Search

Dry direct-seeded rice (DSR) systems are becoming popular due to resource conservation and economic returns but high weed pressure limits rice productivity. Rottboellia cochinchinensis (Lour.) W. D. Clayton is an emerging noxious weed of DSR and requires a suitable herbicide package for effective control. A field study was conducted to evaluate the efficacy of two pre-emergence (oxadiazon and pendimethalin) and two post-emergence (cyhalofop and bentazon) herbicides used in various combinations and sequences during two consecutive seasons (dry season, 2013–14 and wet season, 2014) at the International Rice Research Institute (IRRI), Los Banos, Philippines. Experiments were laid out in a randomised complete block design with three replications. Weedy plots were kept as control. All the herbicide treatments significantly reduced density and biomass of R. cochinchinensis and other dominating weeds at the flowering stage of rice during both seasons. The best treatment was pendimethalin followed by bentazon + cyhalofop, which caused 88–91% reductions in R. cochinchinensis density over the weedy control (9.4–13.0 plants m−2) during both seasons. It also reduced R. cochinchinensis biomass by 98–99% over the weedy control (331–344 g m−2). Different herbicide sequential treatments also controlled density and biomass of Cyperus rotundus L., Eclipta prostrata L., Echinochloa colona (L.) Link, and Murdannia nudiflora (L.) Brenan over the weedy control. Highest reductions in total weed density (82–84%) and total weed biomass (95–97%) over the weedy control were observed from pendimethalin followed by bentazon + cyhalofop applications during both seasons. All the herbicide treatments increased rice grain yield significantly over the control. The maximum grain yield was obtained from pendimethalin followed by bentazon + cyhalofop applications, which was 4.7 and 3.0 t ha−1 during the dry season, 2013–14 and the wet season, 2014, respectively. The results suggest that the pre-emergence application of pendimethalin followed by the combination of post-emergence herbicides (bentazon and cyhalofop) may control R. cochinchinensis and other noxious weeds in DSR effectively with subsequent increment in rice grain yield.

Relationships among vegetation components in perennial pastures are complex, particularly those including grasses, weeds, legumes, and other forbs. Where herbicides are used for broadleaf weed control, a trade-off may exist between the benefits of weed removal and legume loss. Few studies have separated the contribution of different vegetation components to total forage yield, either prior to or after spraying. Herein we use Structural Equation Modelling (SEM) to quantify relationships among grasses, legumes (Medicago sativa L. or Trifolium spp.), a common noxious weed (Cirsium arvense (L.) Scop), and other forbs, at two locations within the Parkland region of central Alberta, Canada. After removal of broadleaf vegetation with herbicide, we quantified changes in forage relative yield ratio (RYR) for two years. The SEM approach revealed marked differences in the relationships among sward components between sites. At the more mesic site, abundant thistle biomass had little influence on other sward components and no benefit was observed post-spraying from weed removal. In contrast, even low levels of thistle biomass suppressed grass and legume biomass at the more xeric location, and post-spraying responses revealed benefits from weed removal. Unexpectedly, legumes were found to suppress grass biomass at both sites, suggesting strong interspecific competition between forage types. Subsequent removal of legumes appeared to release grass biomass from competition within sprayed plots, as exemplified by increased forage yields two years after spraying. These results highlight the complexity within temperate perennial pastures, and add clarification to the potential short-term impacts of weeds and legumes to overall sward dynamics and forage production.

A survey was made to record the most of common weeds in the study area as well as the dominant, associated and rare species. Five sites were selected for this survey, random sample of weeds, fixing and making herbarium sheets for these weeds and deposited them in Herbarium of Botany Department, Faculty of Science, DamiettaUniversity. Furthermore, the characteristics of the soil were these weeds growing in the orchards of new Damietta were analyzed. The most habitat types in the study area were namely, orchards, sandy fertile cultivated lands, banks of irrigation canals, reclaimed lands and waste lands. 60 wed species related to 23 families most of them are annuals, some hemicrytophytes and few perennials. The recorded species were formed monocots and dicots, with Poaceae(13 species) was the most represented family followed by Asteraceae(10 species). Chorological analysis of the recorded species indicated that the Mediterranean weed species extending into the Euro-Siberian territory attained higher occurrence in the study area as compared to those species with Saharo indian extension. Shannon and Simpson diversity index of site П was the most diverse site while the least diverse was site Ш. It's mean that there variety of species in site П compared with the rest of sites so, thus means that this site is a suitable field for growing a high no. of species. The most important soil variables controlling the distribution and richness of weed species were: soil texture, porosity, water-holding capacity, organic carbon, conductivity, calcium carbonates, chlorides and potassium, sodium and calcium cat ions. Soil pH, water holding capacity, calcium carbonates and soil bicarbonates as the best set of predict or variables of the weed species distribution in the study area. The obtained results will be useful for the determination of weeds of national significance. This approach was used to focus on the key species and make an extensive research on them. Most of these weeds remain significant problem at orchards and field crops. Results will be useful for optimum management of the noxious weeds in orchards.

The C4 pathway is a highly complex trait that increases photosynthetic efficiency in more than 60 plant lineages. Although the majority of C4 plants occupy disturbed, arid, and nutrient-poor habitats, some grow in high-nutrient, waterlogged conditions. One such example is Echinochloa glabrescens, which is an aggressive weed of rice paddies. We generated comprehensive transcriptome datasets for C4 E. glabrescens and C3 rice to identify genes associated with adaption to waterlogged, nutrient-replete conditions, but also used the data to better understand how C4 photosynthesis operates in these conditions. Leaves of E. glabrescens exhibited classical Kranz anatomy with lightly lobed mesophyll cells having low chloroplast coverage. As with rice and other hygrophytic C3 species, leaves of E. glabrescens accumulated a chloroplastic phosphoenolpyruvate carboxylase protein, albeit at reduced amounts relative to rice. The arid-grown species Setaria italica (C4) and Brachypodium distachyon (C3) were also found to accumulate chloroplastic phosphoenolpyruvate carboxylase. We identified a molecular signature associated with C4 photosynthesis in nutrient-replete, waterlogged conditions that is highly similar to those previously reported from C4 plants that grow in more arid conditions. We also identified a cohort of genes that have been subjected to a selective sweep associated with growth in paddy conditions. Overall, this approach highlights the value of using wild species such as weeds to identify adaptions to specific conditions associated with high-yielding crops in agriculture.

Invasive weed species in California's rangelands can reduce herbaceous diversity, forage quality and wildlife habitat. Small-scale studies (5 acres or fewer) have shown reductions of medusahead and yellow starthistle using prescribed grazing on rangelands, but little is published on the effects of pasture-scale (greater than 80 acres) prescribed grazing on weed control and plant community responses. We report the results of a 6-year collaborative study of manager-applied prescribed grazing implemented on rangeland that had not been grazed for 4 years. Grazing reduced medusahead but did not alter yellow starthistle cover. Medusahead reductions were only seen in years that did not have significant late spring rainfall, suggesting that it is able to recover from heavy grazing if soil moisture is present. Later season grazing appears to have the potential to suppress medusahead in all years. In practice, however, such grazing is constrained by livestock drinking water availability and forage quality, which were limited even in years with late spring rainfall. Thus, we expect that grazing treatments under real-world constraints would reduce medusahead only in years with little late spring rainfall. After 10 years of grazing exclusion, the ungrazed plant communities began to shift, replacing medusahead with species that have little value, such as ripgut and red brome.

Yellow toadflax (Linaria vulgaris P. Mill.) infestations in North Dakota increased 300-fold from 1997 to 2011, when the plant was added to the state noxious weed list. Long-term control of other invasive species had included biological control agents, but no effective agents for yellow toadflax had been identified, so a control program using herbicides was needed. The objective was to shift from short-term control with picloram applied in the fall at maximum allowed rates to long-term management with minimal nontarget species impact with an adaptive management approach. Yellow toadflax control was increased from an average of 64% with picloram at 1,120 g ha−1 alone 12 mo after treatment (MAT) to over 90% when applied with diflufenzopyr while the picloram rate was reduced 50%. Yellow toadflax control with aminocyclopyrachlor applied at 140 g ha−1 ranged from 91 to 49% 12 MAT when applied in June or September, respectively. In contrast, yellow toadflax control with picloram plus dicamba plus diflufenzopyr averaged > 90% regardless of application date during the growing season. Land managers now have at least two options for long-term yellow toadflax control with a wide window of application timing. The goal of replacing a single high-use–rate herbicide treatment was met but both picloram and aminocyclopyrachlor can injure many desirable forbs. However, application timing can now be adjusted to have the least impact on nontarget species. The adaptive development program led to a 58% reduction in yellow toadflax infestations in North Dakota by 2014.

Weed management is one of the most important aspects in successful crop production, and with the passage of time, ecological and biological aspects are becoming more significant. Echinochloa crus-galli (L.) Beauv. is among the most noxious weeds in the world due to its superior biology and tremendous ecological adaptations. It causes substantial yield losses in different field crops, especially rice. It is widespread in different countries, infesting numerous cropping systems due to its invasive nature. It has a strong allelopathic potential, which aids resource competition to exert notable yield losses. Herbicide resistance evolution in E. crus-galli is a serious threat to agricultural productivity. This review covers all the aspects on the interface of ecology and biology of E. crus-galli in order to generate useful information for better understanding of the weed behavior. Management scenario of E. crus-galli is also presented with reference to its eco-biological interference. Some cultural strategies like preventive measures, hand weeding, irrigation management, the use of competitive cultivars, and mechanical control are still trustworthy but in integration with other means. Although little research has been done on biological control, it may be helpful under sustainable systems. The use of allelopathy for the management of E. crus-galli is another encouraging domain. Herbicides are inevitable but they must be used in rotations and combinations along with other non-chemical tools to avoid the expansion of herbicide resistance. This review provokes an insight about understanding E. crus-galli biology for better management. This weed is noxious in terms of productivity and profit losses and it should be managed through integrated approaches, keeping in view its interference, ecological procession, biological mechanisms, and evolution.

Chrysanthemoides monilifera Tourn. ex Medik is a noxious weed in Australia and New Zealand. It is a widespread species in southern Africa, where it shows considerable morphological variation that has resulted in a confusing infraspecific taxonomy. We use DNA sequence data from the nuclear Internal Transcribed Spacer (ITS) region from 78 samples of this species from its indigenous distribution range and 10 samples from Australia and New Zealand to determine the regions of origin of the invasive plants. These data are augmented by a smaller study using ISSR markers. Bayesian Inference analysis was somewhat resolved, with many weakly supported nodes. Clades with support tended to correspond to infraspecific taxonomic entities, and were geographically coherent. In contrast, a neighbour-net analysis was not as well resolved and indicated considerable reticulation. All analyses of ITS data retrieved two major clades corresponding to Western and Eastern distributions, with some overlap. Samples from New Zealand and Australia correspond to the taxon C. monilifera subsp. monilifera , and are resolved as most closely related to samples from the greater Cape Town area. Biological control agent populations for C. monilifera subsp. monilifera should be sourced from this region in order to avoid host plant incompatibility problems.

Water hyacinth (Eichhornia crassipes (Mart.) Solms-Laub.) is an invasive aquatic weed that has one of the highest growth indices of vascular plants, producing large amounts of biomass. Its use for composting, livestock feed and biogas production has been proposed as a management strategy for its control. The work presented here is an assessment of the potential spread of water hyacinth due to the release of seeds from the by-products of some of these manufacturing processes. We tested experimentally if the seeds were destroyed or did not lose germinability when they had passed through the gut of sheep, remained in compost piles or been used in biogas bioreactors. We made optical and electronic microscopic observations, and calculated retrieval and germination percentages of the seeds subjected to these treatments. After having passed through the gut of sheep, the anatomical organization of the seed was completely destroyed, only 30.50 ± 5.83% of the seeds were retrieved and the germinability was n...

Brachypodium sylvaticum, a shade-tolerant, forest dwelling, and aggressive invasive grass native to Eurasia, is a noxious weed in California, Oregon, and Washington. This species could cause ecosystem collapse by altering forest fire regimes. To examine interactions with fire, we divided two Willamette National Forest sites into eight units and randomly selected half for treatment with prescribed fire in spring 2011. We assessed the effect of B. sylvaticum on fire (severity and intensity) as well as the effect of fire on B. sylvaticum (cover, seedling emergence, and dispersal). We found that B. sylvaticum cover decreased fire severity but had no effect on intensity. Furthermore, fire severity influenced B. sylvaticum cover; in areas receiving low-severity fire, the grass increased from 21 ± 15.05 to 34 ± 15.81%, but in areas of high-severity fire, cover remained consistently around 0% (0 ± 0% cover in yr 1 to 0.2 5± 0.25% in yr 3). In the field, prescribed fire decreased seedling emergence by 32% compared to controls, but not in an associated greenhouse experiment. However, in the greenhouse, severely burned plots had zero emergence, compared to 0.29 ± 0.14 seedlings low-severity m−2 plot. Fire severity also influenced dispersal in the field; we monitored plots with < 0.5% cover B. sylvaticum initially; when these plots experienced low severity fire, they had greater B. sylvaticum cover (increasing 1,200%), suggesting increased dispersal with less severe fires. High-severity dispersal plots did not experience increased cover. High severity fires have the potential to control the grass, but low-severity fires will likely increase its cover.

Lantana camara, an introduced species by the British has turned itself in to a noxious weed, which has expanded itself in almost all the possible habitats of India. It is a major threat to the ecosystem, including plants and animals. Attempt to combat the further spread of this nuisance species has been of little help. Therefore, in the present discussion an attempt on its impact, toxicity, uses and therapeutic properties have been discussed. A carefully knitted plan should be framed emphasizing on exploiting this species economically as well as on taming the present threat so that the Indian society can be benefitted by properly utilizing the plant and thereby also conserve the ecosystem with its bio resources. The present review paper focuses on the various benefitting sides of the Lantana that would create better livelihood opportunities. DOI: http://dx.doi.org/10.3126/ije.v4i2.12663 International Journal of Environment Vol.4(2) 2015: 348-354

Imperata cylindrica (Cogongrass, Speargrass) is a diploid C4 grass that is a noxious weed in 73 countries and constitutes a significant threat to global biodiversity and sustainable agriculture. We used a cost-effective genotyping-by-sequencing (GBS) approach to identify the reproductive system, genetic diversity and geographic origins of invasions in the south-eastern United States. In this work, we demonstrated the advantage of employing the closely related, fully sequenced crop species Sorghum bicolor (L.) Moench as a proxy reference genome to identify a set of 2320 informative single nucleotide and insertion-deletion polymorphisms. Genetic analyses identified four clonal lineages of cogongrass and one clonal lineage of Imperata brasiliensis Trin. in the United States. Each lineage was highly homogeneous, and we found no evidence of hybridization among the different lineages, despite geographical overlap. We found evidence that at least three of these lineages showed clonal reproduction prior to introduction to the United States. These results indicate that cogongrass has limited evolutionary potential to adapt to novel environments and further suggest that upon arrival to its invaded range, this species did not require local adaptation through hybridization/introgression or selection of favourable alleles from a broad genetic base. Thus, cogongrass presents a clear case of broad invasive success, across a diversity of environments, in a clonal organism with limited genetic diversity.

Mountains are remarkably diverse and globally important as cores of biological diversity. Mountains’ greatest values may be as sources of all the world's major rivers, and those of the Himalayas are no less important in terms of provisioning the ecosystem services that have thus far sustained huge populations of people and high levels of biodiversity. The survival of these ecosystems and wildlife are now threatened by human activities such as timber harvesting, intensive grazing by livestock, tourism, industrialization, and agricultural expansion into forestlands, and, above all, climate change which has led to the invasion of many noxious weeds. The present study aimed to analyze the invasion status of one such noxious weed, lantana (Lantana camara), from the western Himalayan foothills. A total of 122 plant species were recorded as associates from all lantana infested sites comprising 73 shrubs, 39 herbs, five sedges, and three grasses belonging to 47 families. Fabaceae and Asteraceae were found to be t...

Invasive and noxious weeds are well known as a pervasive problem, imposing significant economic burdens on all areas of agriculture. Whilst there are multiple possible pathways of weed dispersal in this industry, of particular interest to this discussion is the unintended dispersal of weed seeds within fodder. During periods of drought or following natural disasters such as wild fire or flood, there arises the urgent need for 'relief' fodder to ensure survival and recovery of livestock. In emergency situations, relief fodder may be sourced from widely dispersed geographic regions, and some of these regions may be invaded by an extensive variety of weeds that are both exotic and detrimental to the intended destination for the fodder. Pasture hay is a common source of relief fodder and it typically consists of a mixture of grassy and broadleaf species that may include noxious weeds. When required urgently, pasture hay for relief fodder can be cut, baled, and transported over long distances in a short period of time, with little opportunity for prebaling inspection. It appears that, at the present time, there has been little effort towards rapid testing of bales, post-baling, for the presence of noxious weeds, as a measure to prevent dispersal of seeds. Published studies have relied on the analysis of relatively small numbers of bales, tested to destruction, in order to reveal seed species for identification and enumeration. The development of faster, more reliable, and non-destructive sampling methods is essential to increase the fodder industry's capacity to prevent the dispersal of noxious weeds to previously unaffected locales.

Jacobaea aquatica (Asteraceae) growing in wet grasslands with low management intensity is regarded as a noxious weed with pyrrolizidine alkaloids (PAs), which cause health problems to livestock. The influence of different management practices on the production of PAs and on the proportion of J. aquatica in the fodder was studied. Five cutting regimes were applied during 4 years on permanent plots in lower Austria. The toxicity of the fodder was assessed by recording dry weight and alkaloid content of J. aquatica and total aboveground biomass. Different cutting regimes had significant effects on the PA content of J. aquatica and on its proportion in the fodder. The content of J. aquatica was lowest in fodder of June and October cuts and highest in second cuts in July and August. Total alkaloid contents exceeding 100 mg/kg were found in fodder harvested in July and August. After cutting, the toxic plants regenerated quickly and produced new flowering stalks within 4-5 weeks. Six macrocylic PAs were evaluated, with Z-erucifoline as the most abundant compound. The alkaloid levels were highest in plants cut during summer when flowering plants were present. Consequently, this fodder should not be fed to livestock over a long period of time.

Common ragweed (Ambrosia artemisiifolia L.) is native to North America; it was introduced into Europe by contaminated agricultural goods from the end of the 19th century. Since then due to its excellent ecological adaptability it has invaded whole Europe. Common ragweed is not only a noxious weed causing yield losses in agricultural crops; it invades disturbed urban areas and its highly allergenic pollen induces allergic rhinitis to sensitive people. In urban areas mowing is the most widely used mean of ragweed control. Plants were mowed early (12 June) at BBCH 33 (3 visibly extended internode), late mowed plots were cut off on (25 July) .inflorescence visible BBCH 51 Mowing twice happened on 12 June and 25 July. At mean plant density of 91 plant/m2 number of female flowers was 150/plant on an average, while that of the male inflorescences were 1676. Mowing treatments significantly decreased the above ground fresh biomass and plant height compared to the none-mowed control. The early mowing treatment did not decrease significantly the number of female flowers. Twice mowed and late mowed treatments significantly decreased the number of female flowers, that of the male inflorescences. Further studies are required to improve seed production decreasing effect of mowing treatments.

The semi-evergreen shrub, Jatropha curcas is native to Central and South America, but now occurs worldwide. Four children suffered severe symptoms of abdominal pain, nausea and vomiting after ingesting the seeds of J. curcas. These cases support the listing of J. curcas as a noxious weed. As a result of this, and a few other incidents, municipal authorities are urged to discourage the use of highly toxic plants such as J. curcas for hedges and garden plants, and to monitor the occurrence of such species. We present a case report about J. curcas poisoning.

In agriculture, weeds have inevitable importance because of reducing the crop growth and also affecting food quality. Although, synthetic herbicides are available to combat these weeds but during recent years there is a trend of using ecofriendly herbicides extracted from natural resources. Present investigation is a continuity of the research, which reported a natural herbicidal compound named as Ophiobolin A from a fungus, Drechslera rostrata. The fungus was incubated in a growth medium of known composition (minimal medium) up to 28 days and its metabolites were extracted with organic solvents. The compound showing bioactivity was purified with the help of Reversed Phase High Performance Liquid Chromatography (RPHPLC) and identified with the help of Spectroscopic techniques viz. Mass Spectroscopy (MS) (LRESIMS and HRESIMS) and Nuclear Magnetic Resonance Spectroscopy (NMR). The purified compound caused death of superficial leaf cells of Chenopodium album, a noxious weed of wheat. Present investigation concludes that the identified compound could be used as structural analogue alternative to synthetic herbicides to synthesize natural herbicides. RESUMO Na agricultura, as plantas daninhas têm uma importância fundamental, por reduzirem o crescimento das culturas e também alterarem a qualidade da comida. Apesar de os herbicidas sintéticos estarem à disposição para combatêlas, nos últimos anos tem-se observado a tendência de usar herbicidas sustentáveis, extraídos de recursos naturais. O presente estudo é uma continuação da pesquisa sobre um composto herbicida natural chamado Ophiobolin A, derivado do fungo Drechslera rostrata. O fungo foi incubado em um meio de cultura de composição conhecida (meio mínimo) por até 28 dias, e seus metabólitos foram extraídos com solventes orgânicos. O composto que apresentou bioatividade foi purificado com a ajuda da Cromatografia Líquida de Alta Eficiência de Fase Reversa (CLAEFR) e identificado com a ajuda das técnicas espectroscópicas, nomeadamente a Espectrometria de Massa (EM) (LRESIMS e HRESIMS) e a Espectroscopia de Ressonância Magnética Nuclear (RMN). O composto purificado causou a morte das células superficiais das folhas de Chenopodium album, uma planta daninha do trigo. O presente estudo concluiu que o composto identificado poderia ser usado como análogo alternativo estrutural aos herbicidas sintéticos para sintetizar herbicidas naturais.

Photosynthetic effects of the leaves extracts from Ipomoea cairica on Partheniumhysterophorus L were studied. Ipomoea cairica dried leaf powder (20g) was dissolved in distilled water (200ml) for foliar application. The seedlings were maintained under natural condition in Insect free net house. The experiment was carried out to analyze the effects of Ipomoea cairica leaves extract by measuring chlorophyll ‘a’, chlorophyll ‘b’, total chlorophyll and carotenoid contents in Parthenium. The experimental plants were sprayed 20 days after emergence and control plants were maintained by a simultaneous spray of distilled water. Leaves of Partheniumhysterophorus were collected at 5 days interval following the foliar application of Ipomoea cairica leaves extract up to 15th day. Results showed that Chlorophyll (total chlorophyll, chlorophyll a and b) and carotenoid content was adversely affected as the duration of Ipomoea cairica leaves extract increased. This potential of Ipomoea cairica can be used as herbicide to control noxious weed Partheniumhysterophorous.

© 2017 Matzrafi, Herrmann, Nansen, Kliper, Zait, Ignat, Siso, Rubin, Karnieli and Eizenberg. Weed infestations in agricultural systems constitute a serious challenge to agricultural sustainability and food security worldwide. Amaranthus palmeri S. Watson (Palmer amaranth) is one of the most noxious weeds causing significant yield reductions in various crops. The ability to estimate seed viability and herbicide susceptibility is a key factor in the development of a long-term management strategy, particularly since the misuse of herbicides is driving the evolution of herbicide response in various weed species. The limitations of most herbicide response studies are that they are conducted retrospectively and that they use in vitro destructive methods. Development of a non-destructive method for the prediction of herbicide response could vastly improve the efficacy of herbicide applications and potentially delay the evolution of herbicide resistance. Here, we propose a toolbox based on hyperspectral technologies and data analyses aimed to predict A. palmeri seed germination and response to the herbicide trifloxysulfuron-methyl. Complementary measurement of leaf physiological parameters, namely, photosynthetic rate, stomatal conductence and photosystem II efficiency, was performed to support the spectral analysis. Plant response to the herbicide was compared to image analysis estimates using mean gray value and area fraction variables. Hyperspectral reflectance profiles were used to determine seed germination and to classify herbicide response through examination of plant leaves. Using hyperspectral data, we have successfully distinguished between germinating and non-germinating seeds, hyperspectral classification of seeds showed accuracy of 81.9 and 76.4%, respectively. Sensitive and resistant plants were identified with high degrees of accuracy (88.5 and 90.9%, respectively) from leaf hyperspectral reflectance profiles acquired prior to herbicide application. A correlation between leaf physiological parameters and herbicide response (sensitivity/resistance) was also demonstrated. We demonstrated that hyperspectral reflectance analyses can provide reliable information about seed germination and levels of susceptibility in A. palmeri. The use of reflectance-based analyses can help to better understand the invasiveness of A. palmeri, and thus facilitate the development of targeted control methods. It also has enormous potential for impacting environmental management in that it can be used to prevent ineffective herbicide applications. It also has potential for use in mapping tempo-spatial population dynamics in agro-ecological landscapes.

Horse purslane (Trianthema portulacastrum Linn.) of family Aizoacae is native to South Africa and has been reported to be present in India, Pakistan, Tropical America, West Asia, Sri Lanka and Africa. It has become noxious due to substantial yield reduction on account of competition in several cultivated crops. The aim of this review is to provide general information about the physiology, distribution, ill effects, and management of horse purslane. Various methods has been tried to control this weed, but no single method would be adequate to manage horse purslane, and there is a need to integrate various management options. Successful management of this weed can only be achieved by an integrated approach with biological control as the key element.

Background Loose silky bentgrass (Apera spica-venti) is an important weed in Europe with a recent increase in herbicide resistance cases. The lack of genetic information about this noxious weed limits its biological understanding such as growth, reproduction, genetic variation, molecular ecology and metabolic herbicide resistance. This study produced a reference transcriptome for A. spica-venti from different tissues (leaf, root, stem) and various growth stages (seed at phenological stages 05, 07, 08, 09). The de novo assembly was performed on individual and combined dataset followed by functional annotations. Individual transcripts and gene families involved in metabolic based herbicide resistance were identified. Results Eight separate transcriptome assemblies were performed and compared. The combined transcriptome assembly consists of 83,349 contigs with an N50 and average contig length of 762 and 658 bp, respectively. This dataset contains 74,724 transcripts consisting of total 54,846,111 bp. Among them 94% had a homologue to UniProtKB, 73% retrieved a GO mapping, and 50% were functionally annotated. Compared with other grass species, A. spica-venti has 26% proteins in common to Brachypodium distachyon, and 41% to Lolium spp. Glycosyltransferases had the highest number of transcripts in each tissue followed by the cytochrome P450s. The GSTF1 and CYP89A2 transcripts were recovered from the majority of tissues and aligned at a maximum of 66 and 30% to proven herbicide resistant allele from Alopecurus myosuroides and Lolium rigidum, respectively. Conclusions De novo transcriptome assembly enabled the generation of the first reference transcriptome of A. spica-venti. This can serve as stepping stone for understanding the metabolic herbicide resistance as well as the general biology of this problematic weed. Furthermore, this large-scale sequence data is a valuable scientific resource for comparative transcriptome analysis for Poaceae grasses. Electronic supplementary material The online version of this article (doi:10.1186/s12864-017-3538-4) contains supplementary material, which is available to authorized users.

Author(s): Ceseski, Alex; Al-Khatib, Kassim; Dahlberg, Jeffrey A | Abstract: Johnsongrass (Sorghum halepense) is a summer perennial grass native to the Mediterranean region. It was introduced to the Southern United States in the early 1800s as a perennial forage crop and is still in use for cattle grazing in many states. After introduction, it escaped cultivation and is now present or naturalized in nearly every state in the continental United States. It is recognized as invasive or as a noxious weed throughout the south, southwest, and west and is one of the ten most troublesome weeds in the world. Learn effective ways to manage infestations.

Summary Weedy rice is the same biological species as cultivated rice (Oryza sativa); it is also a noxious weed infesting rice fields worldwide. Its formation and population‐selective or ‐adaptive signatures are poorly understood. In this study, we investigated the phylogenetics, population structure and signatures of selection of Korean weedy rice by determining the whole genomes of 30 weedy rice, 30 landrace rice and ten wild rice samples. The phylogenetic tree and results of ancestry inference study clearly showed that the genetic distance of Korean weedy rice was far from the wild rice and near with cultivated rice. Furthermore, 537 genes showed evidence of recent positive or divergent selection, consistent with some adaptive traits. This study indicates that Korean weedy rice originated from hybridization of modern indica/indica or japonica/japonica rather than wild rice. Moreover, weedy rice is not only a notorious weed in rice fields, but also contains many untapped valuable traits or haplotypes that may be a useful genetic resource for improving cultivated rice.

Invasive weed species are introduced plants (nonnative) that can spread and invade new habitats. Thus, the term ‘invasive’ is most often utilized for any introduced species (‘nonindigenous’ or ‘nonnative’) that can degrade the habitats they invade. Other commonly used synonyms are exotic pest plants, alien species, invasive exotics, or noxious weeds. The best way to avoid problems is to prevent introductions of invasive species in the first place. Once introduced, invasive species can be managed by a variety of methods so that their populations remain restricted and their impacts are minimized. Control methods should be based on the principles of integrated weed management, which is as a combination of preventive, cultural, mechanical, and chemical practices.

Sicklepod (Senna obtusifolia L.) is synonymous both with Cassia tora L. and Cassia obtusifolia L.). It is usually viewed as a noxious weed in crop fields in southeastern United States. This plant, however, has a long history of use in traditional medicine in oriental countries. It is a prolific seed producer the constituents of which include: polysaccharides, proteins, highly colored low fat content and many phenolic compounds. The phenolic components are usually described as toxic, although recent literature shows many of these to exhibit potent therapeutic properties for human health. Pursuant to this as part of our continuing interest in the plant, we have expanded our study of the seed by extracting a mixture of anthraquinone and naphthopyrone glycosides from S. obtusifolia seed obtained from North Carolina. A survey of the composition of the extract was affected using High Performance Liquid Chromatography-Electrospray Ionization-Mass Spectrometry (HPLC-ESI-MS) with a variety of collision induced dissociation (CID) experiments. The major constituents of the mixture produced HPLC-ESI-MSn data consistent with: chrysophanic acid tetraglycoside; rubrufusarin and toralactone di-, tri- and tetraglycosides; torachrysone ester, di-, tri-, tetra- and pentaglycosides and cassialactone tetraglycoside. The naphthopyrone glycosides and related phenolic compounds in the seed are value-added medicinal co-products to the galactomannan polysaccharides of S. obtusifolia. FT-IR spectra of the mixture corroborate the chromatographic information obtained of the mixture of anthraquinone glycosides.

Purple ammannia (Ammannia coccinea Rottb.) is an exotic weed originated from North America. It was known to be a noxious weed in a rice paddy field for the competition with rice. We investigated its distribution and habitat types in Korea to obtain basic data for the management plan of this species. Although purple ammannia is currently not a dominant species in natural habitats, its nationwide distribution was found in our study. We categorized the types of its habitats as margins of rice paddies, abandoned paddy fields, riverine wetlands and reservoirs. Particularly, purple ammannia plants were frequently located along banks of irrigation channels that ran through rice paddies and surrounding wetlands. Because they mainly occurred along the direction of water flow, we considered that the plants have spread along water courses. A total of 69 vascular plant taxa was identified at the habitats of purple ammannia. The largest group of life form among purple ammannia population was therophytes, which indicates that purple ammannia mostly grow in the disturbed habitats.

Introduced exotic plants can drive ecosystem change. We studied invasion and establishment ofBrassica tournefortii(African mustard), a noxious weed, in the Chemehuevi Valley, western Sonoran Desert, California. We used long-term data sets of photographs, transects for biomass of annual plants, and densities of African mustard collected at irregular intervals between 1979 and 2009. We suggest that African mustard may have been present in low numbers along the main route of travel, a highway, in the late 1970s; invaded the valley along a major axial valley ephemeral stream channel and the highway; and by 2009, colonized 22 km into the eastern part of the valley. We developed predictive models for invasibility and establishment of African mustard. Both during the initial invasion and after establishment, significant predictor variables of African mustard densities were surficial geology, proximity to the highway and axial valley ephemeral stream channel, and number of small ephemeral stream channels. The axial valley ephemeral stream channel was the most vulnerable of the variables to invasions. Overall, African mustard rapidly colonized and quickly became established in naturally disturbed areas, such as stream channels, where geological surfaces were young and soils were weakly developed. Older geological surfaces (e.g., desert pavements with soils 140,000 to 300,000 years old) were less vulnerable. Microhabitats also influenced densities of African mustard, with densities higher under shrubs than in the interspaces. As African mustard became established, the proportional biomass of native winter annual plants declined. Early control is important because African mustard can colonize and become well established across a valley in 20 yr.

In southern Quebec, Canada, Trifolium species are commonly used as supplement ground cover along roadside of major roads to assist turf recruitment. They often fail to establish particularly near roadside edges. The noxious weed, Ambrosia artemisiifolia, exploits the empty niches. Based on an assumption that heavy metal stress mainly drives plant species shift, we conducted a field experiment to test the emergence of four species near roadside edges along a metal gradient. The test species included a clover ground cover (Trifolium arvense), two candidate ground covers (Lotus corniculatus and Coronilla varia), and the weed (A. artemisiifolia). Two hundred wet-cold stratified seeds of each species were sown in plots (20 × 30 cm), assigned separately for one of four species treatments, replicated three times. We measured final emergence percentage and soil metal contents and analyzed their correlations. T. arvense emergence was negatively correlated with Zn, Pb, and Cu. In contrast, A. artemisiifolia emergence was positively correlated with Zn, Pb, and Cu. The experiment supports the hypothesis that A. artemisiifolia colonization along roadside edges may be attributing to its greater tolerance for Zn, Pb, and Cu than T. arvense. In evaluating the two legume candidates, L. corniculatus was positively correlated with Zn, Pb, and Cu like A. artemisiifolia, while C. varia emergence did not have significant relationship with Pb and Cu. The current finding implies that L. corniculatus can be a good candidate because of its emergence performance and its tolerance to heavy metal, similarly to that of A. artemisiifolia.

Orobanche spp. are serious and difficult weed to control to many economically important plants. Theseed bank of this noxious weed in soil can be reduced by using trap crop. But all the seed bankreduction is not due to trap crop only; some reduction is also contributed by edaphic and/orpathogenic factors. So in the present study, the relationship between reduction in Orobanche seedbank in soil and loss of seed viability due to trap crop has been investigated in pots and naturalinfested fields at Vedabari (Field A) and Beldia (Field B). Results of viability loss and seed bankreduction indicated that nearly 11% to 25% of the reduction of seed density of Orobanche in soil iscontributed by seed viability loss due to trap crops. On combining data of all three experiments, itwas found that the loss of seed viability in Orobanche due to combined effects of treatments with testcrops was nearly 24%. When the value obtained from viability loss and seed bank reduction iscompared with the value obtained in control treatment, it is found that the contribution of edaphicfactors for seed bank reduction is about 76% and that of tested trap crops is about 24%, respectively.DOI: http://dx.doi.org/10.3126/eco.v20i0.11471ECOPRINT An International Journal of EcologyVol. 20, 2013page: 97-106

The genus Echinochloa (L.) P. Beauv. is a very difficult genus due to many interspecific and intraspecific forms found in the nature. This genus is still taxonomically controversial due to the absence of reliable morphological characters, resulting in poor taxonomic understanding of the genus. It has approximately 3040 species, mainly distributed in the tropical and warm temperate regions, usually associated with wet or damp places, of the world (Clayton and Renvoize, 1999). This genus includes some of noxious weeds, such as E. crusgalli (L.) P. Beauv., E. oryzicola Vasinger, and E. colona (L.) Link in agricultural areas of the world. The dominance of these species causes serious yield loss if they are not appropriately controlled in the fields (Hill et al., 1985). The two species, E. crus-galli and E. oryzicola are problematic weeds in Korean agricultural fields as well. The Korean agronomists are confused about identifying this difficult genus using morphological characters because E. crus-galli not only exhibits very diverse morphological and ecological types, but also includes several varieties such as var. echinata (Willd.) A. Chev. and var. praticola Ohwi. However, these two varieties, echinata and praticola, have been treated as synonyms of var. crus-galli depending on taxonomists (The Plant List, 2014). It has been known that eight morphological taxa of the genus, E. crus-galli var. crus-galli, var. echinata, var. praticola, E. oryzicola, E. colona, E. glabrescens Munro ex Hook.f., E. oryzoides (Ard.) Fritsch, and E. esculenta (A.Braun) H.Scholz, are distributed throughout Korea (Lee et al., 2013). Echinochloa crus-galli grows in the upland fields and also in paddy fields whereas E. oryzicola is frequently found in paddy fields. These two species are mainly found in the whole country. Existence of E. colona and E. glabrescens in Korea, however, should be reexamined. The result of a previous study showed that two species E. colona and E. glabrescens collected from Korea was clustered with E. crus-galli. They were not clustered with E. colona collected from China and/or formed independent clade (in press). The continuous use of the herbicides which have the same ABSTRACT. Echinochloa (L.) P. Beauv. includes some of the noxious weeds, causing a serious yield loss when they are dominant in the fields. Identification of the Echinochloa is very difficult because many interspecific and intraspecific forms of the species are found. However, it is important to identify the species exactly and to know the genetic diversity of the species for effective weed management. This study was conducted to identify and summarize the Echinochloa species by comparing the genetic variation and relationship among Korean Echinochloa species using SSR. The genetic diversity of 107 individuals, including seven species were assessed using five SSR markers. UPGMA dendrogram generated two clades (I and II) and clade II divided again into two subclades (II-1 and II-2) whereas the model based genetic structure proposed four subpopulations. The two subpopulations were corresponded to clades I and II-1 and the other two were arranged to clade II-2 of the UPGMA dendrogram. We have concluded that E. colona and E. glabrescens might have not distributed in Korea. The biological varieties, praticola and echinata, of E. crus-galli should be treated as E. crus-galli. Korean Echinochloa should be summarized with four species, i.e., E. oryzicola, E. crus-galli, E. esculenta, and E. oryzoides.

Invasion biologists often think about feasibility of weed control in purely ecological terms, while land managers’ feasibility definitions are further informed by social, policy, and institutional considerations. We use the case of cheatgrass (Bromus tectorum) in the Eastern Sierra Nevada in California to examine the origins and practical significance of differences between scientific and managerial definitions of feasibility. A serious invasive weed and a major ecological threat to the region, cheatgrass in the Eastern Sierra still exists in the kinds of low-density patches that are technically amenable to containment through active management. Yet land managers in this region dominated by public land are not using active management. We conducted a study of the reasons for the apparent disconnect between management potential and management realities, combining semi-structured interviews of public land managers in the region with analysis of the policy and institutional landscape in which land managers operate. We found that managers are concerned about cheatgrass impacts on the region but face a number of barriers to the deployment of useful spread prevention techniques. The de-prioritization of cheatgrass, which is not listed as a noxious weed under either California or federal law, along with resource constraints exacerbated by such policy de-prioritization form one important set of barriers. Certain substantive and procedural requirements of federal and state environmental law form another barrier: they can limit swiftness and flexibility of managerial action and make managers more hesitant to launch such action; they also provide a venue for public opposition to herbicide-based management or directly restrict managers’ access to useful herbicide treatments. We end with some thoughts on increasing the feasibility of cheatgrass control in eastern California. Many of these are broadly relevant to improving invasion management on public lands.

Current understanding is that high planting density has the potential to suppress weeds and crop-weed interactions can be exploited by adjusting fertilizer rates. We hypothesized that (a) high planting density can be used to suppress Rottboellia cochinchinensis growth and (b) rice competitiveness against this weed can be enhanced by increasing nitrogen (N) rates. We tested these hypotheses by growing R. cochinchinensis alone and in competition with four rice planting densities (0, 100, 200, and 400 plants m-2) at four N rates (0, 50, 100, and 150 kg ha-1). At 56 days after sowing (DAS), R. cochinchinensis plant height decreased by 27-50 %, tiller number by 55-76 %, leaf number by 68-84 %, leaf area by 70-83 %, leaf biomass by 26-90 %, and inflorescence biomass by 60-84 %, with rice densities ranging from 100 to 400 plants m-2. All these parameters increased with an increase in N rate. Without the addition of N, R. cochinchinensis plants were 174 % taller than rice; whereas, with added N, they were 233 % taller. Added N favored more weed biomass production relative to rice. R. cochinchinensis grew taller than rice (at all N rates) to avoid shade, which suggests that it is a "shade-avoiding" plant. R. cochinchinensis showed this ability to reduce the effect of rice interference through increased leaf weight ratio, specific stem length, and decreased root-shoot weight ratio. This weed is more responsive to N fertilizer than rice. Therefore, farmers should give special consideration to the application timing of N fertilizer when more N-responsive weeds are present in their field. Results suggest that the growth and seed production of R. cochinchinensis can be decreased considerably by increasing rice density to 400 plants m-2. There is a need to integrate different weed control measures to achieve complete control of this noxious weed.

article i nfo Bushmint (Hyptis suaveolens (L.) Poit.) is one among the world's most noxious weeds. Bushmint is rapidly invad- ing tropical ecosystems across the world, including India, and is major threat to native biodiversity, ecosystems and livelihoods. Knowledge about the likely areas under bushmint invasion has immense importance for taking rapid response and mitigation measures. In the present study, we model the potential invasion range of bushmint in India and investigate prediction capabilities of two popular species distribution models (SDM) viz., MaxEnt (Maximum Entropy) and GARP (Genetic Algorithm for Rule-Set Production). We compiled spatial layers on 22 climatic and non-climatic (soil type and land use land cover) environmental variables at India level and selected least correlated 14 predictor variables. 530 locations of bushmint along with 14 predictor variables were used to predict bushmint distribution using MaxEnt and GARP. We demonstrate the relative contribution of predictor variables and species-environmental linkages in modeling bushmint distribution. A receiver operating character- istic (ROC) curve was used to assess each model's performance and robustness. GARP had a relatively lower area under curve (AUC) score (AUC: 0.75), suggesting its lower ability in discriminating the suitable/unsuitable sites. Relative to GARP, MaxEnt performed better with an AUC value of 0.86. Overall the outputs of MaxEnt and GARP matched in terms of geographic regions predicted as suitable/unsuitable for bushmint in India, however, predic- tions were closer in the spatial extent in Central India and Western Himalayan foothills compared to North-East India, Chottanagpur and Vidhayans and Deccan Plateau in India.

Models have been developed to simulate the long-term effects of weed treatments across a landscape to determine effective management strategies, but those models might not be suitable for evaluating short-term action plans of weed treatments that are specific in time and place. In this study, we developed a simulation model to build and evaluate 5-yr weed treatment plan options in terms of their cost and effectiveness in minimizing total infestation areas over the short-term planning horizon. In an iterative, interactive process, 5-yr treatment plan options are developed based on user-defined weed treatment preferences, and evaluated in terms of total projected infestation areas at the end of the planning horizon. The simulation model was applied to a study area of 24,867 ha (61,447 ac) located in the Salmon River watershed in Idaho. Eight treatment plan options were developed using two treatment priority strategies and four increasing budget levels, and compared for their effectiveness. The application results showed that regardless of budget levels, site priority strategies were more cost-effective than the species priority strategies in reducing total infestation areas over time. This simulation model can provide weed managers with a useful tool to evaluate short-term treatment options, and thus support informed decision-making for effective weed management. Although the availability and quality of input data may be a practical limitation of using the simulation model, more data would become available and improved as more invasive species monitoring programs are implemented.

Pale swallowwort (PSW) and black swallowwort (BSW) are two viney milkweeds native to Europe that have increasingly become problematic and noxious weeds in eastern North America. An indigenous fungal isolate, Sclerotium rolfsii VrNY, was discovered causing significant mortality in a dense stand of PSW in a park in upstate New York. Although this fungus is a known pathogen with a broad host range, we evaluated the host potential of S. rolfsii VrNY on a limited range of related and nonrelated U.S. species as a critical first step to assess its suitability as a mycoherbicide for PSW and BSW. In addition, PSW and BSW produce the specific stereoisomer (−)-antofine, a compound with antimicrobial and phytotoxic activity that could inhibit the pathogen. Tests revealed this compound had no effect on S. rolfsii VrNY. This isolate caused significant mortality on all broadleaf plants tested (Asclepias syriaca, Asclepias curassavica, Apocynum cannabinum, Monarda fistulosa, Rudbeckia hirta, PSW, BSW) with the exception of Glycine max, and had no effect on the monocots Schizachyrium scoparium and Zea mays. Although these laboratory studies indicate that most broadleaf vegetation may be susceptible to the pathogen, S. rolfsii might have potential as a mycoherbicide in natural eco-niche environments where invasive PSW and BSW have already become the predominant vegetation. Further laboratory testing of S. rolfsii and limited field testing at the initial discovery site are needed in order to prevent premature rejection of this isolate as a potential management tool against these highly invasive weeds.

Parthenium weed (Parthenium hysterophorus L.) is one of the most aggressive invasive weeds, threatening natural ecosystems and agroecosystems in over 30 countries worldwide. Parthenium weed causes losses of crops and pastures, degrading the biodiversity of natural plant communities, causing human and animal health hazards and resulting in serious economic losses to people and their interests in many countries around the globe. Several of its biological and ecological attributes contribute towards its invasiveness. Various management approaches (namely cultural, mechanical, chemical and biological control) have been used to minimise losses caused by this weed, but most of these approaches are ineffective and uneconomical and/or have limitations. Although chemical control using herbicides and biological control utilising exotic insects and pathogens have been found to contribute to the management of the weed, the weed nevertheless remains a significant problem. An integrated management approach is proposed here for the effective management of parthenium weed on a sustainable basis.

Experiments were conducted to evaluate factors affecting persistence of the invasive, federal noxious weed Benghal dayflower in sustainable agronomic systems. Seeds were exposed to a range of temperatures simulating those found in hay bales in the field and periodically tested for viability over 21 days. Seeds were nonviable after one day at 65 °C and after 14 days at 50 or 45 °C. A second series of experiments examined the effects of simulated rumen digestion on germination and viability of Benghal dayflower seeds and the response was compared to that with seeds of five other common weed species. Time courses revealed that seeds from the other weeds were acutely damaged by digestion and viability depressed after 48 and 96 h, but germination of Benghal dayflower seeds was increased at 48 h, and only a slight decrease occurred after 96 h. In the third experimental series, stem fragments of Benghal dayflower were buried in soil at 2 and 6 cm depths and exposed to aerial temperatures of 20, 25, 30, and 35 °C...

Climate warming is likely to change the ways in which plants interact with their insect mutualists, for example through changes in phytochemistry. In particular, this may have implications for the ways in which we manage noxious weeds, which may spread more quickly if they experience stronger mutualistic interactions. We grew the invasive nodding thistle, Carduus nutans, in two experimental treatments in the field: either passively warmed with open top chambers or at ambient temperatures. We collected pollen from thistles in each treatment and analysed the total protein, lipid, and carbohydrate content. We observed no difference in the pollen protein or carbohydrate content, but the total lipid content of the pollen was significantly higher in warmed plants. We conducted a total of 12.75 h of observations of putatively mutualistic, flower-visiting insects. In addition, we spent 4.17 h collecting bees that visited thistle inflorescences in the treatments, allowing us to identify them to species. We found a significant increase in the abundance of flower-visiting insects in the observations, but not bee abundance in collections. In addition, there was no treatment effect on the number of flower-visiting morphotypes in the observations, or bee species richness in the collections. However, a nonparametric test did identify a significant effect of warming on the composition of flower-visiting morphotypes in observations and bee species in collections. Overall, the warming treatment significantly increased lipid content of the pollen, but had relatively weak effects on insect visitation patterns. However, these effects may be amplified at larger spatial and temporal scales or higher temperatures.

Brachiaria eruciformis (Sm.) Griseb. is a noxious weed of Australia and other parts of the world. The effects of different environmental conditions on the seed germination and seedling emergence of three biotypes sourced from different cropping systems (mungbean field, sorghum field, and fenceline) of this weed were evaluated. There were no differences in the response of biotypes to the evaluated factors, therefore, the data was pooled across the biotypes. The highest germination rate was observed at 30/20 &deg, C, and seeds germinated both in light and dark conditions. Seed germination was influenced by different sodium chloride (NaCl) concentrations and water potentials, and no seeds germinated at 200 mM NaCl and &minus, 0.8 MPa water potential. Seeds germinated (&gt, 70%) at a broad range of pH, from 4 to 10. Compared with seeds sown on the soil surface, a burial depth of 4 cm reduced the seedling emergence by 84%. Similarly, a sorghum residue amount of 4 t ha&minus, 1 on the soil surface reduced the seedling emergence by 65%, compared with no sorghum residue cover. No seedlings emerged from seeds buried at 8 cm depth and &gt, 4 t ha&minus, 1 sorghum residue. This study suggests that burying seeds deep into the soil through tillage or employing a residue cover on the soil surface can reduce B. eruciformis emergence.

The specific conditions in habitats in the immediate vicinity of roads provide a suitable environment for noxious weeds and invasive species that spread through them to the landscape. Echinochloa crus-galli and Digitaria sanguinalis are problematic weeds of wide-row crops. The field experiment focused on the impact of the roadside habitat salinization on the occurrence, growth and reproduction of these two species. Quantitative vegetative and generative characteristics of the plants were determined. Measurements were carried out at three distances from the edge of the road and on control plots. The results showed that the growth and reproduction of E. crus-galli and D. sanguinalis occur in the period when the values of soil environmental variables correspond to values of non-saline soil according to the criteria for soil salinity assessment. Despite this fact, the average salinity of soil along roadside was still higher than in soil of further distances and we found these levels of salinity to be well tolerated by the study species. Therefore, we conclude that roadsides with the same or higher salt content represent a suitable location for the occurrence and reproduction of E. crus-galli and D. sanguinalis, thus being temporary locations that enable their further spreading to the countryside.

Tribulus terrestris L. (TT) (puncturevine) is a common weed that grows in many countries worldwide and in some places is considered as a noxious weed. The plant has been used in traditional Chinese and Indian medicines and is now considered as one of the most popular aphrodisiacs. It is known for its healing properties for sexual difficulties, impotence, and human and animal hormonal imbalance. It is also used as a sexual booster. Because of the plant’s active substances that can be used for curing sexual and other disorders, interest in it is increasing, and it is currently one of the most studied medicinal plants. The products and preparations manufactured from the aboveground plant parts are especially popular among athletes and people with health issues and diseases such as hormonal imbalance, sexual problems, heart problems, and various kidney and skin diseases. The aim of this review is a comprehensive and critical assessment of the scientific publications involving TT, with special reference to its chemical constituents and biological properties that may facilitate current understanding and future studies of this fascinating plant species. The objectives of this review were (1) to find knowledge gaps, (2) to discuss critically relevant publications and issues with materials and methods that may be prerequisites for contradictory results, and (3) to identify research and development areas. It was found that some of the studies on TT extracts as aphrodisiacs are controversial. A significant number of research publications claim that TT extracts and nutritional supplements containing TT improve muscle tone, have a common biostimulating effect, and improve spermogenesis. However, there are a growing number of publications that dispute these claims, as there are no empirical data on commonly accepted mechanisms of action. The main biologically active substances in TT are steroidal saponins, flavonoids, alkaloids, and lignan amides, the most studied being the steroidal saponins. Multiyear data on the metabolic profile of the species are generally lacking. There are a variety of methods used for extracting plant material, differences in methodologies and saponin analyses, and scientific instruments that were used. Lack of common standards could be a reason for differences in the pharmacological activity and composition of the TT preparations. Development of standard procedures and methods for collection of plant material and analyses are recommended. Selection and breeding efforts and agronomic studies of promising clones of TT would need to be conducted in order to develop TT as a new crop. This will provide consistency of supply and quality of the feedstock for the pharmaceutical industry and could provide a new cash crop for growers.

Echinochloa crusgalli (L.) Beauv. (barnyard grass) is considered a noxious weed worldwide, and is the most pernicious weed decreasing rice yields in China. Recently, E. crusgalli has evolved quinclorac resistance, making it among the most serious herbicide resistant weeds in China. The present study explored differences in germination and growth between quinclorac-resistant and -susceptible E. crusgalli collected in Hunan Province. The order of the seven E. crusgalli biotypes assessed, from high to low quinclorac-resistance, was: quinclorac-resistant, Chunhua, Hanshou, Shimen, Hekou, Dingcheng, and quinclorac-susceptible. With an increased in the level of quinclorac-resistance, the germination rate, length of young shoots and roots, and fresh weight of E. crusgalli were all decreased compared with that in more susceptible biotypes. However, there were no significant differences between quinclorac-resistant and susceptible E. crusgalli biotypes without polyethylene glycol 6000 treatment. Drought had a more obvious effect on glutathione S-transferases (GST) activity, determined by spectrophotometric method, in quinclorac-resistant E. crusgalli. Higher resistance level biotypes showed greater activity, and when treated with polyethylene glycol 6000 for 3 days, all E. crusgalli biotypes showed the highest GST activity. This study demonstrated that as the level of quinclorac-resistance increased, the rate of seed germination decreased, while the growth of young buds, young roots, and fresh weight decreased. Increased quinclorac-resistance may be related to the increased metabolic activity of GST in E. crusgalli.

Xanthium strumarium L. var. canadense (Mill.) Torr. & A. Gray (Canada cocklebur; Asteraceae), an annual herb native to North America, has been widely naturalized in Eurasia (Yin et al. 2012). This introduced plant was first recorded in Beijing in 1991 and now has spread into many provinces in China such as Hebei, Shandong, Liaoning, Jilin, Heilongjiang, Guangdong, Guangxi, and Xinjiang. This invasive, noxious weed generally invades disturbed habitats such as wastelands, riverbanks, roadsides, meadows, and croplands, causing serious ecological and economic impacts in China (Zhao et al. 2014). To determine its distributions and natural enemies in Liaoning Province, we carried out field surveys in the summer of 2016. On August 7, dodder was first found on Canada cocklebur at three disturbed sites (N 41°49′15.41″ to 41°49′20.81″, E 123°34′56.37″ to 123°35′05.41″, 54 to 57 m above sea level) along the Xinkai River in Shenyang (with temperate continental monsoon climate), Liaoning Province, Northeast China. At each site we found a nearly circular patch of Canada cocklebur (3, 5, and 8 m in diameter, respectively) that was parasitized by dodder. Cocklebur parasitized by the dodder showed wilting and senescent leaves, stunted growth, and few or no fruit produced. The dodder wrapped around petioles and stems of the invasive weed, and it occasionally spread onto cooccurring native plants such as Setaria viridis (L.) Beauv. and Humulus scandens (Lour.) Merr. Where the dodder penetrated the cocklebur stem tissues, brownish black lesions developed with small cracks. Based on its inflorescence, bracts, calyces, pedicles, flowers, capsule, ovary, and seed, the dodder was identified as Cuscuta australis R. Br. (Wu 1979; Zhao et al. 2015). The morphological identification was confirmed by molecular evidence. We measured the base sequence of the internal transcribed spacer (ITS) region of ribosomal DNA of the dodder (amplified with S2F-S3R as primers) and found that it (deposited into GenBank; accession no. MH370812) was 99.75% similar to that of C. australis in GenBank (AY554398). Our dodder was 96.47% similar to the nearest relative, C. epithymum (AY554400.1) (Revill et al. 2005). Dodder is distributed worldwide from temperate to tropical regions. It has been found parasitizing other invasive plants such as Ambrosia artemisiifolia (Zhao et al. 2015). To our knowledge, this is the first report of C. australis parasitizing Canada cocklebur in China. The dodder produced 228 to 2,985 seeds (1.05 to 1.22 mm in length) on each infested host and reduced aboveground biomass of the cocklebur by 68.70 to 80.69% and fruit production by 87.59 to 97.21% in the field (data not shown). The dodder and other natural enemies such as Puccinia xanthii (Zhao et al. 2014) may mitigate the impacts of the invasive cocklebur in China.

Parthenium hysterophorus L. (Asteraceae) is an annual or short-lived perennial herbaceous noxious weed native to North and South America. Parthenium has spread in Kenya and has become a menace to agriculture. Stunted and wilted Parthenium plants with globular galled roots marked with profuse roots were observed in a field in Tigoni, Kiambu County (average, 15.3°C; Koeppen-Geiger Climate Classification Cfb). Nematodes were extracted from root zone soil using the Baermann tray, and population densities of infective second-stage juveniles ranged from 300 to 980 individuals per 100 cm³ of soil. Mature females and their corresponding egg masses were handpicked from a single infected plant root. The posterior part of 20 adult Meloidogyne females was used for morphological analysis and the respective anterior part stored in ethanol for molecular analysis. Analysis of perineal patterns (Eisenback et al. 1980) revealed 13 (65%) Meloidogyne hapla and 7 (35%) M. javanica. To confirm pathogenicity, infection assays with one or two species were performed. Egg masses from pure cultures each containing 410 to 530 eggs were inoculated onto individual Parthenium plants growing in sterile soil in a greenhouse maintained at ∼25°C (average). For monoinfection two egg masses from one species and for coinfection one egg mass of each species were used. Fifteen plants per treatment were inoculated. At 45 days postinfection, the number of egg masses on Parthenium inoculated with M. hapla only was 129 ± 19.5 per root system, whereas M. hapla + M. javanica coinoculation was 188 ± 23.6. On plants inoculated with M. javanica only, no egg masses or galls were observed, indicating that M. hapla facilitates infection of M. javanica on this plant. There was no clear difference in root galling on the monoinfected and coinfected plants. To confirm identification of both species, molecular analysis was performed on females extracted from the field and the greenhouse. DNA was extracted from ethanol-preserved females (n = 10), and polymerase chain reaction (PCR) was carried out using species-specific sequence-characterized amplified region primer set JMV1(5′-GGATGGCGTGCTTTCAAC-3′/JMV (5′-AAAAATCCCCTCGAAAAATCCACC-3′) for M. hapla and Fjav (GGTGCGCGATTGAACTGAGC)/Rjav (CAGGCCCTTCAGTGGAACTATAC) for M. javanica (Zijlstra et al. 2000), producing the expected fragment lengths of 440 and 670 bp, respectively. To further confirm species identification of M. hapla, the same DNA (n = 10) was amplified targeting the mitochondrial DNA region between COII and 16S rRNA gene and sequenced using primers C2F3 (GGTCAATGTTCAGAAATTTGTGG)/1108 (TACCTTTGACCAATCACGCT) (Powers and Harris 1993). Identification of M. javanica was reconfirmed by amplifying the mitochondrial NAD5 gene and sequencing using primers NAD5F2 (TATTTTTTGTTTGAGATATATTAG)/NAD5RI (CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). The PCR products (i.e., KX137039 and KY436071) were sequenced and aligned with sequences in GenBank. BLAST analysis resulted in 99 to 100% identity to M. hapla and M. javanica, respectively. From 5 of the 15 plants, 20 females were randomly sampled. Samples from individual plants were analyzed morphologically and separately for each plant. Anterior parts of 10 of the 20 females were used for PCR analysis. In total, 70% were M. hapla and 30% M. javanica. There were no differences in the appearance of the galls between the treatments. This is the first report of coinfection by M. hapla and M. javanica on Parthenium. M. hapla can infect Parthenium and facilitates infection by M. javanica. Our findings hint on complex interaction of Meloidogyne spp. and their hosts. Because Parthenium is drought tolerant and can aggressively colonize disturbed sites, it will facilitate survival and further spread of both species. Further research will study coinfections among Meloidogyne spp. and other plant parasitic nematodes to understand disease severity and the evolutionary trajectories of virulent nematode populations.

The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to control these noxious weeds in future.

This study was carried out to compare the diversity in seed production and the soil seed bank in a dryland and an irrigated agroecosystem in the dry tropics. Both agroecosystems showed a comparable number of species, but only 25% and 38% similarity during the winter and rainy cropping seasons, respectively. In the irrigated agroecosystem, the amount of seed production diversity was almost double in the winter season, compared to the rainy season. The weed seedbank diversity was low but was sensitive to cropping practices and seasons in both agroecosystems. A considerably smaller soil seedbank size in the irrigated agroecosystem (cf. dryland) was related to lowered weed seed production. The dryland agroecosystem showed a greater accumulation of the seeds of broad-leaved weeds, whereas the irrigated agroecosystem accumulated more seeds of the grasses or sedges. About three-fourths of the seeds during the winter season were accounted for by Anagallis arvensis and Chenopodium album in the dryland agroecosystem and by C. album and Melilotus indica in the irrigated agroecosystem. However, during the rainy season, Ammannia baccifera, Echinochloa colona and Cyperus rotundus dominated in both agroecosystems. The changes in the weed seed bank and its diversity are mainly attributed to differences in water management, which tends to reduce species diversity, especially at a lower depth, but leads to the dominance of some potentially noxious weeds (e.g. Phalaris minor and M. indica). Approximately double the soil seedbank size and a greater diversity at a lower depth might indicate an adaptive mechanism in the storage of weed seeds in the dryland agroecosystem.