Search

Using micromachining techniques, a miniature time-of-flight mass spectrometer (TOF-MS) was fabricated which consisted of ion-source and ion-separator plates. The dimension of the assembled device was 11 mm times 11 mm times1.1 mm. The key part of the ion source was a triode electron emitter with a planar carbon-nanoparticle (CNP) cathode. CNP was one of the best cathode materials to build triode electron emitters because of the smooth surface morphology of CNP films in addition to their excellent emission characteristics which allowed low turn-on gate voltage and stable operation. The operation of each plate was confirmed successfully through separate tests. In particular, ion generation was verified via electron bombardment for ambient air and acetone molecules.

The coupling between ferroelectric distortions and electron transport is an important factor in understanding ferroelectric/noncentrosymmetric materials with metallic conductivities and ferroelectric-based thermoelectrics. Here, multiple d0 ferroelectrics with a variety of crystal structures are doped via oxygen deficiency, resulting in metallic-like conduction in the paraelectric state. It is found that most of the studied systems show a metallic-like to nonmetallic transition near the paraelectric-ferroelectric transition. The metallic-like to nonmetallic transition temperature can be shifted using mechanisms that shift the paraelectric-ferroelectric transition temperature. It was found that the metallic-like to nonmetallic transition temperature could be shifted from 373 K to 273 K by varying (Ba1−xSrx)TiO3−δ from x = 0 to x = 0.3 and x = 1. The most probable mechanism for ferroelectric-electron transport coupling was determined to be Anderson localization associated with polarization with short-range ...

399 Background: By definition, primary adenocarcinoma of the bladder (PAB) is a malignant neoplasm derived from urothelium of the bladder showing histologically pure glandular differentiation. Because of its rarity, role of chemotherapy for metastatic adenocarcinoma of bladder is still questionable. Therefore, we performed a retrospective analysis of the clinical features and chemotherapy outcomes of metastatic PAB to evaluate the clinical findings at presentation, overall survival (OS) and progression-free survival (PFS) and prognostic factors. Methods: Eligible patients for this retrospective analysis were initially diagnosed with adenocarcinoma and presented with a clinically no other primary site of origin. The collected data included age, gender, performance status, stage, hemoglobin, albumin, initial date of diagnosis, treatment modality utilized, response to treatment, presence of relapse, last status of patient, and last date of follow-up. Results: We retrospectively reviewed 29 patients who treated with chemotherapy as metastatic PAB at 10 Korean medical institutions from 2004 to 2014.The median age of patients was 58 years (range, 17 to 78 years) and 51.7% of the patients were female. Fifteen patients were urachal adenocarcinoma. Of 27 symptomatic patients, 22 experienced gross hematuria. Ten patients had two or more metastatic sites of the lungs (51.7%), peritoneum (41.4%), and ovary (20.7%), as the most common sites. Twelve patients were treated with 5-FU based chemotherapy, 5 were gemcitabine based, 3 were taxane and adriamycin based, and others. 13 of them achieved CR (10.3%) or PR (34.5%). Median PFS and OS for all patients were 10.6 months (95% confidence interval [CI], 9.5 to 11.6 months) and 24.5 months (95% CI, 1.2 to 47.8 months), respectively. In the prognostic factor analysis, the cases of urachal adenocarcinoma had worse tendency in PFS and OS (p=0.024 and P=0.046, respectively). Conclusions: Metastatic Despite most of chemotherapy, PFS and OS were short especially in urachal carcinoma, however, there were some long-term survivors, therefore, additional research on the predictive markers of several clinical, pathological differences and their treatments will be needed.

462 Background: In a subset of patients with metastatic renal cell carcinoma (RCC), primary resistance to first VEGF targeted therapy is not fully understood, and the optimal treatment approach for these patients is still controversial. This study was aimed to characterize the primary sunitinib resistant patients and associated predicting factors. Methods: A total of 134 patients with recurrent or metastatic RCC, who were initially treated with sunitinib, consecutively selected from 4 centers in Korea, between January 2008 and March 2013. Patients in whom progressive disease (PD) was the best response during treatment with sunitinib were included in the primary sunitinib resistant group. Results: Among 134 patients, 33 (25%) patients primary resistant to sunitinib with a median age of 59 years (range, 28-78) were identified. Most patients had clear cell histology (94%) and good ECOG performance status (0, 1) (82%). According to MSKCC risk, 25% of patients were at favorable risk, 72% at intermediate risk, and 3% at poor risk. Univariate analysis revealed that poor performance status (ECOG≥2), elevated LDH, neutrophilia, and higher number of distant metastatic disease (≥3) and bone or hepatic metastasis were significant factors associated with intrinsic resistant disease. Neutrophilia (OR=7.4, p=0.015) and more than three distant metastatic disease (OR=3.6, p=0.031) were independently significant risk factors of predicting intrinsic resistant disease on multivariate analysis. There was statistically significant difference with regard to overall survival (median, 11.7 vs. 31.1 month; p=0.001) and progression free survival (median, 2.4 vs. 12.5 month; p

185 Background: Trastuzumab-based chemotherapy became the standard option for patients with HER2 (+) metastatic gastric cancer after ToGA study. However, the OS benefit was not found in Asian and diffuse-type cancer patients. The aim of the current study is to analyze whether Asian ethnicity or poorly differentiated histology (PDH) affects the clinical outcomes of patients who were treated with trastuzumab-based chemotherapy. Methods: We collected the medical records of the patients with HER2 (+) (IHC3+ or IHC2+&FISH+) gastric/GEJ cancer who were treated with trastuzumab-based chemotherapy. The ORR, PFS, and OS were compared according to the patients’ clinicopathologic features and data from ToGA trial. Results: From March 2012 to June 2014, data of 163 Asian patients from 11 institutes in South Korea were collected. The median age was 60 (range 27-85) and the male:female ratio was 116 (71.2%):47 (28.8%). 157 (96.3%) had stomach cancer and 6 (3.7%) had GEJ cancer. Fourteen (8.6%), 62 (38.0%), 71 (43.6%) and 11 (6.7%) patients had well, moderately, poorly differentiated tubular adenocarcinoma (TAC) and signet ring cell carcinoma (SRC), respectively. The ORR was 52.7% (86/163) which is similar to that of the ToGA trial. (47%) The median PFS was 9.8 months (95% CI 8.6 – 11.0 and the median OS was 18.5 months. (95% CI 16.5 – 20.5) These numerical data are slightly better than those of the ToGA trial. (PFS, 6.7 months; OS, 16.0 months) Next, we investigated if PDH (poorly differentiated TAC + SRC) affected on clinical outcomes. The ORR (50.0% vs. 56.6%, p = 0.408) and the PFS (8.8 months vs. 11.2 months, p = 0.109) were slightly inferior in PDH patients but still, they were better than that of the ToGA trial. The median OS was significantly shorter for PDH patients (14.1 months vs. 19.0 months, p = 0.046). Conclusions: While subset analysis of ToGA trial has demonstrated that trastuzumab-based chemotherapy may not be beneficial for Asian ethnicity and poorly differentiated histology, our real world data suggested that even in Asian and patients with PDH, trastuzumab-based chemotherapy is associated with improved clinical outcomes in patients with HER2 (+) gastric cancer.

Carbon nanofiber (CNF) films were synthesized using electroplated Ni catalysts on Au buffer layer. The maximum emission current was measured to be 3.67 mA at an electric field of 12.5 V//spl mu/m from the area of 4.9/spl times/10/sup -3/ cm/sup 2/, which correspond to the very high emission current density of 750 mA/cm/sup 2/. The peculiar hysteresis in emission currents corresponding to anode-voltage ramping direction leads to the proposal that the observed emission behavior of CNFs stemmed from the adsorption and desorption of adsorbates during emission measurements. Field-emission measurements with various voltage-sweep speed and time evolution supported the picture of adsorbate-related emission.

In this paper, the emission I-V of the carbon nanotube (CNT) and carbon nanoparticle (CNP) films have been mapped using a micro-tip anode and the asymmetric distribution of field enhancement factor, /spl beta/, have been deduced from the symmetric distribution of turn-on field. The field enhancement factors, which have been deduced from the fitting of I-V curves measured at 100 different locations to the Fowler-Nordheim (F-N) equation with the series-resistance effect, have confirmed the asymmetric distribution. Moreover, some characteristics of the emission measurements with a macroscopic anode, such as the slight curvature of F-N plots at low voltage regime and the exponential increase of emission site density (ESD), were found to be consistent with the asymmetric /spl beta/ distribution.

This paper reports the fabrication and experiment of a micro time of flight (TOF) mass spectrometer adopting a new ion generation method using a carbon nanostructure. The device is composed of an ion source and an ion separator. The ion source generates electrons by the field emission method. Carbon nanostructure has good field emission property. The emitted electrons collide with sample molecules and ionize the sample molecules. These ions are accelerated by separator. The current output signal is generated when the ions reach the ion detector in the order of mass size. The size of the assembled micro TOF mass spectrometer is 11 times 11 times 1 mm3. The experiment is performed in a vacuum chamber. The sample gas is introduced to the chamber and suitable voltages are applied to separation electrodes for the ion acceleration. Then we observe the current signal from the ion detector. The experimental result verifies the feasibility of the ion source and the ion separator included in the fabricated micro mass spectrometer

The suppression of gate current was realized by introducing an extra conducting layer between gate-insulators and cathode layers. A new type of triode emitters were fabricated, in which carbon emitter layers were positioned at the central part of the well bottom formed in silicon well structures. The silicon well structure was formed using reactive ion etching (RIE). Because of the favorable field distribution using heavily doped /spl eta/-type silicon, we were able to suppress the gate current almost completely.

Carbon nanotube (CNT) films were grown via hot-filament chemical-vapor deposition on silicon substrate covered with electroplated nickel catalyst. This resulted in less crystalline and defect rich carbon nanofibers (CNF). Scanning electron microscopy and FT-Raman spectra of the CNF films showed that a high density of CNFs was formed and that it was constituted of well-ordered graphene layer. High current density of 170 mA/cm/sup 2/ at 7.3 V//spl mu/m was obtained from field emission. Emission-stability test carried out at the current density of 20 mA/cm/sup 2/ showed stable emission currents with fluctuation of only 3.4% over 2 hours.

We used a quadrupole mass spectrometer (QMS) to investigate the dissociation of source gases and the generation of radical species during the hot-filament chemical vapor deposition (HFCVD) process at various methane and ammonia concentrations. Since the HFCVD was carried out at the working pressure of 30 Torr, a capillary tube and a 5 μm pinhole were installed to sample the small amount of gas from the HFCVD chamber to the differentially pumped QMS at the vacuum level of 5×10−6 Torr. An investigation of the systematic variations in mass spectra corresponding to the increase of methane concentration in the ammonia-free source gases revealed substantial generation of chemical species containing two carbon atoms. However, an increase of ammonia concentration in the source gas with 20% of methane resulted in generation of nitrogen containing radicals such as CN and HCN, together with the suppression of two-carbon radicals. An implication of observed mass-spectrum variation for the growth behavior of carbon na...

We modified the structure of the triode field emitters with planar carbon nanoparticle cathodes to reduce the gate currents. As it turned out a simple insertion of an extra metal layer between the gate insulator and the cathode layer was sufficient for the substantial reduction of gate currents; the gate currents of the triode emitter with the modified structure never exceeded 4% of the anode currents up to the anode currents of /spl sim/250 nA corresponding to the gate voltage of 67 V and the anode voltage 900 V. The fabrication of the modified triode structure required only two extra processing steps together with the conventional photolithography. We were able to account for the gate-current reduction in terms of the modification in the electric field distribution.

We prepared iron-impregnated silica films, which turned out to be very efficient catalysts for carbon nanotube synthesis, by a sol-gel process starting from the mixture of tetraethyl orthosilicate (TEOS), aqueous solution of iron nitrate (Fe(NO3)3⋅9H2O), and ethanol. The Fe/silicate-composite catalyst films consisted of nanoparticles, the composition and diameter of which depended on the iron-nitrate molarity in aqueous solution. Within the range of 0.5–1.5 M, the nanocomposite particles maintained good catalytic capacity, and very long and dense bundles of multiwall carbon nanotubes were synthesized regardless of the iron-nitrate molarity. The carbon nanotube density was so high that the nanotube bundles appeared made of aligned nanotubes in spite of the curliness of the individual nanotubes. However, carbon nanotubes were scarcely synthesized below 0.4 M of iron-nitrate molarity, which we attributed to the unfavorable composition and distribution of Fe-species in nanocomposite particles.

To identify the deposition conditions that can minimize the nanotube density in the nanostructured carbon films without compromising the emission properties, we carried out a systematic investigation of the effect of deposition conditions on the emission properties and the structure of the nanostructured carbon films. Catalyst-layer thickness, methane concentration, deposition time, deposition pressure, and substrate temperature were the main deposition parameters we investigated. Within the parameter range for nanoparticle-dominant growth, substrate temperature and deposition time were the two factors that had the largest effect on the variation of the turn-on field. However, catalyst-layer thickness and methane concentration turned out to be the factors allowing the minimization of nanotube density with rather small concomitant variations of the turn-on field. A 50 h test showed that the emission stability of a nanoparticle film was better than that of a multiwall nanotube film with comparable emission ...

We investigated the structural variation and the concomitant change in the emission characteristics of HFCVD-grown nanostructured carbon films induced by the addition of ammonia to source gases; nanostructured films were the mixture of nanotubes and nanoclusters. As the concentration of ammonia was increased, large structural variation, including the increase of disorder in the atomic bonding and the decrease in size of graphitic sheets making up nanotubes and nanoparticles, was observed. Moreover, changes in the emission properties corresponding to the structural degradation was observed.

Introduction Although several previous studies addressed the role of radiation in treating localized diffuse large B-cell lymphoma (DLBCL), chemotherapy alone has shown promising efficacy with the emergence of Rituximab. Thus, we evaluated the clinical efficacy outcomes and failure patterns of patients with localized DLBCL according to two different treatment strategies, either 6 or more cycles of R-CHOP chemotherapy alone or 3 or 4 cycles of R-CHOP followed by involved field radiotherapy (IFRT). Methods A prospectively collected database from 21 tertiary centers participating the Consortium for Improving Survival of Lymphoma (CISL), built up for PROCESS study (NCT01202448) for secondary central nervous system involvement in DLBCL, was recruited for current study in addition to the Asan Medical Center (AMC) Lymphoma Registry. CISL database and AMC lymphoma registry consisted of data from patients with newly diagnosed DLBCL between August 2010 and August 2012, and between February 2004 and February 2012, respectively. Inclusion criteria were localized (stage I or II), non-bulky ( Results A total of 357 patients (CISL prospective cohort: 161 patients, AMC registry: 196 patients) were eligible for the analyses. Two hundred ninety nine patients (83.5%) received 6 or more cycles of R-CHOP chemotherapy alone, and 58 patients (16.2%) underwent 3 or 4 cycles of R-CHOP followed by IFRT. Median age was 54 years (range, 16-87). During the median follow-up of 24 months (range, 4-116 months), 35 patients (9.8%) experienced relapse, and 22 patients (6.1%) died. Two-year OS and EFS rate was 94.7% and 89.9%, respectively, and 345 out of 357 patients (96.6%) achieved CR. Comparing R-CHOP alone to R-CHOP plus RT group, there was no significant difference in clinicopathologic parameters. R-CHOP alone could achieve significantly higher CR rate of 97.7 % than 91.4% of R-CHOP plus RT group (p = 0.030). Two-year OS and EFS were significantly longer in R-CHOP alone group than R-CHOP plus RT group (96.1 vs 89.9 %, p = 0.029 and 91.7% vs 81.8%, p= 0.028) (Figure 1). Relapse rate was significantly lower in R-CHOP alone group compared with R-CHOP plus RT group than group (7.4% vs 22.4%, p=0.001), and distant relapses were also significantly lower (15.5% vs 2.7%, p Conclusion In our cohort, R-CHOP alone for six to eight cycles without IFRT could achieve significantly higher 2-year OS and EFS rate as well as CR compared with R-CHOP plus RT group. In addition, the rate of relapse and systemic failure were significantly lower in R-CHOP alone group, which altogether warrant further validation in prospective trial. Table 1. Explorative comparison of overall clinical outcomes and patterns of relapse between two subgroups: patients who underwent six or more cycles of R-CHOP chemotherapy alone and who underwent 3 or 4 cycles of R-CHOP followed by IFRT Total (%) R-CHOP alone group (%) R-CHOP plus RT group (%) P -value Number of patients 357 (100) 299 (83.5) 58 (16.2) Treatment response Complete response 345 (96.6) 292 (97.7) 53 (91.4) 0.030 Overall response 351 (98.3) 294 (98.3) 57 (98.3) 1.000 Rate of relapse 35 (9.8%) 14 (7.4) 11 (22.4) < 0.001 Median time to relapse (95% CI) 11 (7-15) 11 (8-14) 10 (5-14) 0.346 Pattern of relapse < 0.001 (0.062) Locoregional 14 (4.7) (63.6) 4 (6.9) (30.8) Distant 8 (2.7) (36.4) 9 (15.5) (69.2) Figure 1. Comparison of overall survival and event-free survival in two subgroups: patients who underwent six or more cycles of R-CHOP chemotherapy alone and who underwent 3 or 4 cycles of R-CHOP followed by IFRT Figure 1. Comparison of overall survival and event-free survival in two subgroups: patients who underwent six or more cycles of R-CHOP chemotherapy alone and who underwent 3 or 4 cycles of R-CHOP followed by IFRT Figure 2 Figure 2. Disclosures No relevant conflicts of interest to declare.

In this paper, we demonstrate the scanning photocurrent imaging on carbon nanotube devices in high-purity water environments. We found a streak of photocurrent signals along the nanotube devices; these streaks help in locating individual nanotubes. The photocurrent signals appearing in the middle of the nanotubes are due to the presence of additional ions in the electrical double layer, and as a result, a nanotube device can be used to sense the charge distribution at water-substrate interfaces with nanometer resolution. The gate-dependent photocurrent signals allow us to enumerate the effective charge density influencing nanotube electric potentials. We monitored the dynamical change in the charge distribution, which originates from the dissolution of carbon dioxide from the atmosphere into the solutions.

We determined the carrier diffusion lengths in TiO2 nanoporous layers of dye-sensitized solar cells by using scanning photocurrent microscopy using an ultraviolet laser. Here, we excited the carrier directly in the nanoporous layers where the diffusion lengths were found to 140 μm as compared to that of visible illumination measured at 90 μm. The diffusion length decreased with increasing laser modulation frequency, in which we determined the electron lifetimes and the diffusion coefficients for both visible and UV illuminations. The diffusion lengths have been studied in terms of the sintering temperatures for both cells with and without binding molecules. We found a strong correlation between the diffusion length and the overall light-to-current conversion efficiency, proving that improving the diffusion length and hence the interparticle connections, is key to improving cell efficiency.

Local electrical characterization tools, such as Electrostatic force microscopy (EFM), can provide local electrical information of nanoelectronic devices, albeit mostly qualitative. For example, EFM images are convolution of local surface potential, capacitance, and contact potential variations in the device. In this study, we demonstrate a calibration procedure to obtain quantitative local voltage distributions of quasi one-dimensional nanoelectronic devices based on carbon nanotubes and ZnO nanowires. By comparing the results with IV measurements of the same devices, we can obtain local electrical properties of devices such as contact resistance, intrinsic resistivity of the nanomaterial, and resistance of a defect.

An efficient electron source is developed by using a micro-machined mesh grid having opening ratio of 67% as an extraction gate for a triode-type field emitter, the cathode of which is a film of vertically-aligned carbon nanotubes (VACNTs) that are synthesized by a hot-filament chemical-vapor-deposition process. The threshold electric field defined for the cathode current of 1 µA is about 0.27 V/µm. The cathode and the anode currents as large as 250 and 140 µA, respectively, are obtained at the electric-field strength of 0.44 V/µm. The electron transparency that corresponds to the ratio of the anode current and the cathode current is approximately 60% for anode currents larger than about 2 µA regardless of anode-bias voltage.

This article presents an ionizer based on a triode structure for a micromachined time-of-flight mass spectrometer (TOFMS). The fabricated device has two components in one chip: a triode-type field emitter for ionization and an ion separator with acceleration electrodes. The electron emitter is an array of carbon-nanotube (CNT) pillars grown by hot-filament chemical vapor deposition (HFCVD). The anode current measured in the field-emission characteristic test of the fabricated device is high, up to 72.1 µA. The gate current is about 5% of the anode current, which implies low electron interception. We confirmed the ionization by electron impact and obtained the mass spectrum of the air from the fabricated device using a microchannel plate (MCP). The results show that the fabricated TOFMS is feasible for cheap miniature mass spectral analyzers.

158 Background: While combination chemotherapy involving fluoropyrimidines and platinum is currently considered a standard regimen in AGC, there has been a price to pay in terms of toxicity. Since the main goal of treatment in AGC remains palliation, the current multi-center phase III trial compares efficacy and safety of XELOX combination with those of X monotherapy in elderly patients with AGC. Methods: AGC Patients aged 70 years or older were randomized 1:1 to receive X (capecitabine 1000 mg/m2 bid po on D1-D14) or XELOX (capecitabine 1000 mg/m2 bid po on D1-D14 plus oxaliplatin 110 mg/m2 iv on D1). Treatment was repeated every 21 days until disease progression, unacceptable toxicity, or patient’s refusal. Primary endpoint was overall survival, and the target sample size was 200 eligible patients. This interim safety analysis contains toxicity data from the first 27 randomized patients. Results: Among the 27 patients (X: 13, XELOX 14), median age was 77 (range, 70-84) years and 24 patients had symptomatic (ECOG PS 1-2) disease. The arms of the study were balanced with respect to baseline characteristics. No treatment-related serious adverse events (SAEs) or unexpected toxicities were observed. The most frequent toxicities were anorexia, fatigue, anemia, and hand-foot skin reactions. Fatigue and sensory neuropathy were more common in XELOX than X patients. QOL data showed no significant differences between the two arms. Conclusions: Our data indicate that the addition of oxaliplatin does not add to the toxicity of single agent capecitabine as first-line chemotherapy in elderly (age ≥70 years) AGC patients. The accrual is currently ongoing (ClinicalTrials.gov, NCT01470742). Clinical trial information: NCT01470742.

혈관주위 상피모양세포 종양은 조직학적으로 HMB-45에 강한 양성을 보이는 상피 모양세포를 가지는 중간엽 종양의 한 범주를 총칭한다. 대개 양성경과를 보이며 진단 당시 전 이성 병변을 가지는 예는 흔치 않아 수술적 절제술이 일반 적인 치료로 선택된다. 그러나 양성과 악성의 조직학적 명확 한 경계가 없으며 재발에 대한 예측에 제한점이 많아 다양 한 치료 시도들이 지속되고 있다. 저자들은 좌상복부 거대 종괴 소견을 보인 환자를 대상으로 종괴제거 수술을 시행하 였고 복벽에 다수의 파종성 결절을 확인하였으며 절제된 종괴 및 결절조직의 면역 조직화학염색검사에서 HMB-45 강한 양성을 보여 복강으로 전이된 그물막의 악성 혈관주위 상피 모양세포 종양을 확진하였다. 환자는 더 이상의 추가적 치료를 원하지 않았으며 이후 7개월 만에 다발성 전이로 악화된 1예를 경험하였기에 문헌고찰과 함께 보고하는 바이다.

The influence of glass power morphology on the electrical and microstructural properties of BaTiO3-based multilayer ceramic capacitors (MLCCs) was investigated to enhance the reliability of MLCCs. For a sintering additive, glass particles of different sizes and shapes were prepared by jet-milling and RF plasma treatment. Plasma treatment decreased the glass particle size and transformed the irregular shape of glass particles into homogeneous spherical shapes. It was found that MLCCs sintered with plasma-treated glass powder have a more homogeneous microstructure, a clear core–shell structure, a more stable capacitance against voltage and temperature changes, and a higher degradation resistance. It is inferred that nanosized spherical glass powder prepared by plasma treatment helps so-called magic dopants such as rare-earth elements to be distributed homogeneously around the BaTiO3 particles.

We fabricated and characterized quantum-dot light emitting devices (QLEDs) that consisted of a CdSe/ZnS quantum-dot (QD) emitting layer, a hole-transporting nickel oxide (NiO) layer and/or an electron-transporting zinc oxide (ZnO) layer. Both the p-type NiO and n-type ZnO layers were formed by using sol-gel processes. All the fabricated CdSe/ZnS QLEDs showed similar electroluminescence spectra that originated from the green CdSe/ZnS QDs. However, different combinations of hole- and electron-transporting layers resulted in efficiency variations. In addition to the control of the respective concentrations of holes and electrons within a multilayer device structure, which determines the luminance and efficiency of QLEDs, the use of metal oxide layers is advantageous for long-term stability of QLEDs because they are air stable and can block the permeation of water vapor and oxygen in ambient air to a QD emitting layer. Moreover, the wet chemistry processing for their formation makes metal oxide layers attractive for low cost and/or large area manufacture of QLEDs.

A 45-year-old male presented with a 3-week history of hyperpigmentation of the lip, tongue, and oral cavity (Fig. 1). He had attended an endocrinology outpatient clinic for evaluation of diabetes or adrenal insufficiency. The patient did not have diabetes, but had a 7-year history of hypertension. The endocrinologist diagnosed acanthosis nigricans clinically. On systematic review, the patient stated that he had abdominal distension, discomfort, and easy satiety for several months. He was referred to us for an evaluation of the abdominal discomfort and internal malignancy. Computed tomography of the abdomen and pelvis revealed an enhancing infiltrative mass involving the entire peritoneum in the mid to lower and left upper quadrants of the abdomen and a small amount of ascites in the perihepatic space extending into the right paracolic gutter and pelvic cavity. This suggested a peritoneal carcinomatosis-like malignancy involving the peritoneum, such as peritoneal mesothelioma diffuse type, lymphoma, or desmoplastic small round cell tumor (Fig. 2A). A peritoneoscopic biopsy showed diffuse scattered nodules up to 1 cm on the viscer omentum (Fig. 2B). These bled readily on touch. Histological and immunohistochemical analyses of the biopsy specimen showed diffusely c-kit-positive epithelioid cells, which are consistent with a malignant gastrointestinal stromal tumor (GIST) (Fig. 3). After diagnosing a GIST, we planned palliative chemotherapy with imatinib as it was inoperable. However, the patient was lost to follow-up. Figure 1 The patient presented with a hyperpigmentation of (A) tongue, (B) lip, and (C) gum. Figure 2 (A) Computed tomography scans of abdominopelvis revealed that enhancing infiltrative mass lesion replacement whole peritoneum in mid to lower and left upper quadrant of abdomen, small amount of combined ascites along perihepatic space extending into right ... Figure 3 Biopsy specimen showed round to oval shaped epithelioid cells with diffuse positive to c-kit, which were consistent with a malignant gastrointestinal stromal tumor (A, HE B, c-kit, × 400). Acanthosis nigricans is a paraneoplastic dermatosis characterized by velvety, hyperpigmented plaques on the skin in body folds, typically the armpits, groin, and neck. Sometimes the lips, palms, or soles are affected. Malignant acanthosis nigricans is associated with various neoplasms, most often gastrointestinal adenocarcinoma. The association of this condition with sarcoma is extremely rare. Here, we report acanthosis nigricans on the lip and oral mucous membrane in a patient with GIST. To our knowledge, this is the first case of acanthosis nigricans associated with a malignant GIST.

We studied the operation characteristics of inorganic–organic hybrid light emitting devices (HLEDs) that have a green CdSe/ZnS quantum dot (QD) emitting layer (EML) and a 1,3,5–tris(N–phenylbenzimidazol–2–yl)–benzene (TPBi) hole blocking layer (HBL). A series of devices with a different thickness TPBi HBL all showed pure electroluminescence that is consistent with green photoluminescence of colloidal QDs without any colour contamination from organic layers. The best performance, which we attributed to more balanced charge carrier supply to a QD EML and efficient energy transfer from excitions in a TPBi layer to QDs, was observed from the device with a TPBi HBL of 20 nm thickness: the deep green emission with the luminous efficiency of 1.55 cd/A at standard video brightness (200 cd/m²) and the luminance as large as ~1800 cd/m².

Serum IL-10 level in Kawasaki disease(KD) was tested. In the KD patients' sera during the acute phase, the levels of IL-10 were markedly elevated (122.0 +/- 39.1 pg/ml) compared to 3.7 +/- 1.7 pg/ml in the control subjects (p < 0.001). The serum IL-10 levels remained elevated in the subacute phase (16. 7 +/- 9.7 pg/ml, p < 0.001) and were restored to the normal levels(7.9 +/- 3.9 pg/ml) during the convalescent phase. In the patients with acute febrile disease, the serum IL-10 level increased significantly (34.4 +/- 14.1 pg/ml, p < 0.001) compared to that of the age-matched control subjects, but were not as high as in acute phase of KD(p < 0.005). This increase in serum IL-10 levels in KD may contribute to the up-regulation of humoral immunity and to the down-regulation of acute inflammation due to an increase in proinflammatory cytokines.

Abstract 2683 Background Secondary central nervous system (CNS) involvement in diffuse large B-cell lymphoma (DLBCL) includes CNS relapse or CNS involvement with systemic disease progression. Although many publications have provided information regarding the incidence and risk factors for CNS involvement in DLBCL, its incidence reported across those studies varies widely. It might be related with that the majority of data were from retrospective analyses. Furthermore, the role of CNS prophylaxis for DLBCL has been challenged, especially in the era of R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone). As a result, this rare but fatal clinical problem still remains a therapeutic dilemma in the management of DLBCL. In this study, we prospectively explored the risk factors of CNS involvement and the clinical impact of screening evaluation for CNS involvement. Methods We analyzed the incidence of secondary CNS involvement in pathologically confirmed DLBCL patients enrolled in the Prospective Cohort Study with Risk-adapted Central Nervous System Evaluation in Diffuse Large B-cell Lymphoma (PROCESS study, NCT01202448). Patients should be treated with at least one cycle of R-CHOP, and provide written informed consents. We assessed the risk of CNS involvement based on previously reported risk factors: serum LDH elevation, the number of extranodal involvements, serum albumin, bone marrow invasion, HIV positivity, the involvement of testis, breast, paranasal sinus, bone, retroperitoneal lymph nodes, orbit, and epidural space. If patients had any of these risk factors, they underwent CSF study to screen the CNS involvement at diagnosis. If the results were abnormal, additional studies including brain MRI could be done depending on physicians' decision. CNS prophylaxis was done with intrathecal chemotherapy with methotrexate for patients who had positive findings of screening evaluation or were determined to have a risk of CNS involvement based on physicians' decision. Results 564 patients were enrolled between 2010 and 2012 from 26 institutions belonged to the Consortium for Improving Survival of Lymphoma (CISL). They were prospectively monitored with the median follow-up duration of 10.5 months. The median age was 59.5 years old (range 20–89 years), and approximately a half of patients had Ann Arbor stage III/IV (n = 276, 48.9%) and 193 patients involved two or more than two extranodal sites (34.2%). Based on the International Prognostic Index (IPI) risk, 192 patients belonged to high or high-intermediate risk (34%). Among patients (n = 368) who had at least one of risk factors for CNS involvement, 243 patients underwent CNS evaluation, and the evidence of CNS involvement was found in16 patients including positive cytology (n = 11), and brain parenchyma lesion (n = 5). The other 78 patients showed equivocal results of CSF analysis including the presence of atypical cells (n = 17). Intrathecal prophylaxis was done for 51 patients whereas high dose methotrexate chemotherapy was combined with R-CHOP for patients with brain lesion. During follow-up, 14 cases of additional CNS involvement including brain parenchyma (n = 8), leptomeningeal (n = 5), and ocular invasion (n = 1) were observed. The median time to CNS event in these 14 patients was 7.5 months (range 1.2 – 15.9 months). Thus, 30 cases of secondary CNS involvement were documented in our study population at the time of analysis (5.3%) including 16 cases at diagnosis and 14 cases during follow-up. The univariate analysis for evaluation of risk factors demonstrated serum LDH, the number of extranodal involvements, bone marrow invasion, and the involvement of retroperitoneal lymph nodes, breast, paranasal sinus and orbit were significantly associated with CNS involvement. The high/high-intermediate risk of IPI was also predictive of CNS involvement (P < 0.05). However, in the multivariate analysis, bone marrow invasion and the involvement of breast, paranasal sinus and orbit were independently predictive for CNS involvement. Conclusions The incidence of secondary CNS involvement in DLBCL patients treated with R-CHOP was around 5%, and a half of cases had the evidence of CNS involvement at diagnosis. Considering a particular risk of CNS involvement of disease-related factors, risk-adapted active screening against CNS involvement may help to improve treatment outcome of patients with DLBCL. Disclosures: No relevant conflicts of interest to declare.

Undoped, 0.5 and 1.0 mol. % Mn-doped 0.15BiInO3-0.85PbTiO3 films were grown on PbTiO3/Pt/Ti/SiO2/Si substrates by pulsed laser deposition. Phase-pure perovskite films were obtained at a substrate temperature of 585 °C irrespective of Mn doping level. The 0.5 mol. % Mn-doped films showed a room temperature permittivity of 480 and a dielectric loss tangent of 0.015 at 100 kHz after 650 °C post-deposition annealing. The coercive field and remanent polarization were 80 kV/cm and 29 µC/cm2, respectively. The ferroelectric transition temperature of the films ranged from 535 to 585 °C. The e31,f piezoelectric coefficient was −7.1 C/m2. X-ray diffraction and phase transition temperature data showed that the Mn atoms substitute on the Ti-site as Mn3+; the resulting films have p-type conduction characteristics.

독자 여러분의 임상화보 투고를 환영합니다. Correspondence to Do Hyoung Lim, M.D. Department of Internal Medicine, Dankook University Hospital, 201 Manghyang-ro, Dongnam-gu, Cheonan 330-715, Korea Tel: +82-41-550-3294, Fax: +82-41-550-7058, E-mail: dos143@paran.com Figure 1. A-P CT scan of the patient showed that about 2.2 × 5.8 cm sized rim-enhancing lesion in right gluteus medius muscle. Which was considered as abscess, initially. 농양으로 오인된 횡문근육 림프종

Everolimus, an inhibitor of the mammalian target of rapamycin, is an active agent against metastatic renal cell carcinoma. Treatment with everolimus prolongs progression-free survival in patients with clear cell-type renal cell carcinoma that has progressed on vascular endothelial growth factor receptor tyrosine kinase inhibitors, such as sunitinib and/or sorafenib. Everolimus-induced interstitial pneumonitis is not rare and is sometimes fatal. Due to the potential for pulmonary toxicity due to everolimus, it is recommended that pulmonary complications be periodically evaluated. We report a case of everolimus-associated interstitial pneumonitis in a patient with metastatic renal cell carcinoma. (Korean J Med 2012;83:520-524)

Multiple primary neoplasms, defined as the occurrence of multiple malignant neoplasms in the same individual, were first reported by Billroth in 1889. With gradual improvements in diagnostics, and the early detection and effective treatment of malignant neoplasms, the prevalence of multiple primary neoplasms seems to be increasing. Although there have been several reports of triple primary neoplasms in Korea, cases of quadruple neoplasms are rare. Recently, we diagnosed a 69-year-old male with primary neoplasms in the lung, esophagus, vocal cords, and hypopharynx. The authors report this rare case of four metachronous primary neoplasms and provide a review of the literature. (Korean J Med 2012;82:110-114)

만성 C형 간염으로 페그인터페론과 리바비린 병합 치료시작 16주 후 다발성 관절통이 발생하여, 류마티스관절염 진단하에 NSAID와 DMARD를 투약하여 호전된 1예를 경험하였기에 문헌고찰과 함께 보고하는 바이다.

We demonstrate that a filtration method is efficient for the fabrication of thick single-walled nanotube films and is capable of shielding terahertz waves. Shielding effectiveness can be engineered by controlling the film thickness and we achieved 38 dB for a 950-nm-thick film. In addition, we found that the films exhibit a dispersion of dielectric constant obeying the Drude free-electron model, whereas the plasma frequency decreases with increasing film thickness. Based on the nanotube films with a thickness greater than the skin depth, we fabricated grid polarizers by laser-machining process, which enable us to achieve a large polarization extinction ratio.

Abstract 5219 Background: Local stage- Ann Arbor stage I/II- Marginal zone B-cell lymphoma (MZL) was occupied 50∼70% of all MZL patients. Even though almost of them were well controlled with local treatment based therapy, But there is no data about risk factors and role of additional chemotherapy in stage II after local treatment. In this study, we conducted multicenter retrospective analyses of local stage MZL in order to assess their clinical features, optimal treatments, and prognoses. Methods: Between May 1992 and Jan. 2011, a total of 217 patients with biopsy-confirmed Ann Arbor stage I/II -MZL from 7 different institutions in Korea were included for analysis in this study. Results: The median age of our subjects was 48 (range: 14–82) years. This study involved 102 males (47%) and 115 females (53%). The most common primary sites of involvement were the orbit and ocular adnexa (43%) followed by small or large bowel (14%), and nodal MZL (10%). 190 patients (88%) and 27 patients (12%) were stage I and II, respectively. Of 217 patients with stage I or II, 213 patients were available for treatment outcome analysis. 167 (77%) were treated with local modality such as radiation therapy or surgery alone, 24 patients (11%) received additional systemic chemotherapy after local treatment. 26 patients (12%) were treated with chemotherapy alone. The overall response rate was 98% (95% CI, 96–100%) with 188 CRs and 20 PRs. Median progression free survivals (PFS) was 10.5 years (95% CI, 7.5–13.4 years). Overall survival (OS) did not reach the median value. 5 year and 10 year OS rates were 94% and 88%, respectively. During the follow-up 38 relapse events were observed. Poor prognostic factors influence to PFS were stage II (P=0.007) and chemotherapy alone treatment (P=0.002). Conclusion: Local stage- Ann Arbor stage I/II- MZL had been observed a good clinical course and well controlled with local treatment modality without additional chemotherapy. But, stage II MZL patients who need chemotherapy had relatively poor survival. Disclosures: No relevant conflicts of interest to declare.

Abstract 5224 Background: Even though one great study had been addressed for identifying relationship Camphylobacter jejuni (C.jejuni) and IPSID, association is not proof for causation; it is usually the first step in proving the microbial etiology of a disease. Intestinal-marginal zone B-cell lymphoma (I-MZL) in Korean result, many points of clinical presentations were quietly different from classical IPSID. Median age was about 60 not a young child, common involving site was ileo-cecal valve not a jejunum, limited segmental involvement was dominant not a diffuse involvement of whole intestine. Therefore, we propose this study for identifying the causative etiology of I-MZL. Thus firstly we planned to demonstrate the enterobacterias including C.jejuni and I-MZL with Korean specimen. Patients and Methods: Histologically confirmed 33 patients of intestinal MZL were evaluated for this study. DNA preparing from FFPE will be used Ambion RecoverAllTM Total Nucleic Acid Isolation Kit for FFPE tissue. Universal primers PB (5'TAACACATGCAAGTCGAACG3') and DG74 5'AGGAGGTGATCCAACCGCA3') has been used to amplify bacterial 16S ribosomal DNA (rDNA). Established primers directed at C. jejuni (CCCJ609F 5'AATCTAATGGCTTAACCATTA3' and CCJ1442R 5'GTAACTAGTTTAGTATTCCGG3') will be used to generate an 852-bp 16S rDNA amplification. Cycling conditions for all PCR will be as follows: 7 minutes at 95°C, 35 cycles of denaturation for 30 seconds at 95°C, annealing for 20 seconds at 55°C, and 2 minutes of extension at 72°C and then 10 minutes at 72°C.With the similar concept, Salmonella typi, Vibrio Cholerae, Escherichia coli, Shigella also were evaluated for evaluating the etiology of the I-MZL. Result: Between 1999 and October 2009, a total of 24 patients with histological diagnosis of I-MZL from 9 different institutions in Korea were analyzed. The male/female ratio was 14 to 10. The median age was 57 years (range, 15–80). The number of involved site was duodenum-1, jejunum- 2, ileum-7, ileo-cecal valve-3, ascending colon-2, sigmoid colon-1, rectum- 5, and multiple intestine involvement was 3. Four bands were appeared in I-MZL patient. All of two jejunum involved MZL tissue had positive result. But one patient was ileum and the other one was ileo-cecal valve involved MZL. Salmonella typi, Vibrio Cholerae, Escherichia coli, Shigella were all negative in I-MZL tissue Conclusion: It was a difficult to identify the relationship several enterobacterias and I-MZL. However C. jejuni could be a possibility of etiologic organism of jejunum involved MZL. Furthermore, extra-jejunum I-MZL has a need for more investigation to define the etiology of I-MZL Disclosures: No relevant conflicts of interest to declare.

Abstract 5084 Background: Waldeyer's ring (WR) is circular band of lymphoid tissue located at the opening of the respiratory and digestive tract. There is controversy as to whether WR should be considered as a nodal or extranodal site. In this study, we conducted retrospective analyses of WR involving MZLs (WR-MZLs) to identify their clinical features, treatment, prognosis- favor nodal or extranodal. And we want to get additional information about specific organ relationship between WR-MZL and other MALT sites. Patients and Methods: From 1987 to 2010, 124 patients who were histologically confirmed as a MZL arising from head and neck (H&N) area was including WR (47 patients) were reviewed. Primary orbit and ocular adnexa MZL patient was excluded this data collection. Results: The male/female ratio of the 47 patients was 23 to 24. The median age was 53 years (range, 17–77). The commonly involving sites were tonsil (53.2%) followed by nasopharyn (40.4%). Fourteen patients (29.7%) were accompanied with extra-WR area MALT site- gastrointestinal tract (14.9%), ocular and adnexa (12.8%). Ann Arbor stage I/II disease was present in 50% (23 out of 46). Thirty-nine patients were categorized into the low/low-intermediate risk group (84.8%) according to International Prognostic Index (IPI). Complete and partial remissions were achieved in 18 (78.3%) and 2 (8.7%) of the 23 stage I/II patients. In 23 patients with stage III/IV, CR and PR were achieved in 15 (65.2%) and 4 (17.4%), respectively. The median progression-free survival (PFS) was 3.6 years (95% CI, 2.4–4.8 years). The estimated 5-year overall survival (OS) was 88%. Compared with H&N MALT site MZLs, WR-MZLs were significantly poor in PFS and OS (P=0.005 and P=0.007). Conclusion: WR-MZLs were also an indolent disease like general MZL. But, WR-MZL patients presented with more advanced stage and poorer survivals than other site H&N MZL patients. Therefore, even though WR has been considered histologically extranodal MALT organ, clinically it is closer to nodal MZL. Disclosures: No relevant conflicts of interest to declare.

not Available.

The authors report the fabrication of freestanding field-electron emitters based on arrays of vertically aligned carbon nanotubes (VACNTs) and flexible polydimethylsiloxane (PDMS). Transplant of VACNT arrays from silicon substrates to flexible PDMS platforms through a press-and-curing process resulted in PDMS-supported VACNT-array electron emitters. Test of field-electron emission from the PDMS-supported VACNT columns in a diode configuration showed good field-emission results regardless of cathode geometry, either planar or convex shape cathodes. Furthermore, the repeated bending of the PDMS-supported VACNT-column cathodes up to a few hundred times showed no noticeable degradation in field emission. Numerical simulations of electric field distribution at various bending angles and anode-cathode distance show that the general trend in emission-current variations is consistent with the difference in maximum electric field strength at the cathode surface.

A convenient and facile method to fabricate cathodes for efficient field-electron emission, which consists of columns of vertically aligned carbon nanotubes (VACNTs), is presented. The new top-down approach that uses femtosecond laser pulses to make a VACNT-column array starting from a mat of VACNTs is versatile in making diverse cathode architecture because the synthesis and sculpturing processes are completely decoupled. Moreover, this laser-machining process is scalable for the fabrication of large size cathodes. Test of field-electron emission from a typical laser-machined cathode showed a promising result. Emission currents of 0.10 μA and 0.57 mA were measured at the respective applied fields of 0.76 and 1.47 V/μm from a cathode that consisted of a 5×5 array of VACNT columns. The total cathode area occupied by the 5×5 VACNT columns was 0.80×0.80 mm2 while the net area of 25 VACNT columns’ top surfaces was 1.00×10−2 mm2. The stability of the 5×5 VACNT-column array was proved by the continuous operatio...

We report on electron beam induced current (EBIC) from individual carbon nanotubes (CNTs) which are in contact with metal electrodes. The EBIC signals originate from the diffusion of excess carriers induced by the electron beam bombardment. The EBIC image enables us to locate the individual CNTs efficiently. From the polarity of the EBIC signals we can identify the electrical contacts to the metal electrodes. More importantly, we demonstrate that the EBIC can be used to characterize the local electrical properties of CNT-based devices, such as asymmetry in metal contacts and the presence of defects. EBIC is also observed regardless of the presence of insulating surfaces, indicating that the EBIC is a result of the direct interaction between the CNTs and the electron beams.

Nonstoichiometric tungsten bronze-structured ferroelectric SrxBa1−xNb2O6−δ (SBN) single crystals were found to be a promising n-type thermoelectric oxide. Thermopower anomalies were observed at the phase transition temperatures, depending on the degree of reduction as well as crystal anisotropy. Above 500 K, heavily reduced SBN crystals show high thermoelectric power factors (∼20 μW/cm K2 at 516 K) with both thermopower and electrical conductivity higher parallel to the c-axis. It is noted that the power factor increases with temperature due to the semiconducting behavior with high carrier concentration. The carrier transport mechanism also varies with the degree of reduction and temperature.

Compositional effects on optical band-gap energy using end members of ABO3 perovskites have been investigated through an optical absorption with a UV-spectroscopy. Three examples are selected, namely, BaTiO3–CaTiO3, BaTiO3–BaZrO3, and SrTiO3–BaZrO3 solid solutions. To understand the role of high temperature phase equilibria on the band-gap compositional trends, structural and microscopy data were determined. In simple systems such as Si–Ge, the nonlinear variations in band gap with composition is usually associated with the effect of the local lattice relaxations and provides a parabolic dependence, often referred to as the “bowing” phenomena. In the case of perovskite solutions, the cases are more complex, and a modified Vegard’s law is introduced to account for the trends. This has to be considered in relation to high temperature phase formation where incomplete solid solutions and two-phase regions exist. In addition to high temperature phases, low temperature displacive phase transitions and complex nonstoichiometry also perturb the band-gap variation in perovskite oxide materials.