Search

Objective: The daily bisphenol A (BPA) intake level of Japanese pregnant women was surveyed based on the measurement of the urinary excretion level of a BPA metabolite., Methods: Spot urine samples were collected from 56 pregnant women who visited the gynecology division of a hospital for a routine health check between June and October 2003. The urinary concentrations of the BPA metabolite and creatinine were measured by GC/MS/MS and spectrophotometry, respectively. Daily BPA intake was assumed to be equal to daily excretion., Results: The daily intake of BPA among Japanese pregnant women was estimated to be in the range of < 0.3 to 7.9 microg/day (median < 2.0 microg/day), being consistent with the levels in previous studies for non-pregnant Japanese women. This level was far below the current Acceptable Daily Intake (0.01 mg/kg/day) which was set by the European Commission. The maximum estimated intake per body weight (0.16 microg/kg/day) reached 1/10 of the Lowest Adverse Effect Level of BPA for pregnant mice for a reproductive effect on the offspring (2 microg/kg/day)., Conclusion: It is desirable to lessen BPA intake from a precautionary viewpoint, particularly in pregnant women.

We compared the effects of two distraction frequencies on bone formation during tibial lengthening by evaluating radiographs, bone mineral density, and histological findings. In 15 mature White Leghorn chickens, both tibiae were distracted at a rate of 0.75 mm/day for 10 days. The distraction frequency was 2 steps (0.375 mm/12 hour) by hand on the right side and 120 steps (0.00625 mm/12 min) by autodistractor on the left. Serial radiographs showed faster bone formation on the 120-step side than on the 2-step side. Bone mineral density on the 120-step side was also higher than that on the 2-step side at all times. On the 2-step side, endochondral ossification was marked in the early stage of distraction; then intramembranous ossification became the main mechanism of bone formation. On the 120-step side, however, intramembranous bone formation predominated throughout the study. Our findings support the contention that, at least in skeletally mature chickens, an increase in the distraction frequency improves osteogenesis during bone lengthening.

Background: Debate has been continuing whether endocrine disrupting chemicals (EDC) in the environment affect human reproduction. We are planning to use time to pregnancy (TTP) as a measure of human fecundity to relate EDC exposure in a future research. TTP is expressed as the number of non-contracepting menstrual cycles or months required for a couple to conceive. An extended TTP might be considered to reflect an injury to reproductive processes. Since this parameter has never been measured in Japan. the present preliminary study aimed at establishing a Japanese version of the TTP questionnaire and determining if TTP could be reliably measured in Japan., Methods: We prepared a self-administered questionnaire that consisted of questions on TTP, sexual life and dietary habits. Women who visited a gynecology clinic in Tokyo for confirmation of pregnancy during the period October 2000 to March 2001 were the subjects asked to fill in the questionnaire. The results were statistically analyzed by chi-square test, t-test and binorminal logistic model after classifying the subjects into two groups: (a) Group I (TTP < or = 6 months; n = 53) (b) Group II (TTP > 6 months; n = 16), Results: Of the 92 women approached, 69 (75.0%) could report TTP. The distribution of TTP, the mode being around 1-2 months with a positive skew toward longer value, was similar to those reported so far in Western countries. There were statistically significantly more smokers in Group II (smoker 62.5%) than in I (15.6%). Logistic regression analysis indicated prior gravidity and fish and milk consumption, in addition to cigarette smoking, to be related to TTP., Conclusions: The present preliminary study indicated that TTP surveys are feasible with Japanese based on the high response rate and plausible distribution of reported value. It also indicated that TTP was related to cigarette smoking, gravidity and dietary habits, again consistent with previous studies.

We investigated the relationship between interleukin-6 (IL-6) levels and subset profiles of T lymphocyte (T-cell) and macrophage in peritoneal fluid (PF) with or without endometriosis (EM). IL-6 levels in PF with EM were significantly higher than those without EM. IL-6 producing cells with EM were analyzed in each activated mature T-cell (CD3+CD69+) and macrophage (CD14+) were 0.5 and 3.5%, respectively, whereas it was mostly negative in those without EM. Cytotoxic T-cell (CD8+CD11b-) profiles in PF with EM were also quiet different from those without EM. Cellular immunity in the peripheral blood did not change during the course of IVF-ET cycles, although plasma levels of ovarian steroid hormones significantly increased comparing with that in normal ovarian cycles. Cytotoxic T-cell type 1 (Tc1) profiles might be useful predictive values in the pregnancy outcome for infertile patients with EM.

Background: Bone-lengthening can be accomplished by means of distraction osteogenesis. In the present study, we examined the effect of a single dose of recombinant human bone morphogenetic protein-7 (rhBMP-7) on the rate of new-bone formation during distraction osteogenesis in the rat., Methods: Fourteen Long-Evans rats were randomized into two groups of seven rats each. An external fixator was applied to the left femur, and a transverse osteotomy was performed. One group was treated with rhBMP-7 in an aqueous solvent, and the other group received the solvent alone and served as the control. rhBMP-7 was administered on the day of surgery by means of a single injection into the osteotomy gap. Distraction was started seven days after surgery at a rate of 0.25 mm every twelve hours. Distraction was continued for twenty days, resulting in a total of 10 mm of lengthening. The regenerate was monitored with use of radiographs and bone-mineral-density measurements at the conclusion of distraction and at two and four weeks after the cessation of distraction. The lengthened femora were harvested, and biomechanical studies were carried out to determine the stiffness and maximum torque to failure., Results: Radiographs showed accelerated regenerate ossification in the BMP-7 group, with a larger amount of new bone compared with the control group. The bone-mineral-density values were dramatically enhanced on Day 20 in the BMP-7 group (103.6 +/- 12.6 mg/cm (2) ) compared with the control group (26.2 +/- 15.1 mg/cm (2) ). These differences continued to be greater at two and four weeks after the cessation of distraction. Normalized values of stiffness (percent stiffness) reached 76.5% +/- 5.4% in the BMP-7 group, compared with 6.6% +/- 0.5% in the control group. The percent maximum torque at failure was 81.1% +/- 1.2% in the BMP-7 group, compared with 20.8% +/- 0.3% in the control group., Conclusion: A single injection of rhBMP-7 at the time of osteotomy surgery stimulated the rate of regenerate ossification and increased bone-mineral density during distraction osteogenesis. The biomechanical properties of the newly formed bone were also increased by BMP-7 injection.

Background: Patients with unresectable malignant gastroesophageal strictures often are troubled with reflux esophagitis after stent placement., Methods: A self-expandable metallic stent (SEMS) without an antireflux mechanism was placed in seven patients with unresectable malignant gastroesophageal strictures (group A), and SEMS with an antireflux mechanism was placed in five patients (group B). After we obtained monitoring systems, two patients in group A and all the patients in group B underwent measurement of bilirubin and pH in the esophagus using a 24-h bilirubin and pH monitor., Results: The mean percentage of total time less than 0.14 for use of the bilirubin absorbance unit was 12.4% in group B and 64.0% in group A. The mean percentage of total time for a pH less than 4 was 2.9% in group B and 37.8% in group A., Conclusion: The placement of SEMS with the antireflux mechanism can be effective not only for palliation of gastroesophageal stricture, but also for prevention of reflux.

Protons with energies up to approximately 10(15) eV are the main component of cosmic rays, but evidence for the specific locations where they could have been accelerated to these energies has been lacking. Electrons are known to be accelerated to cosmic-ray energies in supernova remnants, and the shock waves associated with such remnants, when they hit the surrounding interstellar medium, could also provide the energy to accelerate protons. The signature of such a process would be the decay of pions (pi(0)), which are generated when the protons collide with atoms and molecules in an interstellar cloud: pion decay results in gamma-rays with a particular spectral-energy distribution. Here we report the observation of cascade showers of optical photons resulting from gamma-rays at energies of approximately 10(12) eV hitting Earth's upper atmosphere, in the direction of the supernova remnant RX J1713.7-3946. The spectrum is a good match to that predicted by pion decay, and cannot be explained by other mechanisms.

Background: Although the clinical experience with transcatheter closure of the patent ductus arteriosus using the coils has grown rapidly, one important complication of this procedure using the conventional Gianturco coil was the migration of coils into peripheral vessels. This is especially for patients with a relatively larger size ductus and the risk for such complications could be increased. In this situation, the detachable coil may have some technical benefits to perform coil occlusion and reduce the incidence of complications., Methods: We describe the clinical efficacy of a simultaneous double or triple coil occlusion technique using the Cook detachable coil or bioptome delivered 0.052 inch Gianturco coil to close the ductus arteriosus. This was performed in patients whose ductus diameter was greater than 3.0 mm., Results: From February 1995 to December 2000, 118 patients with patent ductus arteriosus were treated by coil occlusion using Cook detachable coils, of whom 58 patients whose minimum diameter of ductus > or = 3.0 mm were reviewed. All patients had successful placement of coils. According to the evaluation by color flow mapping, a trivial shunt was observed in 17 patients (29%) within 24 h after the procedure. In 11 out of 17 patients, a residual shunt was not detected 1 month after the procedure. At 6 months after the procedure, the residual shunt was detected only in three patients., Conclusions: Although this study did not calculate the statistical significance between detachable and non-detachable coils in term of occlusion rate, our institutional experience suggests that the simultaneous double or triple coil technique using the detachable or 0.052 inch Gianturco coils can reduce the prevalence of coil migration or complications.

Abstract A 63-year-old male with a 5-year history of malignant rheumatoid arthritis (MRA) developed recurrent massive melena and abdominal pain. Methylprednisolone pulse therapy and high doses of oral prednisolone markedly improved the clinical symptoms and normalized immunological disorders. However, he died of disseminated intra-vascular coagulation secondary to pneumonia caused by methicillin-resistant Staphylococcus aureus. Although a high dose of glucocorticoid therapy is effective for ischemic colitis complicated with MRA, intensive care to avoid any opportunistic infection is required.

Background: Although formalin has been widely used as an algesic substance in rodent studies, the unique biphasic effect seen in rats is not present in humans. Humans, like cats, have a monophasic behavioral response to formalin injection. Electrophysiologically, spinal dorsal horn neurons in cats also have what could be considered a monophasic response after the initial burst of activity following formalin injection. Although several studies of the effects of ketamine on formalin responses have been carried out in rodents, we are unaware of similar studies in cats. We hypothesize that such species differences may explain observed differences in preemptive analgesic effects. Therefore, we examined the effects of ketamine on activity of spinal wide dynamic range (WDR) neurons evoked by formalin injection in cats., Methods: We investigated in cats the effect of ketamine on the activity of WDR neurons in the spinal dorsal horn that was evoked by formalin. In addition, we studied the effects of pre- and post-administration of ketamine on the maintained phase of the formalin response. Each dose was a subanesthetic, anesthetic or high anesthetic dose (3.0 mg x kg(-1), 10 mg x kg(-1), and 30 mg x kg(-1))., Results: Intravenously administered ketamine produced a dose-dependent depression of evoked activity that was significantly greater when the drug was administered before formalin., Conclusion: In spite of the species differences in responses to formalin, there still appears to be a clear preemptive effect of ketamine in the cat. Species differences may not explain apparent differences between human and animal preemptive analgesia.

Background: Prenatal echocardiography has shown evidence of prenatal development of congenital heart disease. Prenatal cardiac anatomy, chamber size and function change during gestation, so that the appearance of cardiac structure in abnormal hearts may be different from that which is usually seen postnatally., Methods: Published prenatal echocardiographic studies were reviewed and in utero development of congenital heart disease from midtrimester to the early postnatal period is discussed., Results: The growth of the great vessels and ventricles is reduced in fetuses with ventricular outflow obstruction. Valve regurgitation may progress. The foramen ovale and ductus arteriosus have been reported to become restrictive in utero in several settings. Pulmonary vascular obstructive changes may progress prenatally. Fetal arrhythmia (both bradycardia and tachycardia) may develop in utero. Development of congestive heart failure is a very important issue during follow up of fetuses with significant cardiac or extracardiac problems. Some may progress to fetal hydrops and prognosis of the affected fetuses is usually very poor., Conclusions: Correct knowledge of possible development is important for accurate prenatal diagnosis. Information on prenatal progression of the cardiac anomaly is also important to make plans for follow up and perinatal management, to predict outcomes and to counsel family. Furthermore, the benefits of prenatal treatment instead of postnatal treatment should be assessed by the accurate prediction of the progression of the cardiac problem in utero. Further extensive studies using a large number of cases is required to predict progression accurately. In addition, further studies for elucidating the mechanisms of progression is important to provide better outcomes for fetuses with various congenital heart diseases.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term., (Copyright 1999 Academic Press.)

In the middle of July, 1996, a massive outbreak of hemorrhagic colitis (HC) occurred among elementary schoolchildren in Sakai city. This is the most widespread outbreak of O157 infection ever experienced to our knowledge. Lunch foods supplied in the elementary schools in Sakai were contaminated by Escherichia coli (E. coli) O157. One hundred and twenty-one cases developed hemolytic uremic syndrome (HUS) from 12,680 symptomatic patients, including putative secondary infections, and three girls died during this outbreak. Sakai City Hospital is one of the core medical facilities in this community; hence, 425 children with HC were treated at the hospital. Antibiotics were used extensively on all patients. Among them, 12 children developed HUS. All 425 children, including the patients with HUS, recovered without significant sequelae. In the present paper, the clinical experiences during this massive outbreak of E. coli O157 infection in Sakai City Hospital are described.

In order to investigate the regulatory mechanisms involved in the transcription of the human oxytocin receptor (OTR) gene in the human myometrium at term of pregnancy, we subjected the 5' flanking region of the gene to a differential EMSA (electrophoretic mobility shift assay) procedure. Comparing nuclear proteins from term myometrium, in which OTR gene transcription is massively up-regulated, with those from the non-pregnant myometrium, indicated a prominent DNA-protein complex using the former extract. The sequence of the protein binding site was determined within 20 bp (TCTGCCTTCATCCAGCC) and designated as uterine stimulator motif-1 (US-1). The concatemerized US-1 sequence exhibited enhancer activity using a minimal thymidine kinase promoter (tk-81) in transfected SKN cells. We partially purified US-1 binding protein from SKN cells using a resin bead affinity procedure. Binding activity could be concentrated, although the protein eluate still comprised more than 20 component polypeptides. The molecular weight of the principal protein-DNA complex was determined following UV crosslinking to be 70 kDa. In circumstances where a cell-line mimicking the pregnant uterus at term is not available, the differential EMSA strategy, comparing OTR DNA protein binding in up- and down-regulated tissues, provides a powerful tool to investigate OTR regulation in the uterus. However, the precise characterization and identity of the specific DNA-binding protein(s) and consequent experimental verification of regulatory mechanisms still require elucidation.

The human oxytocin receptor (OTR) gene comprises a large (> 10 kb) third intron between the regions encoding the transmembrane domains six and seven. It has been shown for other genes that transcriptional control elements may reside within such introns, and that these may correlate with changes in the methylation status of the DNA. Methylation mapping indeed indicated that within this third intron there was a region which appeared to be hypermethylated in non-expressing tissues, but relatively hypomethylated in the myometrium of the cycle and at term, when the OTR gene is upregulated. We then employed in vitro nuclear protein-DNA binding assays to evaluate the importance of this region in the control of the human OTR gene. As source of nuclear proteins we have compared a non-expressing tissue, human peripheral blood leucocytes, with human myometrium from the cycle (low expression) and from term pregnancy (high expression). It could be shown that a specific motif of ca. 10-15 nucleotides close to the middle of the third intron specifically binds nuclear proteins correlating with the down-regulated state of the gene. The accumulated data suggest that this intronic element is specifically binding nuclear protein(s) associated with a suppression of OTR gene activity.

Purpose: To describe the features of capsule opacification in rabbits and cynomolgus monkeys after the capsules were refilled with an inflatable endocapsular balloon., Setting: Nishi Eye Hospital, Jinshikai Medical Foundation, Osaka, Japan., Method: Capsule opacification was evaluated by slitlamp examination, Miyake view, and histopathological examination in 15 eyes of 15 rabbits and 16 eyes of 13 primates from 4 to 32 months after the lens capsule had been refilled., Results: The incidence of capsule opacification was 94%. In the eyes that did not have lens epithelial cell (LEC) removal, a monolayer of LECs was seen on the posterior capsule when the lens capsule was tautly refilled, whereas a thick layer was seen when the lens capsule was moderately or poorly refilled. In the eyes that had LEC removal, the opacification was generally less marked regardless of the amount of refilling. In two rabbit capsules that were refilled moderately or tautly and had LEC removal, the capsule remained clear. Neodymium:YAG capsulotomy in two eyes did not cause herniation of the injected silicone., Conclusions: Filling the capsule tautly and removing the LECs effectively reduced capsule opacification but could not completely inhibit LEC migration. This suggests the need for more efficient and thorough LEC removal or even a pharmaceutical approach to prevent capsule opacification after lens refilling.

Although the formalin test is widely used in rodents, the electrical response to this stimulus and the effect of isoflurane on this response, has not been well understood in cats. We have therefore examined the effect of isoflurane on spinal wide-dynamic-range neuronal activity evoked by a subcutaneous (s.c.) formalin injection in cats. In decerebrate, spinal cord-transected cats (L 1-2), a s.c. injection of formaldehyde solution (0.05 ml; 5%) was performed in the receptive fields of spinal wide-dynamic-range neurons at the hind paw. Isoflurane (1.5%) inhalation was given 20 mins prior to formalin injection or 5 mins after the formalin injection. The formalin injection elicited an immediate and continuous discharge or burst activity in the neurons that lasted at least 90 min. Inhaled isoflurane was found to markedly inhibit this neuronal discharge. At 30 mins after discontinuing of isoflurane, the neuronal activity in both groups recovered to approximately 55% of the control value. These results suggest that formalin injection will reliably produce a continuous burst of neuronal activity in the spinal dorsal horn of cats, and that this activity can be markedly reduced by isoflurane. The ability of isoflurane to inhibit this neuronal response was not temporally related to the formalin injection.

The effects of nitrous oxide (75%) on the spinal dorsal born wide dynamic range (WDR) neuronal activity were studied in either spinal cord intact or spinal cord-transected cats. Extracellular activity was recorded in the dorsal horn from single WDR neurons responding to noxious and non-noxious stimuli applied to the cutaneous receptive fields on the left bind foot pads of intact or decerebrate, spinal cord-transected (L 1-2) cats. The experiment was divided into four sections as follows: (1) When 10 micrograms of bradykinin (BK) was injected into the femoral artery ipsilateral to the recording site as the noxious test stimulus in the spinal cord-transected cat, all of 6 WDR neurons gave excitatory responses which were not depressed by 75% nitrous oxide. (2) When the injection of 10 micrograms of BK into the femoral artery ipsilateral to the recording site was used in the spinal cord-intact cat, 6 of 15 WDR neurons (40%) gave excitatory responses, which were significantly depressed by 75% nitrous oxide, and 9 of 15 WDR neurons (60%) gave inhibitory responses, which were not affected by 75% nitrous oxide. (3) When 10 micrograms of bradykinin (BK) was injected into the femoral artery contralateral to the recording site as the noxious test stimulus in the spinal cord transected cat, 6 of 12 WDR neurons gave excitatory reasons, which were not depressed by 75% nitrous oxide. (4) When the injection of 10 micrograms of BK into the femoral artery contralateral to the recording site was used in the spinal cord-intact cat, 6 of 6 WDR neurons (100%) gave responses, which were affected by 75% nitrous oxide. We have observed that nitrous oxide reduces the excitation and inhibition of dorsal born WDR neuronal activities induced by BK injection in spinal cord-intact cats, but does not reduce the excitation of those in spinal cord-transected cats. This finding confirmed that the antinociceptive effect of nitrous oxide might be modulated by supraspinal descending inhibitory control systems. In addition our result showed that the supraspinal effect of nitrous oxide was mediated not only by an increase but also a decrease in a supraspinal descending inhibition.

We compared the effect of various distraction frequencies on the gastrocnemius muscle by evaluating the histological findings, intramuscular enzyme contents, and DNA contents. In 15 rabbits, both tibiae were distracted 1 mm per day. The distraction frequency was 2 steps (0.5 mm/12 hour) by hand on the right side and 120 steps (0.0083 mm/12 minutes) by an auto-distractor on the left. The rabbits were divided into 3 subgroups based on length gain: 10%, 20%, and 30%. Histologically, there were no signs of fibrosis or edema and no differences in the number of necrotic cells, and intramuscular enzyme contents between the 2- and 120-step groups. The DNA content, however, was higher in the 120-step group at 30% lengthening in the middle of the muscle belly, and at 20% and 30% lengthening in the musculotendinous junction. Our findings suggest that an increase in the distraction frequency may promote DNA synthesis in the muscle, thus providing better muscle accommodation during bone lengthening.

Effects of N,N'-diphenyl-p-phenylenediamine (DPPD), an antioxidant, on liver carcinogenesis caused by a choline-deficient L-amino acid-defined (CDAA) diet containing ethionine were studied in Fischer 344 rats. Male animals, 6 weeks old, were fed a CDAA diet, a choline-supplemented L-amino acid-defined (CSAA) diet or a CDAA diet containing 0.05% ethionine with or without 0.2% DPPD. Histological changes and lesions positive for gamma-glutamyltransferase (GGT) were analyzed 12 weeks after the beginning of the experiment. The levels of 8-hydroxyguanine (8-OHGua) in DNA and 2-thiobarbituric acid-reacting substances (TBARS) were measured as the parameters for cellular oxidative damage after 4 and 11 days of treatment. Expression of c-myc and c-Ha-ras was also investigated in relation to cell proliferation after 2, 4, 8 and 11 days. Histologically, development of diffuse fatty liver observed in rats fed a CDAA diet was inhibited, while massive oval cell proliferation and cholangiofibrosis resulted from the addition of ethionine with/without DPPD. The sizes but not numbers of GGT-positive lesions seen in the liver of rats fed a CDAA diet were increased and the levels of 8-OHGua formation and TBARS generation were also increased by the ethionine supplement. Both numbers and sizes of GGT-positive lesions were decreased and the level of TBARS, but not 8-OHGua, was decreased by adding DPPD. The increased expression of c-myc and c-Ha-ras detected in the liver of rats fed a CDAA diet was further increased by addition of ethionine and again reduced by DPPD. These results indicate that an antioxidant DPPD can inhibit the early stage of enhanced hepatocarcinogenesis caused by coadministration of ethionine and a CDAA diet, by blocking cellular oxidative damage as well as c-myc and c-Ha-ras expression.

The influence of timing of administration of preoperative pentazocine on pain and analgesic requirements after surgery was studied in 46 patients undergoing total abdominal hysterectomy. Twenty-three patients received thiamylal 5 mg.kg-1 on induction of anesthesia, followed by pentazocine 30 mg or 60 mg before surgical incision (group A). Twenty-three control patients received pentazocine 30 mg or 60 mg, 5 min after abdominal incision (group B). The visual analogue scales for pain 24 h after operation were 6.0 cm at 30 mg dose in group A or 5.3 cm at 60 mg dose in group A and 5.7 cm at 30 mg dose in group B or 4.7 cm at 60 mg dose in group B. There were no differences in the visual analogues scales. Pentazocine consumption in the first 24 h after surgery was 67.5 mg at 30 mg dose in group A or 52.5 mg at 60 mg dose in group A and 70.9 mg at 30 mg dose in group B or 51.8 mg at 60 mg dose in group B. We conclude that postoperative pentazocine consumption and pain scores are no different when pentazocine is given before or after skin incision for abdominal hysterectomy and that there is no clinically useful pre-emptive analgesic effect with these doses of pentazocine.

The purpose of this study was to clarify the relationship between NK activity and TG-beta in the immune system in endometriosis. We investigated (1) the changes in the NK activity and concentration of TGF-beta in human peritoneal fluid (HPF), and (2) the effects of HPF and TGF-beta on the development of early mice embryos. In a rat model of experimental endometriosis, we observed the effects of tissue culture supernatants of peritoneum on NK activity in rat spleen cells, and obtained the following results. (1) NK activity of peripheral lymphocytes in healthy women was significantly suppressed in the presence of HPF of endometriosis. (2) The concentrations of TGF-beta was significantly higher in HPF of endometriosis than in HPF of healthy women. (3) Both HPF of endometriosis and TGF-beta significantly inhibited the development of early mice embryos. (4) The supernatants prepared from the intact peritoneum of the rat model showed marked inhibition of NK activity compared to control rats, although the peritoneum was obtained from a region distant from the implanted endometrium. These results suggest that ectopic endometrial tissues may cause a change in the cell-mediated immune system and subsequently exert an adverse effect on human reproduction.

Experimental endometriosis in rats was induced by autotransplanting the uterine endometrium to the peritoneum. In all rats, endometrial implants developed into endometriotic tissues similar to those in humans about 2 weeks after transplantation. Natural killer (NK) activity of spleen cells in the endometriosis model rats was significantly (p < 0.05) lower than that in the sham-operated intact rats. The inhibited NK activity in the endometriosis rats recovered to the level in intact rats with danazol (but not buserelin). The supernatant after 24-hour culture of endometrial tissues from both intact and model rats seemed to have significant inhibitory effects on NK activity. The supernatant from endometrial grafts showed significantly (p < 0.05) higher inhibitory effects than that from the endometrial tissues. The inhibitory effects were significantly (p < 0.05) reduced by treatment with danazol or buserelin to the untreated level. In addition, supernatants of unaffected peritoneal tissues from the endometriosis rats had significantly (p < 0.01) higher inhibitory effects on NK activity than those from the intact rats. Even when uterine serosa or silicone was implanted to the peritoneum, the supernatants of the contralateral peritoneal tissues showed significantly (p < 0.05) higher inhibitory effects than those from the intact rats, while having significantly (p < 0.05) lower inhibitory effects than those from the endometriosis rats. These results suggest that this marked inhibitory effect on NK activity by the peritoneum may be associated with the development and progression of endometriosis.

The effects of methionine on hepatocarcinogenesis induced by coadministration of a choline-deficient L-amino acid-defined (CDAA) diet and ethionine were examined. F344 male rats were divided into 4 experimental groups. Groups 1 and 2 received the CDAA diet and a choline-supplemented L-amino acid-defined (CSAA)++ diet, respectively. Group 3 received the CDAA diet containing 0.05% ethionine, and group 4 the CDAA diet containing 0.05% ethionine and 0.47% methionine. Animals were killed after 12 weeks of treatment. Histologically, the CDAA diet induced intracellular fat accumulation and foci. In contrast, ethionine caused not only foci, but also hyperplastic nodules, cholangiofibrosis and the proliferation of oval cells without such fat accumulation. Methionine abolished the development of all of the liver lesions induced by coadministration of the CDAA diet and ethionine. To investigate the effects of methionine on induction of c-myc and c-Ha-ras expression, as well as generation of 8-hydroxyguanine (8-OHGua) and 2-thiobarbituric acid-reacting substances (TBARS), by coadministration of the CDAA diet and ethionine, subgroups of 3 to 5 animals were killed at 2, 4, 8, or 11 days after the beginning of the experiment. Coadministration of the CDAA diet and ethionine markedly enhanced the level of expression of c-myc and c-Ha-ras, 8-OHGua formation and TBARS generation as compared with the CDAA or CSAA diet within 11 days, and methionine blocks these actions. These results indicate that addition of methionine prevents the induction of c-myc and c-Ha-ras expression, 8-OHGua formation and TBARS generation, as well as hepatocellular lesions, by coadministration of the CDAA diet and ethionine in rats, and suggest a possible involvement of oxidative stress and gene expression in hepatocarcinogenesis by these agents.

Using two different commercially available extraction kits, genomic/nuclear DNA could be recovered from rat liver samples as small as 10 mg. Background 8-hydroxydeoxyguanosine levels in such DNA were low and stable at 0.26-0.30 +/- 0.01-0.03/10(5) guanine residues. The minimum tissue wet weight required for the accurate 8-hydroxydeoxyguanosine analysis was 25 mg. The present results indicate that routine and reliable assessment of the involvement of oxidative DNA damage in the development of various diseases, including cancer, is feasible using a variety of tissue sources.

We implanted indomethacin-coated intraocular lenses (IOLs) in rabbit eyes to ascertain how the sustained release of the drug affects postoperative inflammation and posterior capsule opacification (PCO). A preoperative resolution test showed that 1% indomethacin-coated IOLs placed in balanced salt solution released a mean 14.0 +/- 0.6 micrograms of the drug within 24 hours. Postoperatively, aqueous flare intensity in eyes with 0.1% indomethacin-coated IOLs and in eyes with 1.0% indomethacin-coated IOLs was significantly less at day 2 and at days 2 and 3, respectively, than in control eyes with uncoated lenses. In another group of eyes, histopathological examination showed that those with 1.0% indomethacin-coated lenses had significantly less PCO than the contralateral control eyes with uncoated IOLs.

Groups of female Fischer-344 rats were fed a semipurified choline-deficient (CD) diet, or a semisynthetic L-amino acid-defined choline-deficient (CDAA) diet, for up to 12 wk and effects of the 2 diets on the liver were compared. Steatosis was diffuse and more severe throughout in rats fed the CDAA diet than in rats fed the CD diet. Greater elevations in serum aspartate and alanine aminotransferase activities were also present in the former rats, along with higher 2-bromodeoxyuridine labeling indices in the liver. Discrete amounts of 8-hydroxyguanine were detected in liver DNA, but were not significantly different in rats fed the 2 diets, or from those present in a group of control rats killed at 0 time. Glutathione S- transferase placental form-positive focal lesions were not observed in any of the rats. The results show that the CDAA diet causes more severe degrees of steatosis and liver cell death and proliferation than the CD diet, raising the possibility that it may, in contrast to the CD diet, result in the eventual induction of hepatocellular carcinomas in female Fischer-344 rats.

We evaluated in 20 Japanese white rabbits the effects of tibial lengthening on tibial nerve conduction and intraneural blood flow at the end of lengthening. Both tibiae were distracted 1 mm per day. The distraction frequency was in 2 steps (0.5 mm/12 h) on the right side and in 120 steps (0.0083 mm/12 min) on the left. The rabbits were separated into 4 subgroups based on the percentage of lengthening: 0 (control), 10, 20, and 30 percent. In the 2-step group, nerve conduction was delayed at 20 and 30 percent lengthening, compared to the control group, while in the 120-step group, it was delayed only at 30 percent lengthening. Intraneural blood flow in the 2-step group was decreased at 10, 20, and 30 percent lengthenings, while in the 120-step group it was reduced at 30 percent lengthening. Our findings indicate that an increase in the frequency of distraction reduces the impairment of nerve function during bone lengthening.

We investigated the effects of tibial lengthening by callotasis on glycosaminoglycan (GAG) metabolism of the knee articular cartilage in 30 rabbits. The distraction rate was 1 mm per day. On the right side, the daily distraction was in 2 steps, while on the left it was in 120 steps. The animals were divided into 3 subgroups based on length gain; 10, 20, and 30 percent, respectively. The knee joint fluid and medial tibial cartilage were examined by quantitative analysis of the GAG content and/or synthesis. The immunoreactivity for chondroitin sulfate in the cartilage was also examined by immunohistochemistry. For all length gains, the GAG concentration in the synovial fluid was higher on both sides than in controls, with no difference between sides. The GAG content and synthesis in the cartilage on the 2-step side decreased gradually with increasing length. On the 120-step side, the content did not differ from control values in any length gain, and the level of synthesis at 20 and 30 percent lengthening was higher than the control level. Our findings indicate that the alterations in GAG metabolism are attributable to increased mechanical stress on the articular cartilage, suggesting a moderate increase on the 120-step side compared to an excessive one on the 2-step side.

Oxytocin (OT) has been detected in mammalian granulosa-luteal cells during the early stages. The purpose of this study was to explore gene expressions of OT and OT receptor (OTR) in human cumulus cells. Cumulus cells enclosing a mature oocyte were obtained from 6 women undergoing clinical in vitro fertilization and embryo transfer programs. OT and OTR gene expressions were investigated by employing reverse transcription polymerase chain reaction and reverse transcription polymerase chain reaction/single-strand conformation polymorphism methods. OT gene expression in the cumulus cells was positive in 5 women and weakly positive in the remaining patient. The structure of OT mRNA in the cumulus cells was equivalent to that in human hypothalamus. OTR gene expression was also observed in the cumulus cells. This study is the first to describe the simultaneous expression of both OT and OTR genes in human cumulus cells. It is suggested that local OT plays some important roles in fertility through modification of the micro-environment around the oocyte.

Recently, several authors have reported the existence of oxytocin (OT) in mammalian granulosa-luteal cells after ovulation. The purpose of this study was to examine the evidence for gene expression and localization of OT and OT receptor (OTR) in the cumulus cells surrounding the oocytes. Cumulus cells with mature oocytes were obtained from experimental and clinical in vitro fertilization-embryo transfer (IVF-ET) programs. OT and OTR gene expression was analyzed with reverse transcriptase-polymerase chain reaction (RT-PCR) and RT-PCR/single strand conformation polymorphism (SSCP). OT gene expression was detected in mouse and human cumulus cells. The results of RT-PCR/SSCP showed that the structure of OT mRNA in cumulus cells was similar to that in the hypothalamus. Furthermore, OTR gene expression was clearly demonstrated in human cumulus cells, and a weak positive signal was observed in human oocytes. Immunocytochemical staining of OTR was clearly detected in human cumulus cells. The rate of mouse blastocyst development was significantly higher in the group cultured with OT than that without OT. These results are the first observations of simultaneous OT and OTR gene expression in cumulus cells, suggesting that ovarian OT might have some physiological role in the early stage of embryo development.

The questions of whether oxygen-derived free radicals are induced during preservation of lungs and, if so, how such radicals might relate to reperfusion injury were investigated by means of an isolated canine lung model. Lungs were obtained from 16 mongrel dogs and divided into groups 1 (n = 6), 2 (n = 5), and 3 (n = 5). The lungs of groups 1, 2, and 3 were flushed through the pulmonary artery with Euro-Collins solution alone, the solution with superoxide dismutase (120,000 U/L), and the solution with allopurinol (1 mmol/L), respectively, at 4 degrees C and then stored for 4 hours in the respective solutions at 4 degrees C with clamped bronchi. They were then reperfused for 2 hours by means of an isolated lung model. Lung lipid peroxidation was sequentially determined. The lung functional status was assessed by systolic pulmonary arterial pressure and end-inspiratory airway pressure. The lung edema was assessed by lung wet/dry weight ratio. Lipid peroxidation was induced after 1 hour of preservation and the first 30 minutes of the reperfusion in group 1 and only 2 hours of the reperfusion in group 2, whereas no induction was observed in group 3. Values for systolic pulmonary arterial pressure and end-inspiratory pressure in group 1 were significantly higher than those in group 3 (p < 0.05). The lung wet/dry weight ratio in group 1 was significantly higher than that in groups 2 and 3 (p < 0.05). The present results indicate that the administration of free radical scavengers in the preservation may effectively improve conditions for lung transplantation.

8-Hydroxyguanine (8-OHG) formation, a possible initiating event, was determined in pancreatic and liver DNA and compared with the genesis of acinar cell and hepatocyte necrosis in male Wistar rats given a single intravenous administration of 4-hydroxyaminoquinoline 1-oxide (4-HAQO). At the non-necrotic but tumorigenic dose of 7.0 mg/kg body weight, 8-OHG was selectively generated in pancreatic DNA, in the absence of acinar cell necrosis, at the 6 and 24 h time points and repaired by the 48 h time point. When rats were exposed to 4-HAQO at a necrotic dose of 14.0 mg/kg body weight, 8-OHG was also selectively formed in pancreatic DNA with the same time-dependence of generation and repair, while acinar cell necrosis became evident at the 24 h time point and progressed thereafter. Whereas no hepatocyte necrosis was detected in any rats, 8-OHG values for liver DNA merely expressed slight increases only at the 24 and 48 h time points in rats given 14.0 mg/kg body weight of 4-HAQO. The present data suggest that formation of oxidative DNA damage, assayed by 8-OHG, in pancreatic DNA is independent from toxicity and may be involved, along with quinoline adducts, in mutational events underlying 4-HAQO-induced rat acinar cell carcinogenesis.

It is known that urinary excretion of glucaric acid (GA) is an indirect index of hepatic P-450 microenzyme induction. We measured and analyzed urinary excretion of GA and plasma lipids in non-pregnant women, pregnant women and postpartum women. GA was measured by a new method for the inhibition of beta-glucuronidase activity and plasma lipids were measured by routine laboratory methods and we obtained the following results. 1. The concentration of urinary GA was correlated with that of urinary creatinine in pregnant women. 2. The urinary GA and plasma HDL-cholesterol did not change during the first of gestation, but steeply increased in the middle of gestation, and postpartum values were lower than at term. 3. Plasma total lipids, triglycerides, and total cholesterol continuously increased throughout gestation. 4. Plasma free fatty acids and lipid peroxide steeply increased in late in gestation. These results and several reports suggested that the change in GA in pregnant women reflected their own metabolism not fetal or placental metabolism. It seems that grasping and understanding their metabolism can make their disease clear.

Effects of acetylsalicylic acid (ASA) (aspirin) on the pathogenesis of fatty liver, cirrhosis and hepatocarcinogenesis caused by a choline-deficient L-amino acid-defined (CDAA) diet were examined in male Fischer 344 rats fed a CDAA diet supplemented with 0, 0.1, 0.2, 0.4 or 0.8% ASA for 30 weeks. ASA at concentrations of > 0.2% prevented the development of both cirrhosis and preneoplastic and neoplastic nodules, but without any directly associated prevention of fatty changes. ASA also prevented hepatocyte proliferation and the generation of thiobarbituric acid-reactive substances and 8-hydroxydeoxyguanosine caused by feeding the CDAA diet, analyzed, respectively, after 1, 12 and 12 weeks. The results clearly indicate that the anti-inflammatory drug ASA, which is not a lipotropic factor, can prevent the pathogenesis of cirrhosis and hepatocarcinogenesis caused by a CDAA diet, which is possibly partly associated with the prevention of reactive oxygen species production.

The present study was performed to assess the roles of hepatocellular oxidative damage to DNA and constituents other than DNA in rat liver carcinogenesis caused by a choline-deficient, L-amino acid-defined (CDAA) diet by examining the effects of the antioxidant N,N'-diphenyl-p-phenylenediamine (DPPD). The parameters used for cellular oxidative damage were the level of 8-hydroxy-guanine (8-OHGua) for DNA and that of 2-thiobarbituric acid-reacting substance (TBARS) for constituents other than DNA. A total of 40 male Fischer 344 rats, 6 weeks old, were fed the CDAA diet for 12 weeks with or without DPPD (0.05, 0.10 or 0.20%) or butylated hydroxytoluene (BHT, 0.25%). In the livers of the rats, the numbers and sizes of glutathione S-transferase (EC 2.5.1.18) placental form (GSTP)- and/or gamma-glutamyltransferase (GGT, EC 2.3.2.2)-positive lesions and levels of 8-OHGua and TBARS were determined. The GSTP-positive lesions of 0.08 mm2 or larger were all stained positively for GGT as well in cross-sectional area, whereas the smaller lesions were generally negative for GGT. DPPD and BHT reduced the size of the GSTP-positive lesions without affecting their total numbers. At the same time, they reduced TBARS generation without affecting 8-OHGua formation in DNA. The present results indicate that oxidative DNA damage (represented by 8-OHGua formation) and damage to constituents other than DNA (represented by TBARS generation) may play different roles in rat liver carcinogenesis caused by the CDAA diet; the former appears to be involved in the induction of phenotypically altered hepatocyte populations while the latter may be related to the growth of such populations.

Changes in plasma levels of lipids peroxide (LPO) and vitamin E(VE) are observed in pregnant women. We measured levels of VE and lipids in 80 maternal and cord sera in normal delivery and obtained the following results. 1. For each lipid and VE, the concentration gradients were preserved in maternal sera to cord sera through placentas. 2. The concentration of VE correlated with that of total lipids (TL) in both sera. 3. The VE to TL ratio (VE/TL ratio) inversely correlated with the concentration of LPO in both sera. 4. The concentration of VE correlated with the VE/TL ratio and there was a more significant correlation of the VE and VE/TL ratio than that of VE and TL in both sera. 5. The VE/TL ratio in maternal serum correlated with VE/TL ratio and the concentration of VE in cord serum. These results suggested that lipids in serum was a regulatory factor in VE and that VE and lipids maintained the gradation of the concentration according to their own placental transport systems. It seems that the fetus has a unique VE which is comparatively lowered. This may be due to the effects of the accelerated lipid metabolism in the fetus.

Effects of a lipophilic derivative of vitamin C, 2-O-octadecylascorbic acid (CV-3611), as well as its parent L-ascorbic acid (AscA), DL-alpha-tocopherol (alpha-T) and its hydrophilic derivative, 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox), on the number and size of gamma-glutamyltransferase (GGT)-positive putative preneoplastic lesions were examined and compared with their influences on 8-hydroxyguanine formation in DNA and 2-thiobarbituric acid-reacting substance generation in the livers of rats fed a choline-deficient, L-amino acid-defined (CDAA) diet for 12 weeks. A total of 90 male Fischer 344 rats, 6 weeks old, were divided into 18 groups each consisting of five rats. Group 1 received the CDAA diet alone; Groups 2, 3 and 4 received the CDAA diet containing respectively 0.01, 0.05 and 0.10% CV-3611; Groups 5-7, 8-10 and 11-13 similarly received the CDAA diet containing AscA, alpha-T and Trolox, respectively, at these same low, middle and high concentrations; Group 14 received a choline-supplemented, L-amino acid-defined (CSAA) diet alone; Groups 15-18 were given the CSAA diet containing CV-3611, AscA, alpha-T and Trolox, respectively, all at the 0.10% level. While all four vitamin derivatives exerted inhibitory effects on all four parameters, in each case dose-dependently, CV-3611 demonstrated the most pronounced effects. The present results indicated that lipophilic vitamin C derivatives may be particularly effective chemopreventive agents against CDAA diet-associated, oxidative stress-related hepatocarcinogenesis via its superior antioxidative properties.

The spontaneous passage of colon cast from a 76-year-old Japanese female patient is reported. Macroscopically, the colon case was shaped like the airbladder of a fish. Histopathologically, the cast consisted of degenerated colonal mucosa, including glands. No inflammatory reaction was apparent. The patient lacked any evidence of abdominal aneurysm. Since there have been only five reported cases of colon cast in the literature, and since in all of those association with abdominal aneurysms was always described, the present study represents the first report demonstrating the formation of a colon cast in the absence of associated abdominal aneurysm. However, the patient was found to exhibit several risk factors for ischemic colitis, such as arteriosclerosis on the wall of the abdominal aorta, chronic constipation, and colonic stenosis. Her colonal mucosal surface, indeed, suggested ischemic colitis. This case report, therefore, indicates that ischemic colitis, due to various causes, may be responsible for the formation of colon casts, and that the presence of an abdominal aneurysm is not necessarily a prerequisite for colon cast formation. This report may contribute to a better understanding of the pathogenesis of colon casts.

It has been reported that antipsychotic drugs such as phenothiazine derivatives, dibenzyl derivatives and others with calmodulin antagonism induce cataracts, which are generically called phenothiazine-induced cataracts. In the ophthalmologic field, the mechanism of cataractogenesis by such drugs is a problem urgently requiring a solution. This paper reports the relationship between the properties of such drugs and cataract formation. In this experiment, phenothiazine derivatives (chlorpromazine, trifluoperazine, prochlorperazine and perphenazine), dibenzyl derivatives (imipramine and amitriptyline), and other drugs (cyproheptadine and calmidazolium) were investigated. As a result, it was clarified that phenothiazine derivatives and calmidazolium have high lipophilicity, strong inhibition activity against phosphodiesterase, and a large permeability constant, and that those drugs induce high levels of Ca2+ accumulation in the lens. It was also revealed that those drugs were distributed only at the peripheral region of the lens after they had penetrated into the lens. From these findings, we inferred that the cataract formation may be caused by lens protein aggregation followed by the inactivation of calmodulin-dependent Ca-ATPase and subsequent Ca2+ accumulation in the lens. Furthermore, we have been convinced that it is necessary to lower at least the lipophilicity of these drugs to suppress the side effect of antipsychotic drugs inducing cataractic formation.

Recently, several reports have demonstrated the presence of oxytocin (OT) in the corpus luteum of mammalian species. However, the biological role of ovarian OT remains obscure. This study was performed to examine OT gene expression in cumulus cells of mice and humans, and in human corpus luteum, and the role of OT in early embryogenesis. OT gene and OT mRNA were analyzed by reverse transcription-polymerase chain reaction, with single-strand-conformation polymorphism and heteroduplex procedures. OT-treated in-vitro-fertilized mouse oocytes were cultured and the rate of blastocyst development estimated. An immunohistochemical study was also carried out to detect OT on the surface of the mouse oocytes.

We measured changes in gustatory sensitivities and gustation threshold levels and those of some trace elements, vitamin E and lipids in the serum of 38 patients suffering from hyperemesis gravidarum, 12 normal pregnant women in the first trimester and 22 healthy non-pregnant women by means of filter discs and an electrogusto meter (EGM) and we obtained the following results. 1. Gustatory sensitivity to sweetness was found to be significantly lowered in the patients with hyperemesis gravidarum when tested with filter discs (p < 0.05). 2. Gustation threshold levels were significantly lowered in the patients with hyperemesis gravidarum and the normal pregnant women tested with the EGM (p < 0.01). 3. There was considerable heterogeusia of women in the patients with hyperemesis gravidarum (p < 0.05). 4. Zn and Mg in serum decreased (p < 0.01), but Cu increased significantly in the patients with hyperemesis gravidarum and the normal pregnant women (p < 0.01). 5. Total cholesterol and phospholipid in serum significantly decreased, but lipid peroxide in serum significantly increased in the patients with hyperemesis gravidarum (p < 0.01). These results suggested that the gustatory test was helpful in investigating hyperemesis gravidarum and that biological defense systems (scavenger systems) to free radicals were damaged in patients with hyperemesis gravidarum.