male sterility to plants, with an emphasis on microRNAs. Also, we present a perspective on improved understanding about ncRNA-mediated regulatory pathways that control male sterility in plants. A refined understanding of plant male sterility would strengthen crop hybrid industry to deliver hybrids with improved performance.

Next generation sequencing platforms and high-throughput genotyping assays have remarkably expedited the pace of development of genomic tools and resources for several crops. Complementing the technological developments, conceptual shifts have also been witnessed in designing experimental populations. Availability of second generation mapping populations encompassing multiple alleles, multiple traits, and extensive recombination events is radically changing the phenomenon of classical QTL mapping. Additionally, the rising molecular breeding approaches like marker assisted recurrent selection (MARS) that are able to harness several QTLs are of particular importance in obtaining a "designed" genotype carrying the most desirable combinations of favourable alleles. Furthermore, rapid generation of genome-wide marker data coupled with easy access to precise and accurate phenotypic screens enable large-scale exploitation of LD not only to discover novel QTLs via whole genome association scans but also to practise genomic estimated breeding value (GEBV)-based selection of genotypes. Given refinements being experienced in analytical methods and software tools, the multiparent populations will be the resource of choice to undertake genome wide association studies (GWAS), multiparent MARS, and genomic selection (GS). With this, it is envisioned that these high-throughput and high-power molecular breeding methods would greatly assist in exploiting the enormous potential underlying breeding by design approach to facilitate accelerated crop improvement.