Search

Pig manure contributes significantly to environmental pollution through nitrogen compounds. Reducing protein in feed can help, but it may lead to damaging behaviors if pigs' nutritional needs are not met. Breeding pigs for higher protein efficiency (PE) is a long-term solution to reduce nitrogen pollution, but concerns about pig welfare remain. We studied 95 pigs involved in a project on the genetic basis of PE on a 20% protein restricted diet to investigate the phenotypic connection between PE and welfare. These pigs represented natural PE variations in the population. At around 100 days, before their PE was known, we observed their behaviors. Only three pigs engaged in tail biting and manipulation of vulnerable regions, but this was not associated with PE. There was no clear link between PE and manipulating pen mates' less vulnerable regions. Such behaviors are normal but can cause stress and injury if carried out excessively due to boredom or stress. Overall, pigs with higher PE showed no major behavioral abnormalities in this study. Considering the lack of genetic knowledge, the risk of increased harmful behaviors when selecting for higher PE appears low when inferred from this purely phenotypic association., (© 2023. Springer Nature Limited.)

Transposable elements (TEs) are a major source of genetic polymorphisms and play a role in chromatin architecture, gene regulatory networks, and genomic evolution. However, their functional role in pigs and contributions to complex traits are largely unknown. We created a catalog of TEs (n = 3,087,929) in pigs and found that young SINEs were predominantly silenced by histone modifications, DNA methylation, and decreased accessibility. However, some transcripts from active young SINEs showed high tissue-specificity, as confirmed by analyzing 3570 RNA-seq samples. We also detected 211,067 dimorphic SINEs in 374 individuals, including 340 population-specific ones associated with local adaptation. Mapping these dimorphic SINEs to genome-wide associations of 97 complex traits in pigs, we found 54 candidate genes (e.g., ANK2 and VRTN) that might be mediated by TEs. Our findings highlight the important roles of young SINEs and provide a supplement for genotype-to-phenotype associations and modern breeding in pigs., (© 2023. Springer Nature Limited.)

Background: Immune traits are considered to serve as potential biomarkers for pig's health. Medium to high heritabilities have been observed for some of the immune traits suggesting genetic variability of these phenotypes. Consideration of previously established genetic correlations between immune traits can be used to identify pleiotropic genetic markers. Therefore, genome-wide association study (GWAS) approaches are required to explore the joint genetic foundation for health biomarkers. Usually, GWAS explores phenotypes in a univariate (uv), trait-by-trait manner. Besides two uv GWAS methods, four multivariate (mv) GWAS approaches were applied on combinations out of 22 immune traits for Landrace (LR) and Large White (LW) pig lines., Results: In total 433 (LR: 351, LW: 82) associations were identified with the uv approach implemented in PLINK and a Bayesian linear regression uv approach (BIMBAM) software. Single Nucleotide Polymorphisms (SNPs) that were identified with both uv approaches (n = 32) were mostly associated with immune traits such as haptoglobin, red blood cell characteristics and cytokines, and were located in protein-coding genes. Mv GWAS approaches detected 647 associations for different mv immune trait combinations which were summarized to 133 Quantitative Trait Loci (QTL). SNPs for different trait combinations (n = 66) were detected with more than one mv method. Most of these SNPs are associated with red blood cell related immune trait combinations. Functional annotation of these QTL revealed 453 immune-relevant protein-coding genes. With uv methods shared markers were not observed between the breeds, whereas mv approaches were able to detect two conjoint SNPs for LR and LW. Due to unmapped positions for these markers, their functional annotation was not clarified., Conclusions: This study evaluated the joint genetic background of immune traits in LR and LW piglets through the application of various uv and mv GWAS approaches. In comparison to uv methods, mv methodologies identified more significant associations, which might reflect the pleiotropic background of the immune system more accurately. In genetic research of complex traits, the SNP effects are generally small. Furthermore, one genetic variant can affect several correlated immune traits at the same time, termed pleiotropy. As mv GWAS methods consider strong dependencies among traits, the power to detect SNPs can be boosted. Both methods revealed immune-relevant potential candidate genes. Our results indicate that one single test is not able to detect all the different types of genetic effects in the most powerful manner and therefore, the methods should be applied complementary., (© 2023. BioMed Central Ltd., part of Springer Nature.)

Background: Skin development is a complex process that is influenced by many factors. Pig skin is used as an ideal material for xenografts because it is more anatomically and physiologically similar to human skin. It has been shown that the skin development of different pig breeds is different, and some Chinese pig breeds have the characteristics of skin thickness and facial skin folds, but the specific regulatory mechanism of this skin development is not yet clear., Methods: In this study, the facial skin of Chenghua sows in the four developmental stages of postnatal Day 3 (D3) , Day 90 (D90) , Day 180 (D180), and Year 3 (Y3) were used as experimental materials, and RNA sequencing (RNA-seq) analysis was used to explore the changes in RNA expression in skin development at the four developmental stages, determine the differentially expressed messenger RNAs (mRNAs), long noncoding RNAs (lncRNAs), microRNAs (miRNAs), and circular RNAs (circRNAs), and perform functional analysis of related genes by Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses., Results: A pairwise comparison of the four developmental stages identified several differentially expressed genes (DEGs) and found that the number of differentially expressed RNAs (DE RNAs) increased with increasing developmental time intervals. Elastin (ELN) is an important component of the skin. Its content affects the relaxation of the epidermis and dermal connection, and its expression is continuously downregulated during the four developmental stages. The functions of DEGs at different developmental stages were examined by performing GO and KEGG analyses, and the GO terms and enrichment pathways of mRNAs, lncRNAs, miRNAs, and circRNAs highly overlapped, among which the PPAR signaling pathway, a classical pathway for skin development, was enriched by DEGs of D3 vs. D180, D90 vs. D180 and D180 vs. Y3. In addition, we constructed lncRNA-miRNA-mRNA and circRNA-miRNA interaction networks and found genes that may be associated with skin development, but their interactions need further study., Conclusions: We identified a number of genes associated with skin development, performed functional analyses on some important DEGs and constructed interaction networks that facilitate further studies of skin development., Competing Interests: The authors declare there are no competing interests., (©2023 Li et al.)

The Yorkshire pigs, renowned for their remarkable growth rate, low feed conversion ratio (FCR), and high meat production, emerge as a novel preference for paternal breeding. In this study, we found that purebred paternal Yorkshire pigs (PY) surpass the purebred Duroc breed in terms of growth rate. Specifically, purebred PY attain a weight of 100 kg at an earlier age compared to purebred Duroc (Male, 145.07 vs. 162.91; Female, 145.91 vs. 167.57; p -value < 0.01). Furthermore, different hybrid combinations suggest that offspring involving purebred PY exhibit superior growth performance. Compared with purebred Duroc, the offspring of purebred PY have an earlier age in days (173.23 vs. 183.54; p -value < 0.05) at the same slaughter weight. The changes of plasma metabolites of 60-day-old purebred boars in the two sire-breeds showed that 1335 metabolites in plasma were detected. Compared with Duroc, 28 metabolites were down-regulated and 49 metabolites were up-regulated in PY. Principal component analysis (PCA) discerned notable dissimilarities in plasma metabolites between the two sire-breeds of pigs. The levels of glycerol 3-phosphate choline, cytidine, guanine, and arachidonic acid increased significantly ( p -value < 0.05), exerting an impact on their growth and development. According to our results, PY could be a new paternal option as a terminal sire in three-way cross system.

Background: Numerous circular RNAs (circRNAs) have been recently identified in porcine tissues and cell types. Nevertheless, their significance in porcine spleen development is yet unelucidated. Herein, we reported an extensive overlook of circRNA expression profile during spleen development in Meishan pigs., Results: Overall, 39,641 circRNAs were identified from 6,914 host genes. Among them, many circRNAs are up- or down-regulated at different time points of pig spleen development. Using WGCNA analysis, we revealed two essential modules for protein-coding genes and circRNAs. Subsequent correlation analysis revealed 67 circRNAs/co-expressed genes that participated in immnue-associated networks. Furthermore, a competing endogenous RNA (ceRNA) network analysis of circRNAs revealed that 12 circRNAs modulated CD226, MBD2, SAMD3, SIT1, SRP14, SYTL3 gene expressions via acting as miRNA sponges. Moreover, the circRNA&#95;21767/miR-202-3p axis regulated SIT1 expression in a ceRNA manner, which is critical for the immune-based regulation of spleen development in Meishan pigs., Conclusions: Overall, our results demonstrated that the circRNAs were differentially expressed during different stages of porcine spleen development, meanwhile the circRNAs interacted with immune-related genes in a ceRNA-based fashion. Moreover, we presented biomedical researchers with RNAseqTools, a user-friendly and powerful software for the visualization of transcriptome profile data., (© 2023. BioMed Central Ltd., part of Springer Nature.)

Large White pigs are extensively utilized in China for their remarkable characteristics of rapid growth and the high proportion of lean meat. The economic traits of pigs, comprising reproductive and meat quality traits, play a vital role in swine production. In this study, 2295 individuals, representing three different genetic backgrounds Large White pig populations were used: 500 from the Canadian line, 295 from the Danish line, and 1500 from the American line. The GeneSeek 50K GGP porcine HD array was employed to genotype the three pig populations. Firstly, genomic selective signature regions were identified using the pairwise fixation index (F ST ) and locus-specific branch length (LSBL). By applying a top 1% threshold for both parameters, a total of 888 candidate selective windows were identified, harbouring 1571 genes. Secondly, the investigation of regions of homozygosity (ROH) was performed utilizing the PLINK software. In total, 25 genomic regions exhibiting a high frequency of ROHs were detected, leading to the identification of 1216 genes. Finally, the identified potential functional genes from candidate genomic regions were annotated, and several important candidate genes associated with reproductive traits ( ADCYAP1 , U2 , U6 , CETN1 , Thoc1 , Usp14 , GREB1L , FGF12 ) and meat quality traits ( MiR-133 , PLEKHO1 , LPIN2 , SHANK2 , FLVCR1 , MYL4 , SFRP1 , miR-486 , MYH3 , STYX ) were identified. The findings of this study provide valuable insights into the genetic basis of economic traits in Large White pigs and may have potential use in future pig breeding programs.

This study investigated the molecular basis for differences in meat yield and quality between Duroc, Taoyuan black (TB), and Xiangcun black (XB) pigs. The results show that TB pigs have lower carcass weight, lean percentage, pH decline, and glycolytic potential but have higher fat percentage, water- holding capacity, intramuscular fat content, antioxidant capacity, and percentage of slow-twitch fibers than the Duroc pigs. Moreover, muscles of TB pigs have lower protein synthesis and lipolysis gene expression than the muscles of Duroc pigs. Targeted metabolome analysis indicates that 24 metabolites significantly differ among these three pig breeds. Correlation analysis suggests that L-malic acid and β-alanine contents in muscle are closely related to meat quality. These findings suggest that the excellent meat quality of TB pigs is closely related to muscle metabolism and fiber characteristics, while lower protein synthesis and lipolysis may contribute to less meat yield.

The number of ribs (NR) and carcass length (CL) are important economic traits in pig breeding programs. Pigs with a higher NR and longer CL produce greater pork yields. In the present study, Suhuai pigs with NR and CL phenotypes were genotyped using the Neogen ® GGP Porcine 80 K SNP array to identify the QTL affecting NR and CL and dissect the candidate genes for the two traits. The SNP-chip data was imputed to the whole-genome sequence (iWGS) to increase the probability of identifying causal variants. Through genome-wide association studies (GWAS) based on both chip and iWGS data, significant SNPs were detected on Sus scrofa chromosome (SSC) 1, SSC4 and SSC7 for NR and on SSC5, SSC16 and SSC17 for CL. Moreover, two SNPs (H3GA0022644 and WU&#95;10.2&#95;7&#95;103460706) on SSC7 detected in chip-based GWAS were significantly associated with both NR and CL. Through Bayes fine mapping, one reported QTL for NR on SSC7 and two reported QTL for CL on SSC17 were verified, and two new QTL (SSC1: 14.05-15.84 Mb and SSC4: 64.83-66.59 Mb) affecting NR and two new QTL (SSC5: 58.31-59.84 Mb and SSC16: 22.98-23.43 Mb) affecting CL were detected. According to the biological functions of genes, MTHFD1L on SSC1 and SULF1 on SSC4 are novel functional candidate genes for NR, and EMP1 on SSC5 and EGFLAM on SSC16 are novel functional candidate genes for CL. Overall, our findings provide a basis for identifying new causal genes and mutations affecting NR and CL., (© 2023 Stichting International Foundation for Animal Genetics.)

Excreta traits comprise a very important characteristic in breeding that have been neglected for a long time. With the growth of intensive pig farming, plenty of environment problems have been raised, and people have begun to pay attention to pig excreta behaviors from genetics and breeding perspectives. However, the genetic architecture of excreta traits remains unclear. To investigate the genetic architecture of excreta traits in pigs, eight excreta traits and feed conversion ratio (FCR) were analyzed in this study. We performed genome-wide association studies (GWASs) on 213 Yorkshire pigs and estimated genetic parameters for a total number of 290 pigs, comprising 213 Yorkshire, 52 Landrace and 25 Duroc. After analysis, eight and 22 genome-wide significant SNPs were detected for FCR and the eight excreta traits in single-trait GWASs separately, and 18 were detected in a multi-trait meta-analysis for excreta traits, six of which were detected in both the single-trait and the multi-trait GWAS. Eighty, 182 and 133 genes were detected within 1 Mb of the genome-wide significant SNPs for FCR, excreta traits and multi-trait meta-analysis, respectively. Five candidate genes (BCKDC, DBT, ANKRD7, SHPRH and HCRT) with biochemical and physiological effects relevant to feed efficiency and excreta traits might be interesting markers for future breeding. Meanwhile, functional enrichment analysis indicates that most of the significant pathways are associated with the glutathione catabolic process, DNA topological change and replication fork protection complex. This study reveals the architecture of excreta traits in commercial pigs and offers an opportunity for decreasing the pollution from excreta using genomic selection in pigs., (© 2023 The Authors. Animal Genetics published by John Wiley & Sons Ltd on behalf of Stichting International Foundation for Animal Genetics.)

Philippine native pigs (PhNP) are small black pigs domesticated in rural communities in the Philippines. They are valued locally for their various sociocultural roles. Recently, considerable literature has accumulated in the field of native pig production and marketing. However, there is limited research on the genetic diversity of PhNP. No previous study has investigated the evolutionary relatedness among native pigs from various islands and provinces in Luzon and the Visayas, Philippines. In addition, a much debated question is whether the PhNP were interbreeding with or even domesticated from endemic wild pigs. This study aims to clarify some of the uncertainties surrounding the identity and classification of PhNP based on mitochondrial DNA (mtDNA) signatures. Native pig samples (n = 157) were collected from 10 provinces in Luzon and the Visayas. Approximately 650 base pairs of the mtDNA D-loop region were sequenced and analyzed together with publicly available sequences. Pairwise-distance analysis showed genetic separation of North and South Luzon (SL) and the clustering of SL with Visayan pigs. Phylogenetic analysis showed that the PhNP clustered within 3 recognized Asian pig domestication centers: D2 (East Asia), D7 (Southeast Asia) and the Cordillera clade (sister to the Lanyu). We identified 19 haplotypes (1-38 samples each), forming 4 haplogroups, i.e., North Luzon, South Luzon and Visayas, Asian mix and the Cordillera cluster. No endemic wild pig mtDNA was detected in the native pig population, but evidence of interspecific hybridization was observed. This study showed that the Philippine native pigs have originated from at least 3 Sus scrofa lineage and that they were not domesticated from the endemic wild pigs of the Philippines., (© 2023. The Author(s).)

Spermatogenesis is a continual process that occurs in the testes, in which diploid spermatogonial stem cells (SSCs) differentiate and generate haploid spermatozoa. This highly efficient and intricate process is orchestrated at multiple levels. N 6 -methyladenosine (m 6 A), an epigenetic modification prevalent in mRNAs, is implicated in the transcriptional regulation during spermatogenesis. However, the dynamics of m 6 A modification in non-rodent mammalian species remains unclear. Here, we systematically investigated the profile and role of m 6 A during spermatogenesis in pigs. By analyzing the transcriptomic distribution of m 6 A in spermatogonia, spermatocytes, and round spermatids, we identified a globally conserved m 6 A pattern between porcine and murine genes with spermatogenic function. We found that m 6 A was enriched in a group of genes that specifically encode the metabolic enzymes and regulators. In addition, transcriptomes in porcine male germ cells could be subjected to the m 6 A modification. Our data show that m 6 A plays the regulatory roles during spermatogenesis in pigs, which is similar to that in mice. Illustrations of this point are three genes (SETDB1, FOXO1, and FOXO3) that are crucial to the determination of the fate of SSCs. To the best of our knowledge, this study for the first time uncovers the expression profile and role of m 6 A during spermatogenesis in large animals and provides insights into the intricate transcriptional regulation underlying the lifelong male fertility in non-rodent mammalian species., (Copyright © 2023 The Authors. Published by Elsevier B.V. All rights reserved.)

Sperm associated antigen 6 (SPAG6) acts as a scaffolding protein in the center of the flagellar axoneme and has an impact on the maturation of the motility of mammalian sperm flagella and the maintenance of sperm structure. In our previous research, SPAG6 c.900 T>C in exon 7 and exon 7 skipped transcript was identified by analyzing RNA-seq data of testicular tissues from 60 day (sexually immature) and 180 day (sexually mature) Large White boars. Herein, we found porcine SPAG6 c.900 T>C to be associated with semen quality traits in Duroc, Large White and Landrace pigs. SPAG6 c.900 C can generate a new splice acceptor site, inhibit the occurrence of SPAG6 exon 7 skipping to a certain extent, thereby promote the growth of Sertoli cells and maintain the normal blood-testis barrier function. This study provides new insights into the molecular regulation of spermatogenesis and a new genetic marker for the improvement of semen quality in pigs., (© 2023 Stichting International Foundation for Animal Genetics.)

Background: This study investigated if the allele effect of a given single nucleotide polymorphism (SNP) for crossbred performance in pigs estimated in a genomic prediction model differs depending on its breed-of-origin, and how these are related to estimated effects for purebred performance. Results: SNP-allele substitution effects were estimated for a commonly used SNP panel using a genomic best linear unbiased prediction model with breed-specific partial relationship matrices. Estimated breeding values for purebred and crossbred performance were converted to SNP-allele effects by breed-of-origin. Differences between purebred and crossbred, and between breeds-of-origin were evaluated by comparing percentage of variance explained by genomic regions for back fat thickness (BF), average daily gain (ADG), and residual feed intake (RFI). From ten regions explaining most additive genetic variance for crossbred performance, 1 to 5 regions also appeared in the top ten for purebred performance. The proportion of genetic variance explained by a genomic region and the estimated effect of a haplotype in such a region were different depending upon the breed-of-origin. To illustrate underlying mechanisms, we evaluated the estimated effects across breeds-of-origin for haplotypes associated to the melanocortin 4 receptor (MC4R) gene, and for the MC4Rsnp itself which is a missense mutation with a known effect on BF and ADG. Although estimated allele substitution effects of the MC4Rsnp mutation were very similar across breeds, explained genetic variance of haplotypes associated to the MC4R gene using a SNP panel that does not include the mutation, was considerably lower in one of the breeds where the allele frequency of the mutation was the lowest. Conclusions: Similar regions explaining similar additive genetic variance were observed across purebred and crossbred performance. Moreover, there was some overlap across breeds-of-origin between regions that explained relatively large proportions of genetic variance for crossbred performance; albeit that the actual proportion of variance deviated across breeds-of-origin. Results based on a missense mutation in MC4R confirmed that even if a causal locus has similar effects across breeds-of-origin, estimated effects and explained variance in its region using a commonly used SNP panel can strongly depend on the allele frequency of the underlying causal mutation. [ABSTRACT FROM AUTHOR]

Litter size is among the most important traits in swine breeding. However, information on the genetics of litter size in pigs is lacking. In this study, we identified single nucleotide polymorphisms (SNPs) in the insulin-like growth factor binding protein 2 and 3 (IGFBP2 and IGFBP3) genes in Berkshire pigs and analyzed their association with litter size traits. The IGFBP2 SNP was located on chromosome 15 intron 2 (455, A > T) and the IGFBP3 SNP was on chromosome 18 intron 2 (53, A > G). The AT type of IGFBP2 and the GG type of IGFBP3 had the highest values for all litter size traits including total number born (TNB), number of pigs born alive, and breeding value according to TNB. Homozygous GG pigs expressed higher levels of IGFBP3 mRNA in the endometrium than pigs of other genotypes, and a positive correlation was observed between litter size traits and IGFBP3 but not IGFBP2 expression level. These results suggest that SNPs in the IGFBP2 and the IGFBP3 gene are useful biomarkers for increasing the reproductive productivity of Berkshire pigs. [ABSTRACT FROM AUTHOR]

Background: Behavioral traits of pigs have been shown to be partly under genetic control, which raises the possibility that behavior might be altered by genetic selection, resulting in pigs with better growth performance. Objective: To evaluate the behavior and growth of finishing pigs and investigate pigs selected for high or low social breeding value (SBV) in relation to social behavior and group growth. Methods: Thirty-five females and 35 boars from five positive and five negative SBV groups of finishing pigs were grown from 30 to 90 kg and housed in 10 test pens (3.0 × 3.3 m, 7 pigs/pen). Pigs were recorded with video technology for nine consecutive hours on days 1, 15, and 30 after mixing. Pigs were weighed at approximately 90 kg body weight and the number of days to reach 90 kg was then calculated. Results: The frequency and duration of behaviors were present in the positive and negative SBV groups after mixing. On day 1 after mixing, agonistic behavior was significantly higher (p=0.027) for the -SBV group compared with the +SBV group. Feeding and feeding-together behaviors were significantly higher (p<0.003) in the +SBV group on days 1 and 30 after mixing. Moreover, growth performance to reach 90 kg body weight was significantly faster (p<0.002) in the +SBV group than in the -SBV group. Conclusion: Social interactions, such as feeding-together behavior, among pen mates might affect their growth rate and feed intake. Selection for SBV could be used as an indirect technique for improving growth performance of pigs. [ABSTRACT FROM AUTHOR]

Highlights • Alterations in genes expression of isthmus is demonstrated in this study. • On Days 2–3 of pregnancy porcine embryos affect transcriptome of oviductal isthmus. • The most altered genes are down-regulated and involved in immunological processes. Abstract The optimal environment in the oviduct is created by adjusting its ultrastructure and secretory capacity to protect gametes and embryos. It was hypothesized that direct contact between the isthmic epithelium and 2- and 4-cell-stage embryos would alter the transcriptomic profile of the isthmus in pigs. Microarray analysis was performed to determine the alterations in gene expression of the isthmus on Days 2–3 of pregnancy in pigs (after natural mating) during embryo presence in the oviduct. Of 43,803 microarray probes, 354 (0.81%) transcripts were altered (P -value ≤ 0.05 and fold-change ≥ 1.2) on the days of pregnancy when assessments were made. Of these 354 transcripts, 118 (33.3%) were up-regulated, and 236 (66.7%) were down-regulated. A total of 57 (48.3%) up-regulated and 73 down-regulated (30.9%) transcripts were classified into gene ontology categories. Of the 354 altered genes, 36 (10.2%) were categorized into the Toll-like or NOD-like receptor signaling pathway, in the immune system subcategory. Selected genes engaged in maternal immune function were down-regulated. The up-regulated genes were involved in epigenetic regulation, the protection of embryos against oxidative stress and xenobiotics and the control of estrogen metabolism. The 2- and 4-cell-stage embryos might, therefore, affect the oviductal transcriptome to optimize the intra-oviductal milieu, which is necessary to support proper development of embryos. The results of this study indicates the pig oviduct has the capacity to alter its transcriptomic profile as a result of early embryo development after natural mating. [ABSTRACT FROM AUTHOR]

Objective: To investigate the genotype and diversity of Pasteurella multocida present in pig herds and to determine the extent of overlap with isolates from poultry flocks in Australia. Methods: A total of 43 isolates from pigs from different farms and regions of Australia were used in this study. A diverse collection of 41 poultry isolates, with 31 being previously characterised, was also used. The pig isolates and 10 poultry isolates were identified by species‐specific PCR assay, serotyped by the Heddleston scheme and genotyped by a multiplex PCR based on the lipopolysaccharide (LPS) outer core biosynthesis locus, repetitive element PCR fingerprinting (rep‐PCR) and multilocus sequence typing (MLST), with the latter being used on a subset of the isolates based on the rep‐PCR results. Results: Only 4 out of 8 recognised LPS genotypes were found in the pig isolates, with each isolate assigned to an LPS genotype. In contrast, 77% of the isolates were non‐typable or cross‐reacting in the Heddleston serotyping scheme. The rep‐PCR analysis recognised 20 patterns, yet only 16 sequence types (STs) were found and 4 were new STs. There were 5 STs (STs 7, 11, 20, 24 and 58) shared among the pig and poultry isolates. Conclusions: Although only limited numbers of isolates have been examined, there is evidence of a sharing of genotypes between Australian pigs and chickens. These findings have major implication for biosecurity measures with regard to minimising both direct (e.g. animal to animal) and in‐direct (e.g. shared staff or cross‐visitors) contact between poultry and pigs. [ABSTRACT FROM AUTHOR]

Aim: The objective of this experiment was to study the nucleolar organizer region (NOR)-banding pattern in Large White Yorkshire (LWY) crossbred and non-descript pigs and finding differences in the number of NORs between animals and between genetic groups. Materials and Methods: The experiment was carried out on 15 females, and 15 males of LWY crossbred and non-descript pigs to study NOR-banding pattern by employing ammoniacal silver staining technique. Results: A total of 63 and 65 number of good metaphases were prepared in LWY crossbred, and non-descript pigs and a total of 168 and 143 number of NORs were detected on the 8th and 10th chromosomes in both genetic groups, respectively. The mean number of NORs per metaphase was 2.67 and 2.20 in LWY crossbred and non-descript pigs, respectively. LWY crossbred pig had high mean number of silver-stained NORs (Ag-NORs) per metaphase compared to non-descript pig. In general, it was observed that the highest frequency of metaphases (%) examined had two number of NORs, while the lowest frequency (%) had four number of NORs. The number of NORs observed per metaphase on secondary constrictions of the 8th and 10th chromosome pair in both genetic groups ranged from 2 to 4. The Chi-square test of significance revealed that the observed frequencies do not differ significantly from the expected frequencies. Conclusion: The results confirmed differences across breeds in occurrence and number of NORs on chromosomes in pigs. The mean numbers of NORs present per metaphase vary between the animals indicating the existence of polymorphism for the number of NORs. A higher number of Ag-NORs were observed on chromosome pair 10 in both the genetic groups. It was concluded that NORs were more morphologically distinct and greater on chromosome pair 10 than on pair 8, which suggests a dominant role of chromosome 10 in the global production of ribosomal RNA. [ABSTRACT FROM AUTHOR]

Highlights • Casertana and Nero Siciliano pigs are two endangered breeds raised in the Southern of Italy. They were cytogenetically investigated for karyotype analyses and the SCE-test for chromosome stability testing. • Crosses between domestic (2 n = 38) and wild (2 n = 36) pigs are possible and the hybrids found had 2 n = 37. • SCE-test appears very useful not only to establish the normal genome stability baseline of the animal species and breeds raised in wild breeding, but also to test animals, which are naturally (in vivo exposure) or in vitro (cells) exposed to mutagens. • The presence of hybrids between domestic and wild boar demonstrates that it is necessary to develop a specific breeding program to avoid breed contamination. Abstract Representative groups of animals of two endangered local pig breeds (Casertana and Nero Siciliano, both with black skin and raised in Southern-Italy) were cytogenetically investigated and compared to check for the presence of chromosomal abnormalities and to test their chromosome stability by sister chromatid exchange (SCE) test, in their normal breeding conditions. Forty-two Casertana pigs (22 males and 20 females, raised in 3 farms) and 39 Nero Siciliano pigs (19 males and 20 female, raised in 3 farms) were investigated. All animals showed normal CBA- and RBA-banded karyotypes (2 n = 38), except for two Nero Siciliano boars (both from the same farm) which showed 2 n = 37 being heterozygous carrier of rob (15;17). The translocation was confirmed by FISH-mapping with specific BAC-clones. Both animals were probably hybrids from crosses with the wild pig (2 n = 36) present in the Nebrodi mountains where Nero Siciliano is reared with extensive or semi-extensive systems. SCE-test applied on all studied animals revealed no statistical differences between the SCE-mean number of Casertana (7.13 ± 3.20) and Nero Siciliano (6.87 ± 3.12) breeds. Statistical differences were found between SCEs mean values of males (7.26 ± 3.38) and females (6.59 ± 2.90) of Nero Siciliano breed, as well as between females of Casertana (7.24 ± 3.26) and Nero Siciliano (6.59 ± 2.90) breeds, while no statistical differences were found between SCE mean values of males of Casertana (6.98 ± 3.10) and Nero Siciliano (6.45 ± 2.97) breeds, as well as between males and females of Casertana breed. [ABSTRACT FROM AUTHOR]

DNA methylation is an important mediator of gene expression regulation and has been shown to be closely linked to aging. Immune-related genes tend to be influenced by DNA methylation at different ages. To explore DNA methylation changes in the porcine TNFα gene and analyze their potential effects on gene expression, we measured the methylation level of the TNFα promoter and TNFα mRNA expression in the spleen of Meishan piglets at six developmental stages (1, 7, 14, 21, 28 and 35 days old) by bisulfite sequencing PCR and quantitative PCR. The results revealed a trend for TNFα promoter methylation level to increase and mRNA expression to decrease with age. Correlation analysis showed a significant negative association between methylation level and mRNA expression (Pearson's r = -0.775, P = 4.87E-07). In addition, the transcription factor Sp1 was revealed to bind with the TNFα promoter and regulate TNFα expression. DNA methylation in the TNFα promoter was found to decrease the promoter's activity, and methylation inhibition could enhance the expression level of TNFα, providing functional evidence that promoter methylation controls TNFα expression. Together, our data provide insights into age-associated changes in promoter methylation of the TNFα gene in the spleen and contribute to our understanding of regulatory mechanisms for TNFα expression in the immune system of pigs. [ABSTRACT FROM AUTHOR]

Genetic diversity and breed structure of Banija spotted pig (BS) was analyzed trough 721 pedigree records and polymorphism of 23 microsatellites on 30 BS pigs. Two phylogenetic trees were constructed from microsatellite and pedigree information. The inbreeding coefficient obtained by microsatellite markers was 5.6%, while the inbreeding coefficient from pedigree analysis was 3.68%. The rate of inbreeding per generation was 1.74% and effective population size was 28.81. In phylogenetic analyses, relationship coefficients and genetic distances between individuals were calculated using microsatellite and pedigree data. Phylogenetic trees from microsatellite markers and pedigree corresponded well to each other and showed consistency between microsatellite and pedigree information. From the data obtained by microsatellite markers and pedigree, two subpopulations can be observed. The existence of two subpopulations can be explained by two different paths of breed genesis. Thus, future work in the conservation process should include methods such as optimal contribution selection including factorial mating, in order to make genetic progress and control the rate of inbreeding. [ABSTRACT FROM AUTHOR]

The microsatellite (MS) genetic diversity studies on CS pig breed showed subclustering of this breed. Structuring results based on MS data of 70 CS pigs were compared to the MC1R coat color gene genotyping results. The MS analysis included also commercial pig breeds to elucidate the relationship of different CS breed gene pools towards commercial pig breeds. The Structure results and the results of Unweighted Pair Group Method with Arithmetic Mean (UPGMA) individual clustering based on genetic distances revealed presence of three gene pools in CS breed. Comparison with the genotyping results of the MC1R coat color gene showed that one gene pool consists of MC1R homozygous black animals, while animals from the other two gene pools (CS2 and CS3) were MC1R heterozygous. [ABSTRACT FROM AUTHOR]

This study aims to evaluate the effect of two different genetic groups and of the dietary protein content (16.1 vs 14%, conventional - CONV vs low crude protein - LCP) on the environmental footprint of the intensive medium-heavy pigs (final BW of 145 kg) system in northern Italy through Life Cycle Assessment (LCA). The experiment involved 92 barrows with the same age, originated by the same maternal line and by two different commercial paternal lines intended for medium-heavy pig production. Pigs were allotted 12 individuals per pen and fed according to the same feeding curve, based on a moderate restricted feed allowance increased on a weekby- week basis. The LCA model included emissions related to animal handling, manure storage and feedstuffs production. The functional unit was 1 kg of body weight gained (BWG). Impact categories assessed were (mean values into brackets): global warming (GWP, 2.3 kg CO2-eq), acidification (AP, 48 g SO2-eq) and eutrophication (EP, 24 g PO4-eq). Impact values were analyzed with a mixed model testing the effect of diet and genetic group. All the impact categories were affected by diet (P<0.001) and genetic group (P<0.05). The LCP diet showed lower values of GWP, AP and EP than CONV diet (-18, -12 and -3%, respectively). Low protein diets can effectively reduce the environmental footprint of intensive pig production, with no effects on productive performances. However, feedstuffs type and origin should be considered to not nullify the emissions savings. [ABSTRACT FROM AUTHOR]

Pigs serve as an important agricultural resource and animal model in biomedical studies. Efficient and precise modification of pig genome by using recently developed gene editing tools has significantly broadened the application of pig models in various research areas. The three types of site-specific nucleases, namely, zinc-finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein, are the main gene editing tools that can efficiently introduce predetermined modifications, including knockouts and knockins, into the pig genome. These modifications can confer desired phenotypes to pigs to improve production traits, such as optimal meat production, enhanced feed digestibility, and disease resistance. Besides, given their genetic, anatomic, and physiologic similarities to humans, pigs can also be modified to model human diseases or to serve as an organ source for xenotransplantation to save human lives. To date, many genetically modified pig models with agricultural or biomedical values have been established by using gene editing tools. These pig models are expected to accelerate research progress in related fields and benefit humans. [ABSTRACT FROM AUTHOR]

Feet and legs of replacement females were objectively evaluated at selection, i.e., approximately 150 d of age (n = 319) and post first parity, i.e., any time after weaning of first litter and before second parturition (n = 277) to 1) compare feet and leg joint angle ranges between selection and post first parity; 2) identify feet and leg joint angle differences between selection and first 3 wk of second gestation; 3) identify feet and leg joint angle differences between farms and gestation days during second gestation; and 4) obtain genetic variance components for conformation angles for the two time points measured. Angles for carpal joint (knee), metacarpophalangeal joint (front pastern), metatarsophalangeal joint (rear pastern), tarsal joint (hock), and rear stance were measured using image analysis software. Between selection and post first parity, significant differences were observed for all joints measured (P < 0.05). Knee, front and rear pastern angles were less (more flexion), and hock angles were greater (less flexion) as age progressed (P < 0.05), while the rear stance pattern was less (feet further under center) at selection than post first parity (only including measures during first 3 wk of second gestation). Only using post first parity leg conformation information, farm was a significant source of variation for front and rear pasterns and rear stance angle measurements (P < 0.05). Knee angle was less (more flexion; P < 0.05) as gestation age progressed. Heritability estimates were low to moderate (0.04-0.35) for all traits measured across time points. Genetic correlations between the same joints at different time points were high (>0.8) between the front leg joints and low (<0.2) between the rear leg joints. High genetic correlations between time points indicate that the trait can be considered the same at either time point, and low genetic correlations indicate that the trait at different time points should be considered as two separate traits. Minimal change in the front leg suggests conformation traits that remain between selection and post first parity, while larger changes in rear leg indicate that rear leg conformation traits should be evaluated at multiple time periods. [ABSTRACT FROM AUTHOR]

Genetic and antigenic variability between Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) isolates has encumbered vaccine development. Here, the genetic basis of PRRSV antibody response was assessed using data from experimental infection trials of commercial crossbred weaner pigs across with one of two distinct PRRSV isolates, NVSL-97-7895 (~750 pigs) and KS-2006-72109 (~450 pigs). Objectives were to estimate the genetic parameters of antibody response, measured as the sample to positive ratio (S:P) of PRRSV N-protein specific IgG in serum at 42 d post infection (dpi); assess the relationship of S:P at 42 dpi with serum viremia and growth under infection; and identify genomic regions associated with S:P at 42 dpi. Estimates of heritability of S:P at 42 dpi for NVSL and KS06 were 0.31 ± 0.09 and 0.40 ± 0.10 and appeared to be under similar genetic control (genetic correlation 0.73 ± 0.39). Estimates of genetic correlations of S:P were generally weak with viral load (NVSL: -0.20 ± 0.18; KS06: -0.69 ± 0.20), measured as area under the curve of log10 serum viremia from 0 to 21 dpi, and with weight gain (WG) from 0 to 42 dpi (NVSL: -0.38 ± 0.19; KS06: -0.08 ± 0.25). However, genetic correlations of S:P at 42 dpi with daily serum viremia and with 3-d WG revealed dynamic relationships, with S:P at 42 dpi having the strongest negative genetic correlations with daily viremia when IgG production starts (10-20 dpi), and negative genetic correlations with WG early after infection but positive later on. This suggests that animals that placed more emphasis on immune response early in infection reaped benefits of that later in infection by more effectively clearing the virus. The WUR10000125 SNP on SSC4, previously associated with response to PRRSV, did not have a significant effect on S:P at 42 dpi (P > 0.05) but genotype- specific genetic correlations of S:P with daily viremia and 3-d WG suggested that the lower WG of pigs with the unfavorable AA WUR10000125 genotype may be due to their utilization of a more energetically costly host response compared to pigs with the favorable genotype. Genome-wide association studies identified three SNPs in the Major Histocompatibility Complex associated with S:P that explained ~10 (NVSL) and 45% (KS06) of the genetic variance but were not associated with viremia or WG. In conclusion, antibody response to PRRSV infection is a possible biomarker for improved host response to PRRSV infection. [ABSTRACT FROM AUTHOR]

The present study aimed to identify the alternatively spliced isoforms of pig MEF2A gene and to determine their mRNA expression patterns. Four alternatively spliced isoforms of pig MEF2A gene (i.e. MEF2A1, MEF2A2, MEF2A3 and MEF2A4) were cloned according to the results of transcriptome sequencing. The fifth to eighth exons of MEF2A1 were normally spliced. In MEF2A2, the fifth exon was missing; the sixth exon had an extra 138 bp at its 5′ end, and the seventh exon had an extra 102 bp at its 3′ end. In MEF2A3, the fifth exon was missing, and the sixth exon had an additional 138 bp at its 5′ end. In MEF2A4, the seventh exon had an extra 102 bp at its 3′ end. Quantitative real-time polymerase chain reaction (qPCR) analysis indicated that the expression profiles of the four alternatively spliced transcripts in the longissimus dorsi differed between the Mashen and Large White pigs. MEF2A1 and MEF2A2 expression levels were the highest at 90 days of age and lowest at 180 days of age. MEF2A3 and MEF2A4 expression levels increased with age (in days). The four alternatively spliced isoforms of MEF2A were also expressed in the small intestine, cerebellum, pancreas, heart and lung. The discovery of new alternatively spliced transcripts of the MEF2A gene may be utilized in understanding its biological functions. [ABSTRACT FROM AUTHOR]

Selection for indirect genetic effects (IGE), i.e. the genetic effect of an individual on a trait of another individual, is a promising avenue to increase trait values in plant and animal breeding. Studies in livestock suggest that selection for IGE for growth (IGEg) might increase animals’ capacity to tolerate stress. We assessed the effect of a stressful phase (weaning) on the behaviour and performance of pigs (n = 480) divergently selected for high or low IGEg. High IGEg pigs were significantly slower to explore the feed and gained less weight than low IGEg pigs in the days after weaning. In line with previous findings, high IGEg animals may have prioritized the formation of social ranks. [ABSTRACT FROM AUTHOR]

Molecular characterization of swine leukocyte antigen (SLA) genes is important for elucidating the immune responses between swine-donor and human-recipient in xenotransplantation. Examination of associations between alleles of SLA class I genes, type of pig genetic modification, porcine endogenous retrovirus (PERV) viral titer, and PERV subtypes may shed light on the nature of xenograft acceptance or rejection and the safety of xenotransplantation. No significant difference in PERV gag RNA level between transgenic and non-transgenic pigs was noted; likewise, the type of applied transgene had no impact on PERV viremia. SLA-1 gene profile type may correspond with PERV level in blood and thereby influence infectiveness. Screening of pigs should provide selection of animals with low PERV expression and exclusion of specimens with PERV-C in the genome due to possible recombination between A and C subtypes, which may lead to autoinfection. Presence of PERV-C integrated in the genome was detected in 31.25% of specimens, but statistically significant increased viremia in specimens with PERV-C was not observed. There is a need for multidirectional molecular characterization (SLA typing, viremia estimation, and PERV subtype screening) of animals intended for xenotransplantation research in the interest of xeno-recipient safety. [ABSTRACT FROM AUTHOR]

Gelatine used for capsule shells is made from porcine or bovine origins. Several methods for porcine DNA identification in numerous products have been reported for halal authentication. The negative results of a specific determination toward porcine DNA remained unclear, whether negative results were caused no porcine DNA in product or due to the failure during DNA extraction, therefore it is necessary to confirm the presence of bovine gelatine in capsule shell. The aim of this study is to confirm the bovine gelatine using specific primer from bovine D-loop. From two pair of primers designed, only primer D-loop93 (F: ACACAGAATTTGCACCCTAA, R: GTACATTACCCCTTGCGTAG) had the capability to identify bovine DNA either in fresh tissue or gelatine sources with the optimum annealing temperature of 51.4oC. The limit of detection of DNA in gelatine is 5 pg. All commercial capsule shells were analyzed using primer D-loop 93, and the results showed that all commercial capsule shells are amplified. [ABSTRACT FROM AUTHOR]

Muslim societies prohibit the inclusion of pig-derived materials in any food. As such, analytical methods that accurately and sensitively detect the presence of porcine materials are critical to ensure the halal authenticity of foods. Among molecular biology techniques, polymerase chain reaction (PCR) is used with preference to identify the presence of pig-derived DNA in foods and gelatins. Using specific primers, PCR can be successfully used to test for the presence of pork DNA in food products. In addition, 90% of gelatin used in food and pharmaceutical products has a porcine origin, so PCR is frequently used to test gelatins. This article describes the use of conventional or real-time PCR to test for the presence of pork DNA and porcine gelatin DNA. [ABSTRACT FROM AUTHOR]

A partial cDNA (~1200 bp) of the porcine ACTC1 gene was identified in the subtracted foetal hind limb muscle cDNA library (44 days of gestation; using m. biceps femoris cDNA as the driver). Using specific polymerase chain reaction (PCR) primers, a bacterial artificial chromosome (BAC) clone containing the genomic ACTC1 gene was identified and the gene was sequenced. Specific PCR primers designed from the BAC and cDNA sequences were used for amplification and comparative sequencing of ACTC1 of Pietrain and Meishan pigs. The gene is approximately 5.4 kb in length, is composed of 7 exons, and has a coding sequence containing 1134 bp. The gene was mapped using the INRA-Minnesota porcine radiation hybrid (IMpRH) panel to chromosome 1, with SW65 as the closest marker (41 cR; LOD = 7.73). Differences were observed in tissue-specific expression of ACTC1 that was studied by transcription profiling in 28 porcine tissues. Developmental differences in muscle and heart were analysed by real-time quantitative PCR (RT-qPCR). Two single nucleotide polymorphisms (SNPs) were found in intron 1. One adequately informative SNP (FM212567.1:g.901C>G) was genotyped by PCR-restriction fragment length polymorphism, and allele frequencies in eight pig breeds were calculated. [ABSTRACT FROM AUTHOR]

Spermatogenesis has a close relationship with male infertility. MicroRNAs (miRNAs) play crucial roles in their regulation of target genes during spermatogenesis. A huge dataset of high-throughput sequencing all over the world provides the basis to dig the cryptic molecular mechanism. But how to take advantage of the big data and unearth the miRNA regulation is still a challenging problem. Here we integrated transcriptome of spermatogenesis and found miRNA regulate spermatogenesis through miRNA editing. We then compared different species and found that the distributions of miRNA editing site number and editing types among different cell types during spermatogenesis are conservative. Interesting, we further found that nearly half of the editing events occurred in the seed region in both mouse and pig. Finally, we foundmiR-34c, which is edited frequently at all stages during spermatogenesis, regulates its target genes through the RNA structure changing and shows dysfunction when it is edited. Summary, we depicted the overall profile of miRNA editing during spermatogenesis in mouse and pig and reveal miR-34c may play its roles through miRNA editing. [ABSTRACT FROM AUTHOR]

The aim of the study was to investigate the SINE polymorphism in Xiang, Kele, Qianbei black, Jiangkouluobo, Large White, and Duroc pig breeds. The PCR based detection method was conducted to identify the short interspersed nuclear element (SINE) polymorphism in the PDIA 4 gene. There were greater frequencies of the SINE−/− genotypes in Xiang pigs (55.9%) as compared with other pig breed groups. There was an association between this 275 bp SINE polymorphism and litter size ( P  = 0.003). The homozygous SINE+/+ genotype of the PDIA 4 gene had a 1.45-piglets larger litter sizes compared to those with the homozygous SINE−/− genotype. Furthermore, there were assessments of mRNA and protein abundances as a result of PDIA 4 gene expression in the ovaries of Xiang pigs for the three different SINE genotypes, and the results indicated that relative abundances of PDIA 4 mRNA and protein was greater for the SINE−/− and SINE−/+ genotypes compared with the SINE+/+ genotype ( P  < 0.05). These findings suggested that the 275 bp SINE polymorphism might change the expression of the PDIA 4 gene and could be used as a candidate DNA marker for the selection for litter size in Xiang pigs. [ABSTRACT FROM AUTHOR]

Heat shock protein 90 (Hsp90) functions as a molecular chaperone in its interaction with clients to influence multiple cellular and physiological processes. However, our current understanding on Hsp90's relationship with mammalian oocyte maturation is still very limited. Here, we aimed to investigate Hsp90's effect on pig oocyte meiotic maturation. Endogenous Hsp90a was constantly expressed at both mRNA and protein levels in porcine maturing oocytes. Addition of 2 µM 17-allylamino-17-demethoxygeldanamycin (17-AAG), the Hsp90 inhibitor, to in vitro mature cumulus-oocyte complexes (COC) significantly decreased Hsp90a protein level (P < 0.05), delayed germinal vesicle breakdown (GVBD) (P < 0.05), and impeded the first polar body (PB1) extrusion (P < 0.01) of porcine oocytes. 2 µM 17-AAG treatment during in vitro maturation also decreased the subsequent development competence as indicated by the lower cleavage (P < 0.001) and higher fragmentation (P < 0.001) rates of parthenotes, whereas no effects on the percentage and average cell number of blastocysts were found. Immunodepletion of Hsp90a by antibody microinjection into porcine oocytes at germinal vesicle and metaphase II stages induced similar defects of meiotic maturation and parthenote development, to that resulted from 2 µM inhibitor 17-AAG. For oocytes treated by 2 µM 17-AAG, the cytoplasm and membrane actin levels were weakened (P < 0.01), and the spindle assembly was disturbed (P < 0.05), due to decreased p-ERK1/2 level (P < 0.05). However, the mitochondrial function and early apoptosis were not affected, as demonstrated by rhodamine 123 staining and Annexin V assays. Our findings indicate that Hsp90a can couple with mitogen-activated protein kinase to regulate cytoskeletal structure and orchestrate meiotic maturation of porcine oocytes. [ABSTRACT FROM AUTHOR]

A total of 757 pigs (PIC 337 × 1050; initially 27.6 kg BW) were used in a 117-d experiment to determine the effects of added Cu from tribasic copper chloride and diet type on growth performance, carcass characteristics, energy digestibility, gut morphology, and mucosal mRNA expression of finishing pigs. Pens of pigs were allotted to 1 of 4 dietary treatments, balanced on average pen weight in a randomized complete block design with 26 to 28 pigs per pen and 7 replications per treatment. Treatments were arranged in a 2 × 2 factorial with main effects of diet type, a corn-soybean meal-based diet (cornsoy) or a high by-product diet (by-product) with 30% distillers dried grains with solubles (DDGS) and 15% bakery meal, and added Cu (0 or 150 mg/kg added Cu). There were no Cu × diet type interactions for growth performance. Overall, neither added Cu nor diet type influenced growth performance. However, caloric efficiency was decreased (P = 0.001) for pigs fed the by-product diet compared to the corn-soy diet. Pigs fed the by-product diet had decreased (P < 0.05) carcass yield and carcass G:F) and marginally decreased (P < 0.07) HCW and carcass ADG compared to pigs fed the corn-soy diet. A Cu × diet type interaction (P < 0.05) existed for DM and GE digestibility during the early finishing period as added Cu improved (P < 0.05) digestibility of DM and GE in the corn-soy diet, but not in the by-product diet. During the late finishing period, added Cu marginally increased (P = 0.060) DM and GE digestibility while pigs fed the by-product diet had decreased DM and GE digestibility (P = 0.001) compared to those fed the corn-soy diet. For gut morphology, pigs fed added Cu had decreased crypt depth (P = 0.017) in the distal small intestine compared to those fed no added Cu. Furthermore, relative mRNA expression of intestinal fatty acid binding protein (iFABP) was decreased (P = 0.032) in pigs fed added Cu compared to those fed no added Cu. In summary, adding 150 mg/kg added Cu or including 30% DDGS and 15% bakery meal into a corn-soy diet did not influence growth performance. However, HCW ADG and HCW G:F were reduced in pigs fed the by-product diet compared to the corn-soy diet. Only minor differences in gut morphology or mRNA expression were observed from feeding diets with high levels of Cu or by-products compared to a corn-soy diet. [ABSTRACT FROM AUTHOR]

Asian and European wild boars were independently domesticated ca. 10,000 yr ago. Since the 17th century, Chinese breeds have been imported to Europe to improve the genetics of European animals by introgression of favorable alleles, resulting in a complex mosaic of haplotypes. To interrogate the structure of these haplotypes further, we have run a new haplotype segregation analysis based on information theory, namely compression efficiency (CE). We applied the approach to sequence data from individuals from each phylogeographic region (n = 23 from Asia and Europe) including a number of major pig breeds. Our genome-wide CE is able to discriminate the breeds in a manner reflecting phylogeography. Furthermore, 24,956 nonoverlapping sliding windows (each comprising 1,000 consecutive SNP) were quantified for extent of haplotype sharing within and between Asia and Europe. The genome-wide distribution of extent of haplotype sharing was quite different between groups. Unlike European pigs, Asian pigs haplotype sharing approximates a normal distribution. In line with this, we found the European breeds possessed a number of genomic windows of dramatically higher haplotype sharing than the Asian breeds. Our CE analysis of sliding windows captures some of the genomic regions reported to contain signatures of selection in domestic pigs. Prominent among these regions, we highlight the role of a gene encoding the mitochondrial enzyme LACTB which has been associated with obesity, and the gene encoding MYOG a fundamental transcriptional regulator of myogenesis. The origin of these regions likely reflects either a population bottleneck in European animals, or selective targets on commercial phenotypes reducing allelic diversity in particular genes and/or regulatory regions. [ABSTRACT FROM AUTHOR]

Objective: Genome wide association study was conducted to identify and validate candidate genes associated with fatty acid composition of pork. Methods: A total of 480 purebreed Duroc pigs were genotyped using IlluminaPorcine60k bead chips while the association test was implemented following genome-wide rapid association using Mixed Model and Regression-Genomic Control (GRAMMAR-GC) approach. Results: A total of 25, 29, and 16 single nucleotide polymorphisms (SNPs) were significantly associated with stearic (18:0), oleic (18:1) and saturated fatty acids (SFA), respectively. Genome wide significant variants were located on the same region of swine chromosome 14 (SSC14) that spanned from 120 to 124 Mb. Top SNP ALGA008191 was located at 5 kb near the stearoyl-CoA desaturase (SCD) gene. This gene is directly involved in desaturation of stearic acid into oleic acid. General relationship of significant SNPs showed high linkage disequilibrium thus genome-wide signals was attributed to SCD gene. However, understanding the role of other genes like elongation of very long chain fatty acids-3 (ELOVL3) located on this chromosomal segment might help in further understanding of metabolism and biosynthesis of fatty acids. Conclusion: Overall, this study provides evidence that validates SCD gene as strong candidate gene associated with fatty acid composition in Duroc pigs. Moreover, this study confirms significant SNPs near ELOVL3 gene. [ABSTRACT FROM AUTHOR]

Abstract: Simulated and swine industry data sets were utilized to assess the impact of removing older data on the predictive ability of selection candidate estimated breeding values (EBV) when using single‐step genomic best linear unbiased prediction (ssGBLUP). Simulated data included thirty replicates designed to mimic the structure of swine data sets. For the simulated data, varying amounts of data were truncated based on the number of ancestral generations back from the selection candidates. The swine data sets consisted of phenotypic and genotypic records for three traits across two breeds on animals born from 2003 to 2017. Phenotypes and genotypes were iteratively removed 1 year at a time based on the year an animal was born. For the swine data sets, correlations between corrected phenotypes (Cp) and EBV were used to evaluate the predictive ability on young animals born in 2016–2017. In the simulated data set, keeping data two generations back or greater resulted in no statistical difference (p‐value > 0.05) in the reduction in the true breeding value at generation 15 compared to utilizing all available data. Across swine data sets, removing phenotypes from animals born prior to 2011 resulted in a negligible or a slight numerical increase in the correlation between Cp and EBV. Truncating data is a method to alleviate computational issues without negatively impacting the predictive ability of selection candidate EBV. [ABSTRACT FROM AUTHOR]

Widely used antipig CD4 monoclonal antibodies (mAbs) fail to recognize CD4 alleles characteristic of miniature pig lines such as the National Institutes of Health (NIH) miniature pigs and microminipigs. We surveyed polymorphisms in the coding sequence of the porcine CD4 gene among Western and Oriental pig breeds and Japanese wild boars and investigated their distribution. Of the 13 alleles that we identified among the 47 animals, 2 in group I and 3 in group II were found exclusively in Western breed pigs. Group IV alleles, which included mAb-nonbinding alleles, were found frequently in Oriental breed pigs, suggesting that the mAb-nonbinding allele arose from the gene pool of Oriental pigs. Group IV alleles were also found in Duroc and Large White pigs, suggesting genetic inflow from Oriental pig breeds into Western breeds. Comparison of the CD4 sequences of species in Cetartiodactyla suggested that the group IV alleles in Sus scrofa occurred before the divergence of this species from the other artiodactyls. The different antibody specificities of the various CD4 alleles may facilitate the discrimination of T-cell populations in transplantation studies using miniature pigs. The significance of the preservation of CD4 polymorphisms to immune function in pigs warrants further investigation. [ABSTRACT FROM AUTHOR]

Skeletal myoblast differentiation is controlled by a multitude of transcription factors and signal pathways. Myogenin is a critical transcriptional regulator in the initiation and maintenance of myoblast differentiation. The Akt/FoxO1 signal pathway plays an important role in myoblast differentiation. MicroRNAs are a kind of small noncoding RNAs that have been regarded as important regulators in skeletal muscle cell proliferation and differentiation. The objective of this study was to investigate the effects of microRNA-27a (miR-27a) on myogenin expression and Akt/FoxO1 signal pathway during porcine myoblast differentiation. Here, we found that the expression of miR-27a was gradually diminished at the early differentiation stage and then rebounded. Overexpression of miR-27a suppressed the mRNA and protein expression levels of myogenin during porcine myoblast differentiation, whereas inhibition of miR-27a promoted the mRNA and protein expression levels of myogenin. In addition, overexpression of miR-27a decreased the level of P-Akt/Akt and increased the protein level of FoxO1; however, inhibition of miR-27a increased the level of P-Akt/Akt and decreased the protein level of FoxO1. The present study demonstrated that miR-27a could inhibit myogenin expression and Akt/FoxO1 signal pathway during porcine myoblast differentiation. [ABSTRACT FROM AUTHOR]

Considering that macrophage functions are strongly impacted by the local tissue environment and the type of immune response, the aim of this study was to carefully set the methodological baseline for phenotype and functions of polarized porcine monocyte-derived macrophages. To this end, macrophages were generated in autologous serum alone or with colony-stimulating factor (CSF)-1 or CSF-2, and subsequently polarized with interferon (IFN)γ, interleukin-4 or IFNβ. IFNγ promoted expression of MHC class I, MHC class II, CD11a, and CD40 as well as LPS-induced IL-6 and IL-12. A hallmark of interleukin-4 was Arginase 1 and CD203a upregulation, without abrogating pro-inflammatory cytokine production. IFNβ induced CD169, MHC class I, CD40, CD80/86, but suppressed IL-6, IL-12 and tumor-necrosis-factor secretion. CSF-2 alone altered macrophage differentiation and promoted an IFNγ-like polarization. Altogether, the results provide a comprehensive overview of porcine macrophage polarization, and demonstrate commonalities with other species as well as peculiarities of the pig. [ABSTRACT FROM AUTHOR]

As a result of selecting for increased litter size, newborn piglets are being born lighter and have a lower chance of survival. Raising fewer pigs to market weight would have a negative impact on the industry and farmer profitability; thus, understanding the genetics of individual growth performance traits will determine whether these traits will play an important role in pig breeding schemes. This study aimed to estimate genetic parameters for individual birth weight (BW), weaning weight (WW), and probe weight (PW) in Canadian-purebred Yorkshire and Landrace pigs. PW is a live weight taken at the time of the ultrasound measurements, when pigs weigh about 100 kg. Data were collected from 2 large and related breeding herds from 2003 to 2015. Four linear animal models were used, which included the following: Model 1-direct additive genetic effect; Model 2-direct additive genetic and maternal genetic effect; Model 3-direct additive genetic and common litter effect; and Model 4-direct additive genetic, maternal genetic, and common litter effect. The model which included all 3 random effects (Model 4) was determined to be the best fit to the data. Low to moderate direct heritability estimates were observed as follows: 0.15 ± 0.03 for BW, 0.04 ± 0.01 for WW, and 0.33 ± 0.03 for PW for the Yorkshire breed; and 0.05 ± 0.01 for BW, 0.01 ± 0.01 for WW, and 0.27 ± 0.03 for PW in the Landrace breed. As expected, the direct heritability estimates increased with age as a result of decreased maternal influence on the trait. Bivariate animal models were also used to estimate genetic and environmental correlations between traits. Strong direct genetic correlations were observed between BW and WW in both breeds. Based on the estimates of genetic parameters, individual BW could be evaluated and considered in breeding programs aiming to increase BW and improve subsequent performance. Different selection emphasis could also be applied on direct and maternal additive genetic effects on BW to optimize the breeding programs and improve selection efficiency. [ABSTRACT FROM AUTHOR]

Background Macrophages play an important role in the innate immune system as part of the mononuclear phagocyte system (MPS). They have a pro-inflammatory signature (M1-polarized macrophages) or anti-inflammatory signature (M2-polarized macrophages) based on expression of surface receptors and secretion of cytokines. However, very little is known about the culture of macrophages from pigs and more specific about the M1 and M2 polarization in vitro . Methods Porcine monocytes or mononuclear bone marrow cells were used to culture M1- and M2-polarized macrophages in the presence of GM-CSF and M-CSF, respectively. Surface receptor expression was measured with flow cytometry and ELISA was used to quantify cytokine secretion in response to LPS and PAM 3 CSK 4 stimulation. Human monocyte-derived macrophages were used as control. Results Porcine M1- and M2-polarized macrophages were cultured best using porcine GM-CSF and murine M-CSF, respectively. Cultures from bone marrow cells resulted in a higher yield M1- and M2-polarized macrophages which were better comparable to human monocyte-derived macrophages than cultures from porcine monocytes. Porcine M1-polarized macrophages displayed the characteristic fried egg shape morphology, lower CD163 expression and low IL-10 production. Porcine M2-polarized macrophages contained the spindle-like morphology, higher CD163 expression and high IL-10 production. Conclusion Porcine M1- and M2-polarized macrophages can be most efficiently cultured from mononuclear bone marrow cells using porcine GM-CSF and murine M-CSF. The new culture method facilitates more refined studies of porcine macrophages in vitro, important for both porcine and human health since pigs are increasingly used as model for translational research. [ABSTRACT FROM AUTHOR]

Objective: The genetic effects of an individual on the phenotypes of its social partners, such as its pen mates, are known as social genetic effects. This study aims to identify the candidate genes for social (pen-mates') average daily gain (ADG) in pigs by using the genome-wide association approach. Methods: Social ADG (sADG) was the average ADG of unrelated pen-mates (strangers). We used the phenotype data (16,802 records) after correcting for batch (week), sex, pen, number of strangers (1 to 7 pigs) in the pen, full-sib rate (0% to 80%) within pen, and age at the end of the test. A total of 1,041 pigs from Landrace breeds were genotyped using the Illumina PorcineSNP60 v2 BeadChip panel, which comprised 61,565 single nucleotide polymorphism (SNP) markers. After quality control, 909 individuals and 39,837 markers remained for sADG in genome-wide association study. Results: We detected five new SNPs, all on chromosome 6, which have not been associated with social ADG or other growth traits to date. One SNP was inside the prostaglandin F2α receptor (PTGFR) gene, another SNP was located 22 kb upstream of gene interferon-induced protein 44 (IFI44), and the last three SNPs were between 161 kb and 191 kb upstream of the EGF latrophilin and seven transmembrane domain-containing protein 1 (ELTD1) gene. PTGFR, IFI44, and ELTD1 were never associated with social interaction and social genetic effects in any of the previous studies. Conclusion: The identification of several genomic regions, and candidate genes associated with social genetic effects reported here, could contribute to a better understanding of the genetic basis of interaction traits for ADG. In conclusion, we suggest that the PTGFR, IFI44, and ELTD1 may be used as a molecular marker for sADG, although their functional effect was not defined yet. Thus, it will be of interest to execute association studies in those genes. [ABSTRACT FROM AUTHOR]

Objective: An experiment was conducted to identify and characterize the circular RNA expression and metabolic characteristics in the liver of Jinhua pigs and Landrace pigs. Methods: Three Jinhua pigs and three Landrace pigs respectively at 70-day were slaughtered to collect the liver tissue samples. Immediately after slaughter, blood samples were taken to detect serum biochemical indicators. Total RNA extracted from liver tissue samples were used to prepare the library and then sequence on HiSeq 2500. Bioinformatic methods were employed to analyze sequence data to identify the circRNAs and predict the potential roles of differentially expressed circRNAs between the two breeds. Results: Significant differences in physiological and biochemical traits were observed between growing Jinhua and Landrace pigs. We identified 84,864 circRNA candidates in two breeds and 366 circRNAs were detected as significantly differentially expressed. Their host genes are involved in lipid biosynthetic and metabolic processes according to the gene ontology analysis and associated with metabolic pathways. Conclusion: Our research represents the first description of circRNA profiles in the porcine liver from two divergent phenotype pigs. The predicted miRNA-circRNA interaction provides important basis for miRNA-circRNA relationships in the porcine liver. These data expand the repertories of porcine circRNA and are conducive to understanding the possible molecular mechanisms involved in miRNA and circRNA. Our study provides basic data for further research of the biological functions of circRNAs in the porcine liver. [ABSTRACT FROM AUTHOR]

Summary: Economic values (EVs) of traits, accounting for environmental impacts and risk preferences of farmers, are required to design breeding goals that contribute to both economic and environmental sustainability. The objective of this study was to assess the effects of incorporating environmental costs and the risk preferences of farmers on the EVs of pig breeding goal traits. A breeding goal consisting of both sow efficiency and production traits was defined for a typical Brazilian farrow‐to‐finish pig farm with 1,500 productive sows. A mean‐variance utility function was employed for deriving the EVs at finishing pig level assuming fixed slaughter weight. The inclusion of risk and risk aversion reduces the economic weights of sow efficiency traits (17%) while increasing the importance of production traits (7%). For a risk‐neutral producer, inclusion of environmental cost reduces the economic importance of sow efficiency traits (3%) while increasing the importance of production traits (1%). Genetic changes of breeding goal traits by their genetic standard deviations reduce emissions of greenhouse gases, and excretions of nitrogen and phosphorus per finished pig by up to 6% while increasing farm profit. The estimated EVs could be used to improve selection criteria and thereby contribute to the sustainability of pig production systems. [ABSTRACT FROM AUTHOR]

In this study, data genotyping by sequence (GBS) was used to perform single step GWAS (ssGWAS) to identify SNPs associated with the litter traits in domestic pigs and search for candidate genes in the region of significant SNPs. After quality control, 167,355 high-quality SNPs from 532 pigs were obtained. Phenotypic traits on 2112 gilt litters from 532 pigs were recorded including total number born (TNB), number born alive (NBA), and litter weight born alive (LWB). A single-step genomic BLUP approach (ssGBLUP) was used to implement the genome-wide association analysis at a 5% genome-wide significance level. A total of 8, 23 and 20 significant SNPs were associated with TNB, NBA, and LWB, respectively, and these significant SNPs accounted for 62.78%, 79.75%, and 58.79% of genetic variance. Furthermore, 1 (SSC14: 16314857), 4 (SSC1: 81986236, SSC1: 66599775, SSC1: 161999013, and SSC1: 267883107), and 5 (SSC9: 29030061, SSC2: 32368561, SSC5: 110375350, SSC13: 45619882 and SSC13: 45647829) significant SNPs for TNB, NBA, and LWB were inferred to be novel loci. At SSC1, the AIM1 and FOXO3 genes were found to be associated with NBA; these genes increase ovarian reproductive capacity and follicle number and decrease gonadotropin levels. The genes SLC36A4 and INTU are involved in cell growth, cytogenesis and development were found to be associated with LWB. These significant SNPs can be used as an indication for regions in the Sus scrofa genome for variability in litter traits, but further studies are expected to confirm causative mutations. [ABSTRACT FROM AUTHOR]

A whole-genome association study was performed using the PorcineSNP60 BeadChip and Bayesian statistical method Bayes B for litter size and litter weight traits in sows from a divergent selection experiment for residual feed intake. A total of 12 traits of litter size and litter weight at birth and weaning were included for the first two parities. We report associations of informative QTL and genes associated with each trait. Different QTL and genes had impact on traits in first and second parity. Most of the important multiple trait genomic regions in first parity were found to be associated with litter weight traits at birth. Genes in the identified regions are involved in implantation and placenta (e.g. PPP3CA, ARHGEF17, KLF17 and RNU5A-1 ) and in energy metabolism (e.g. , UCP2/3, MRPL48, GLO1, and MKK6 ). The QTL associated with litter size at birth and weaning contained genes involved in embryo development and energy balance during lactation (e.g. SCO1, SEMA5A, and ABHD5 ). Most of the important multiple trait genomic regions for second parity were found to be associated with litter size traits at birth. The regions contain genes for endometrium, placenta and embryonic development (e.g. ZCCHC7, RG9MTD3, LRIG3, TIGD1, and TCP-1 ). The QTL that contained genes related to placenta, embryonic development and long-term stress (e.g. FTL, NT5C3, and AVL9 ) were associated with litter weight traits at birth. Further validation studies on larger populations will improve our understanding of the complex genetic basis of litter size and weight traits. [ABSTRACT FROM AUTHOR]